ID: 959989647

View in Genome Browser
Species Human (GRCh38)
Location 3:112616761-112616783
Sequence ATGGAGAAGCAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1994
Summary {0: 1, 1: 1, 2: 22, 3: 204, 4: 1766}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959989647_959989653 -4 Left 959989647 3:112616761-112616783 CCCTCCTTCTTCTGCTTCTCCAT 0: 1
1: 1
2: 22
3: 204
4: 1766
Right 959989653 3:112616780-112616802 CCATATCTTTGATTCGGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 55
959989647_959989650 -10 Left 959989647 3:112616761-112616783 CCCTCCTTCTTCTGCTTCTCCAT 0: 1
1: 1
2: 22
3: 204
4: 1766
Right 959989650 3:112616774-112616796 GCTTCTCCATATCTTTGATTCGG 0: 1
1: 1
2: 0
3: 19
4: 196
959989647_959989651 -9 Left 959989647 3:112616761-112616783 CCCTCCTTCTTCTGCTTCTCCAT 0: 1
1: 1
2: 22
3: 204
4: 1766
Right 959989651 3:112616775-112616797 CTTCTCCATATCTTTGATTCGGG 0: 1
1: 0
2: 0
3: 20
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959989647 Original CRISPR ATGGAGAAGCAGAAGAAGGA GGG (reversed) Exonic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900864254 1:5255899-5255921 AGGGAGGAGCAGAGGATGGAGGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902130372 1:14255139-14255161 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
902159293 1:14516811-14516833 ATAGAAAAGAAGAAGAAGGCTGG - Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
902726686 1:18340884-18340906 AAGGAGAAGAAGCAGAAGCAGGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903080863 1:20811252-20811274 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
903189612 1:21649360-21649382 ATAGAGAAGAAAAAAAAGGAAGG + Intronic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
903338093 1:22637993-22638015 AAGGTGAAGCCGAAGAAAGAGGG - Intronic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903467421 1:23561496-23561518 AAGAAGAAGAAGAAGAAGAATGG - Intergenic
903548645 1:24142658-24142680 AGTGAGAGGCAGAGGAAGGATGG + Intronic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
903959213 1:27046213-27046235 AAGGAGGAGAAGAAGAAGGTGGG - Intergenic
904107472 1:28098006-28098028 AAGGAGAAGAAGAAGAAGACTGG - Intergenic
904130027 1:28268672-28268694 AAAAAGAAGCAAAAGAAGGAAGG + Intronic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904475637 1:30762946-30762968 AAGAAGAAGAAGAAGAAGCAAGG + Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904671867 1:32171972-32171994 AGGAAGAAGAAGAAGAAGAAAGG - Exonic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
905898151 1:41562496-41562518 AAGGAGAAAGAGAGGAAGGAAGG - Intronic
905898305 1:41563427-41563449 AGGGAGGAGGGGAAGAAGGAGGG - Intronic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906114966 1:43350338-43350360 AAGAAGCAGCAGATGAAGGATGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180866 1:43817681-43817703 AAGAAGGAGAAGAAGAAGGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906289876 1:44612904-44612926 AGTGGGAAGAAGAAGAAGGAAGG + Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906511773 1:46414087-46414109 GGAAAGAAGCAGAAGAAGGAAGG - Intergenic
906516722 1:46443360-46443382 AAGAAGAAAAAGAAGAAGGAGGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
907133948 1:52121565-52121587 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907190635 1:52645033-52645055 AAGAAGAAGAAGAAGAAGTAAGG + Intronic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907203382 1:52747455-52747477 ATGGTGTAGCAGAAAAAGTATGG + Intronic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907843816 1:58185235-58185257 AGAGGGAAGCAGGAGAAGGATGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908046607 1:60177144-60177166 ATGGTGAATCAGAAGAAGCCAGG + Intergenic
908141225 1:61187370-61187392 TTGGAGAAGCAGCTGAGGGATGG - Intronic
908406656 1:63820829-63820851 ATGGAGAAACAGATGAGGAATGG + Intronic
908411243 1:63867844-63867866 AAAGAGAAGCAGATCAAGGAAGG - Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908554558 1:65244884-65244906 ATATAGAAGGAGCAGAAGGAGGG + Intergenic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
909172120 1:72310452-72310474 AAGGAGAAGGAGCAGAATGAGGG - Intergenic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909331886 1:74423216-74423238 ATGGAGAGACAAAAGAAAGAGGG - Intronic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
909779053 1:79520035-79520057 AAGAAGAAAAAGAAGAAGGAAGG + Intergenic
910162140 1:84284799-84284821 AGAAAGAAGAAGAAGAAGGAGGG + Intergenic
910275697 1:85446817-85446839 AGAGAGAAGGAGAAGAAGAAAGG - Intronic
910451991 1:87356677-87356699 ATGGTGAAGCAAAACAAAGATGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910803591 1:91168224-91168246 TTGGAGAAGCTGAAGAAGAGAGG + Intergenic
910839190 1:91545736-91545758 ATGGACAAGCAGAGGAAAGTGGG - Intergenic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
911008753 1:93255777-93255799 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
911042462 1:93601747-93601769 ATAAAGAAAAAGAAGAAGGAGGG + Intronic
911474312 1:98357485-98357507 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
911644776 1:100326550-100326572 AGGAAGGAGAAGAAGAAGGAAGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912456153 1:109798848-109798870 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
912883015 1:113437736-113437758 ATGAAGAAGAAGAAGAGGAAAGG - Intronic
913238588 1:116807188-116807210 ATGGAGAAGAATAAGAATAAAGG - Intergenic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
913692552 1:121293120-121293142 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
914145004 1:144986974-144986996 ATGGAGAAGTTGTAGAAAGAAGG - Intronic
914216072 1:145629753-145629775 ATGGAGAAGCAGAAGACCAGAGG + Intronic
914468641 1:147952406-147952428 ATGGAGAAGCAGAAGACCAGAGG + Intronic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915206388 1:154273383-154273405 ATGAGGAAGAAGAAGAAGAAGGG + Exonic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915938643 1:160104228-160104250 GTGGACAAGCAGAGGAAGCAGGG - Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916206206 1:162318641-162318663 ATCAAGAAGAAGAAGAAGAAAGG - Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916881604 1:169024426-169024448 AAGGAGAAGAGGAGGAAGGAAGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917471648 1:175330877-175330899 AGGAAGAAGCAGATGAATGAGGG - Intronic
917628165 1:176866519-176866541 AGGGAGTGGCAGAAGAGGGAGGG + Intronic
917779032 1:178371563-178371585 ATGGAGGAGGAGGAGAAGAAAGG + Intronic
917880648 1:179332544-179332566 AGGGAGAAGCGGCAGAAGGGAGG - Intronic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918876129 1:190046259-190046281 AAGGAGAAAAGGAAGAAGGAAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919062508 1:192651605-192651627 AGGAAGAAGCAAAAGTAGGAGGG + Intronic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919145886 1:193634371-193634393 AGGGAAGAGGAGAAGAAGGAAGG - Intergenic
919267303 1:195286342-195286364 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919934350 1:202241693-202241715 ATGGCAAAGCAGAAGAAGTGGGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920063264 1:203244057-203244079 AGGTAGAAGGAGAAGAAGAAGGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920185718 1:204158073-204158095 ATCCAGAAGCAGAAGAGGAAGGG - Intronic
920479871 1:206311477-206311499 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
920517438 1:206596608-206596630 ATGCAGAAGCAAAAGAAGGCTGG - Intronic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921179588 1:212621380-212621402 ATAGAGAAGCACAAAAAGCAAGG - Intergenic
921188807 1:212692163-212692185 TTGGAGATGGAGAACAAGGAGGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921366319 1:214378077-214378099 CTAGAGAAGCAGAAGATGGCAGG - Exonic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922715853 1:227871338-227871360 TTGAAGAAGCAGAACAAGGTGGG + Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072427 1:230577865-230577887 AAGGGGAAGGGGAAGAAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923329264 1:232907475-232907497 AAGAAGAAGAAGAAGAAGTAAGG + Intergenic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923712014 1:236395453-236395475 AAGGAGGAGAAGAAGAAGGGAGG + Intronic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924111882 1:240708208-240708230 ATGAAGAACGAGAAGAAAGACGG + Intergenic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924355394 1:243169575-243169597 ATGGAGAAAGAGAAGAAAAAAGG + Intronic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924448775 1:244159018-244159040 GAGGAGAAGGAGAAGAAGAAGGG - Intergenic
924481172 1:244435637-244435659 ATGGAGGAGGAAGAGAAGGATGG - Intronic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924683043 1:246257869-246257891 AGGCAGAAGCAGGAGAGGGAAGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063057218 10:2518958-2518980 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063071373 10:2669810-2669832 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063225639 10:4013027-4013049 AGGGAGAAAGAAAAGAAGGAAGG - Intergenic
1063330683 10:5155932-5155954 ATGGAGAAGAGGCAGAATGAAGG - Intergenic
1063358543 10:5427419-5427441 ATGGAGAAGGAGAAGAAGTGGGG - Intronic
1063517713 10:6712907-6712929 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064512386 10:16109878-16109900 AGGGAGAAGCAGAGGACGGGAGG + Intergenic
1064635240 10:17358589-17358611 AGGAAGAAGGAGGAGAAGGAGGG + Intronic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064850841 10:19707058-19707080 AGGGAGAAGTAGAAGAAAGGAGG - Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1064959731 10:20950459-20950481 AGGGAGAAGAGGCAGAAGGAAGG - Intronic
1065241346 10:23708346-23708368 ATTGAACAGCAGCAGAAGGAGGG + Intronic
1065257020 10:23880413-23880435 ATGGAGATAGAGTAGAAGGATGG + Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065474774 10:26122711-26122733 AAGGAGGAGAAGGAGAAGGAGGG - Intronic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1065845967 10:29743644-29743666 ATGGAGAAGCAGATAAACTACGG - Intergenic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066084841 10:31966051-31966073 ATGGCAAGGAAGAAGAAGGATGG + Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066527687 10:36298971-36298993 AAGGAGAAGGAGAAGAAGATAGG - Intergenic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067161463 10:43828396-43828418 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1067538506 10:47135035-47135057 ATGGGGAAGCAGCAGAAGTGGGG + Intergenic
1068232744 10:54191961-54191983 AAGGAGAAGGAGGGGAAGGAAGG + Intronic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068786278 10:60978727-60978749 AAGAAGAAGTAGAAGAAGAAAGG - Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069373033 10:67767147-67767169 AAGGAGAAGGAGGAGAAGGGTGG - Intergenic
1069572574 10:69503350-69503372 ATGGAGGAGCACAAGAATGCTGG - Intronic
1069580336 10:69561584-69561606 ATGCAAGAGCAGAAGAAGGGGGG + Intergenic
1069987488 10:72294299-72294321 AGGGAGAAGAGGAAGAATGAAGG + Intergenic
1070175427 10:73965710-73965732 AAGGAGAAGAAGCACAAGGACGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070578431 10:77698489-77698511 ATGATGAAGGAGGAGAAGGAGGG + Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071347928 10:84711015-84711037 AGGAAGAAGAAGAAGAATGAGGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071684773 10:87743345-87743367 AGAGGAAAGCAGAAGAAGGAAGG - Intronic
1071899875 10:90108702-90108724 ATGGAGAAAGAGCAGAGGGATGG + Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072095108 10:92170648-92170670 ATGGAGAATGAAAGGAAGGAAGG + Intronic
1072153239 10:92700169-92700191 AGTGGGGAGCAGAAGAAGGATGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072567554 10:96629940-96629962 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1072785381 10:98276044-98276066 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1072801414 10:98394798-98394820 GTGGAGAGGTAGAAGAGGGAAGG + Intronic
1072806268 10:98425641-98425663 CTGGAGAAGAAGCTGAAGGAAGG - Exonic
1072872214 10:99132585-99132607 ATGGAGAGCAAGACGAAGGAGGG + Intronic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1074193219 10:111155967-111155989 ATCCAGAACCAGAAGAATGATGG - Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074594927 10:114853954-114853976 AAGGAGAATCTGAAGAGGGAAGG + Intronic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075591503 10:123694687-123694709 AAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1075765262 10:124887844-124887866 ATGAAGACGCAGAGGAAGGGAGG + Intergenic
1076271739 10:129158517-129158539 ATGGAGAAGGAGAAGAGAGGTGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077280582 11:1743316-1743338 ATGGACAAACGGAAGATGGATGG + Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078282741 11:9919250-9919272 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1079441008 11:20514921-20514943 ATGTAAAAGCAGTAGAAGTAAGG - Intergenic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1079673112 11:23192344-23192366 AGGGAGATGAAGAAGAAGTATGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079944621 11:26726216-26726238 ATAGAGAGGGAGAAGAAGGAAGG - Intergenic
1080233110 11:30040128-30040150 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1080290551 11:30666065-30666087 AAGGAGAAGGGGGAGAAGGAGGG + Intergenic
1080601028 11:33820664-33820686 ATGGAGAAGGAGAAGAGGCTGGG - Intergenic
1080708255 11:34720019-34720041 ATGGAGAAGAGCAAGAGGGAAGG + Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081317933 11:41653344-41653366 ATCTAGATGAAGAAGAAGGAGGG - Intergenic
1081504430 11:43700514-43700536 ATGGACAGACAGTAGAAGGATGG - Intronic
1081567761 11:44270387-44270409 AAGGAACAGGAGAAGAAGGAGGG - Intronic
1081627878 11:44666330-44666352 AAGGAGAAGAAGAAGATGCAGGG - Intergenic
1082758488 11:57102465-57102487 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083001808 11:59299109-59299131 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084230779 11:67751117-67751139 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084617251 11:70244791-70244813 ATGGAGGAGGAGGAGAGGGAAGG + Intergenic
1085308026 11:75499374-75499396 AAGGAAAAGAAGAAGAAAGAAGG - Intronic
1085401032 11:76235597-76235619 AAGGAGATGCGGAAAAAGGAAGG - Intergenic
1085401035 11:76235616-76235638 ACGGAGATGCAGGAAAAGGAAGG - Intergenic
1085514316 11:77103473-77103495 AGGGAGAAGCAGAGGAGGAAAGG - Intronic
1085705983 11:78787088-78787110 GGGGAGGAGCAGAAGAAGGGAGG + Intronic
1085807669 11:79651112-79651134 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086037930 11:82439300-82439322 AAGGAGAAGCCGGAGAAGGCTGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259613 11:84923429-84923451 AAAAAGAAGAAGAAGAAGGAGGG + Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086981117 11:93198240-93198262 TTGGAGAATGCGAAGAAGGACGG + Intergenic
1087306485 11:96495482-96495504 AAGGAGGAGGAGGAGAAGGAGGG - Intronic
1087806523 11:102561381-102561403 ACAGAGAAGGAAAAGAAGGAAGG - Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088095178 11:106091446-106091468 ATGGAGAGGAAGAAAAAGAATGG + Exonic
1088381269 11:109195069-109195091 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1089484733 11:118836576-118836598 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1089659776 11:119978311-119978333 ATGGAGAAGGTGGTGAAGGAGGG + Intergenic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090084966 11:123642678-123642700 ATAGAGGAGCAGAAGAGGGTAGG + Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090246615 11:125220685-125220707 ATGGAGAAATAGAACAAGGCCGG - Intronic
1090378703 11:126309915-126309937 GTTGAGAAAAAGAAGAAGGAAGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090933333 11:131319412-131319434 ATGAAGAGGAAGGAGAAGGAGGG - Intergenic
1091166598 11:133481826-133481848 ATGGAGGAGTACAGGAAGGAGGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091905102 12:4179369-4179391 ATTTAGATGAAGAAGAAGGAGGG + Intergenic
1091919081 12:4289998-4290020 ATGGAGAGGCTGAAGAATGCTGG + Intronic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092314826 12:7399474-7399496 AGGAAGAGGAAGAAGAAGGAAGG - Intronic
1092361387 12:7839614-7839636 ATGGAGAAGATGCTGAAGGAGGG + Intronic
1092375831 12:7954878-7954900 ATGGAGAAGATGCTGAAGGAGGG + Intergenic
1092518391 12:9240152-9240174 ATGAAGAAGAGGAAGAAGGTGGG - Intergenic
1092796091 12:12111320-12111342 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1093075864 12:14758127-14758149 ATAGAAAAACACAAGAAGGAAGG + Intergenic
1093242511 12:16695573-16695595 AGGGAGGAGGAGGAGAAGGAAGG + Intergenic
1093521624 12:20057764-20057786 ATAGGAAAGAAGAAGAAGGAAGG - Intergenic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094293419 12:28877273-28877295 AAGGAGATGGAGGAGAAGGAAGG - Intergenic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094383977 12:29873560-29873582 ATAGAACAGCAGAAGAACGATGG + Intergenic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094449550 12:30570059-30570081 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1094816668 12:34193375-34193397 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095342991 12:41114207-41114229 AGGGAGAAGGATAAGAAGAAAGG + Intergenic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095719746 12:45387438-45387460 GGGGAAAAGCAGATGAAGGATGG + Intronic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096629693 12:52918113-52918135 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096725829 12:53561589-53561611 AGGGAAAGGGAGAAGAAGGAAGG + Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097098261 12:56567465-56567487 AGGAAGAAGAAGAAGAAGAAAGG + Intronic
1097206190 12:57323267-57323289 TTGGAGAAGGACAGGAAGGAAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097383872 12:58926064-58926086 AAAGAGAAGAAGAAGAAGCAAGG - Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097789121 12:63795292-63795314 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1097790678 12:63812031-63812053 AGGAGGAAGAAGAAGAAGGAGGG + Intergenic
1097973379 12:65659208-65659230 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098487073 12:71033772-71033794 ATGGAGAAGCAGACAAAGTTGGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098863544 12:75736407-75736429 ATGGAAAAGCAAATGAAGGCTGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099099982 12:78427137-78427159 ATAGAGAAGCAGAAGCCAGATGG - Intergenic
1099224208 12:79949566-79949588 ATGGAGAAATAGAAAAAGAAAGG - Intergenic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1099557801 12:84131425-84131447 GTGGAGAAGCAGAAGACATATGG + Intergenic
1100176207 12:92033881-92033903 ATGAAGAAAGAGAAGAAGAAAGG + Intronic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100702084 12:97159867-97159889 AGAGAAAAGAAGAAGAAGGATGG + Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101040174 12:100747519-100747541 ATGGTGAGGCCGGAGAAGGAGGG - Intronic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1101117480 12:101546465-101546487 ATGGAGACAGAGTAGAAGGATGG + Intergenic
1101193775 12:102361807-102361829 AAGGAGAAGAAGGAGAAGAAAGG + Intergenic
1101360529 12:104022036-104022058 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1101654417 12:106707486-106707508 GGGGAGGAGCAGCAGAAGGAGGG + Intronic
1101727025 12:107396160-107396182 GTGGAGAGGCAGAGGAAGGCTGG - Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101794126 12:107957118-107957140 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102133957 12:110557030-110557052 AGGGAGAAGCTGAAAAATGAAGG + Intronic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102194433 12:111014531-111014553 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1102243218 12:111338453-111338475 ATGAAGAAGCTGGAGAAGAAAGG + Exonic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102652488 12:114451971-114451993 AGGGAGAGGCGGAGGAAGGAAGG - Intergenic
1102749171 12:115277248-115277270 AAGAAGAAAAAGAAGAAGGACGG + Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1103172802 12:118836088-118836110 ATGGAGATGGACAAGAAGGCAGG - Intergenic
1103245755 12:119455824-119455846 AGGAAGGAGAAGAAGAAGGAAGG + Intronic
1103366999 12:120390709-120390731 AAGGAGAAGGAAAGGAAGGAAGG + Intergenic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103663457 12:122541324-122541346 AGGGAGAGACAGAGGAAGGACGG - Intronic
1103722389 12:122981762-122981784 AGGAAGAAGCTGAAGAAGAAGGG + Exonic
1104085155 12:125467435-125467457 AAGGAGAAGAAGAAGAGGGTGGG - Intronic
1104186315 12:126435471-126435493 ATTGAAAAGCAAAAGAAAGAAGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104301697 12:127570410-127570432 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104604125 12:130175510-130175532 ATGGGGAAGCAAAGGAAGGCCGG + Intergenic
1105240650 13:18606814-18606836 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1105646157 13:22320043-22320065 ATGGAGTAGCAGAACAATTAAGG - Intergenic
1105726461 13:23167075-23167097 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1105828345 13:24142705-24142727 AAGGAGGAGAAGAAGAAGGGAGG - Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106909387 13:34446918-34446940 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1106926098 13:34614787-34614809 AAGGTGGGGCAGAAGAAGGAAGG - Intergenic
1107084230 13:36408187-36408209 AAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1107510217 13:41076176-41076198 AACAGGAAGCAGAAGAAGGAGGG + Exonic
1107629863 13:42332447-42332469 GTATAGAAGGAGAAGAAGGAGGG + Intergenic
1107683997 13:42878624-42878646 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107802849 13:44126610-44126632 AGGGAGAAGTACAAGAAAGAAGG + Intergenic
1107897119 13:44976296-44976318 AAGGAGAAGGAGAAGAAAGGAGG + Intronic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108090219 13:46841695-46841717 ATGGAAAAGAAAAGGAAGGAGGG - Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108794814 13:54017974-54017996 AGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109505121 13:63290183-63290205 AAGGAAAAGCAGAAAAAGTAAGG + Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110865991 13:80397102-80397124 AAGGAGAACAAGAAGAAAGAAGG + Intergenic
1110945568 13:81411369-81411391 AAGGAGAAGGAGAAGAACGAGGG - Intergenic
1110965531 13:81690225-81690247 ATGAAGAAGAGGAAGAAGGTGGG + Intergenic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1111231588 13:85351046-85351068 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1111467837 13:88640844-88640866 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1111798434 13:92953587-92953609 ATGGTGCAGCAGCAGACGGAAGG + Intergenic
1111904253 13:94237299-94237321 ATGGAGAAAAGAAAGAAGGAAGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112447089 13:99474028-99474050 ATGGCAAAGCAGAAGATTGATGG + Intergenic
1112619582 13:101040928-101040950 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1112643170 13:101300299-101300321 AAGAGGAAGAAGAAGAAGGAGGG - Intronic
1112672435 13:101655669-101655691 ATGGAGAAGCAAATGAATGTTGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113136931 13:107101176-107101198 ATGGAGGAGGGGAAGAAAGATGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113258607 13:108534782-108534804 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114529399 14:23386409-23386431 AGGGTGAAGAAGAAGATGGAAGG - Exonic
1114534800 14:23416098-23416120 AGGGTGAAGAAGAAGATGGAAGG - Exonic
1114799403 14:25755968-25755990 ATGGAGAAATAGAAGAATGCTGG - Intergenic
1115018528 14:28646373-28646395 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1115018535 14:28646398-28646420 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115293728 14:31802265-31802287 AAGAAGAAGAAGAAGAAGAAGGG - Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116010621 14:39347407-39347429 AGGGAGGAGGAAAAGAAGGAAGG + Intronic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255846 14:42554274-42554296 AGGAAGGAGGAGAAGAAGGAAGG + Intergenic
1116524776 14:45891124-45891146 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1116717941 14:48451333-48451355 GAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117473562 14:56071015-56071037 ATGTGGAAGGAGAAGAAGGCAGG + Intergenic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1117776817 14:59191311-59191333 GTAGACAAGCAGAAGAATGAAGG - Intronic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119186888 14:72649471-72649493 AGTGAGAAGAGGAAGAAGGAAGG + Intronic
1119199834 14:72744149-72744171 ATAAAGAAACAGAAGAGGGATGG + Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119409978 14:74424578-74424600 ATGGAAGAGGAGAAGAAGGGAGG + Intronic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119535812 14:75401637-75401659 ACGGAAAGGCAGAAGAACGATGG + Intergenic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120436317 14:84487396-84487418 AAGGAGAAGAAGATGAAGAAGGG + Intergenic
1120774447 14:88418135-88418157 ATGATGAAGAAGAAGAATGAAGG - Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121096871 14:91223480-91223502 AGGAAGAAGAAGAAGAGGGAAGG + Intronic
1121141375 14:91545386-91545408 ATGGAAAAGAAAAAGAAAGAAGG - Intergenic
1121146232 14:91584987-91585009 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121726546 14:96156223-96156245 AGAGAGAGGGAGAAGAAGGAAGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121873713 14:97432088-97432110 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1121979508 14:98442485-98442507 ATTGAGACCCAGAAGAACGATGG + Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122589122 14:102833451-102833473 AGGGAAAAGCAAAGGAAGGAAGG - Intronic
1122765654 14:104067806-104067828 ATGGTGGAGCAGAAGAGAGAGGG + Intergenic
1122877048 14:104672428-104672450 TTTGGGAAGCAGAGGAAGGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123875898 15:24623528-24623550 ATAAAGAAGAAGAAGAAGAAAGG - Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1124012420 15:25849488-25849510 TTGGAGAAGGCGTAGAAGGAGGG - Intronic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125303454 15:38282613-38282635 ATGGATAAGCAGTGGTAGGATGG + Intronic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1125684668 15:41556849-41556871 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1125886781 15:43235312-43235334 AGGGGGAAGGAGAAGAGGGAAGG + Intronic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126620466 15:50634381-50634403 ATAAACAAACAGAAGAAGGAGGG - Exonic
1126904893 15:53353972-53353994 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1127052080 15:55094962-55094984 ATGAAGAAGATGAAGAGGGAGGG - Intergenic
1127122100 15:55780570-55780592 AAGCAGAAGAAGAAGAAGAAAGG + Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127226913 15:56940734-56940756 AAGGAGAAGGAGGAGAAGGGGGG - Intronic
1127363369 15:58264663-58264685 AGGGAGAAGAGGGAGAAGGAGGG - Intronic
1127647075 15:60969574-60969596 ATGGAGAAGGAGATGAAGACAGG + Intronic
1128121454 15:65150853-65150875 CTGGAGTTGAAGAAGAAGGATGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128308479 15:66615546-66615568 ATGGACAGGCAGATGATGGAAGG + Intronic
1128522896 15:68387119-68387141 ATGGAAAAGTAGAAGAAGGTAGG + Intronic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129834952 15:78696578-78696600 ATGGAGATAGAGTAGAAGGATGG - Intronic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1129932603 15:79424876-79424898 GTGGAGAAGAAATAGAAGGAAGG + Intronic
1130127420 15:81105381-81105403 ATGGAGGAAGGGAAGAAGGAAGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130397569 15:83516602-83516624 ATGGCAAAGCAGAACAAGGGTGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130641445 15:85679434-85679456 AGGGAGAACCAAAAGAAGGGAGG + Intronic
1130825577 15:87542058-87542080 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1130866244 15:87935563-87935585 ATGCAGAAGAAGAAGAAGAAGGG + Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014138 15:89043466-89043488 AAGGAGAAGGAGAGGAAGAAGGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131069486 15:89456817-89456839 TTGGAGCAGCAAAGGAAGGAGGG + Intergenic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131110165 15:89759952-89759974 ATAAAGAAGAAGAAGAAAGATGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131328697 15:91474326-91474348 ACAGAAAGGCAGAAGAAGGAAGG - Intergenic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131413239 15:92228826-92228848 AAGGGGAAGCAGAACAAGAAAGG + Intergenic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131856718 15:96605178-96605200 ATGGAAGAGCAGAGGAACGAAGG + Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131960041 15:97780612-97780634 GTGGGGAAGGACAAGAAGGAAGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132855897 16:2044403-2044425 GCGGGGAAGCAGAGGAAGGAAGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133460685 16:5983986-5984008 AAGGAGAAGAAGAAGAATGTGGG - Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1134031877 16:10998652-10998674 AAGGAGAAGAAGGAGAAGGGAGG - Intronic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1134324286 16:13192880-13192902 AAAGAGAAGAAGAAGAAAGAAGG + Intronic
1134690959 16:16190870-16190892 ATGGAGCTGGAGAAGAGGGAGGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135618622 16:23933814-23933836 ATCGACAAACAGAAGATGGATGG - Intronic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136168233 16:28470711-28470733 GTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136387322 16:29937195-29937217 ATAAAAAAGCAGAAGAAGAAAGG + Intergenic
1136539107 16:30918743-30918765 AGGAGGAAGGAGAAGAAGGAAGG - Intergenic
1136539128 16:30918976-30918998 GAGGAGAAGGAGAAGAAGAAAGG - Intergenic
1137219770 16:46437160-46437182 AAGGAAAAGGAAAAGAAGGAAGG - Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137639254 16:50013928-50013950 ATGGTGAAGCAGGGGAGGGAAGG - Intergenic
1137699448 16:50486183-50486205 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1137767725 16:50991059-50991081 AAGGAACAGGAGAAGAAGGAAGG + Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138494728 16:57401042-57401064 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1138628944 16:58278217-58278239 AAGGAGAGGAAGAGGAAGGAGGG + Intronic
1138777744 16:59744591-59744613 ATAGAGAAGGAAAGGAAGGAAGG - Intronic
1139128460 16:64110894-64110916 ATGGTGAATCAGAAGAAAGCTGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139306442 16:65990268-65990290 ATAGAGAAAGAGAGGAAGGAAGG + Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1140025115 16:71281501-71281523 ATGGAAAAGTAGAAGAAGACAGG - Exonic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141221924 16:82078835-82078857 ATGGAGATAGAGTAGAAGGATGG + Intronic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141373412 16:83508042-83508064 AGAGAGAAAGAGAAGAAGGAAGG + Intronic
1141411643 16:83838262-83838284 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141856222 16:86683103-86683125 GGGGAGAAGGAAAAGAAGGAAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141898404 16:86973660-86973682 ACAGAGAAGCAGCAGAAGGGTGG + Intergenic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1142305657 16:89283501-89283523 CGAGAGAAGGAGAAGAAGGATGG - Exonic
1203139535 16_KI270728v1_random:1752046-1752068 AAGAAGAAGAAGAAGAAGAATGG - Intergenic
1142858334 17:2745911-2745933 TCAGAGAACCAGAAGAAGGAGGG - Intergenic
1142905048 17:3035719-3035741 AGGGAGGAGGAGAACAAGGATGG + Exonic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1143451573 17:7039855-7039877 GTTGAGAAGCAGAAGAAGTGGGG - Exonic
1143480943 17:7227029-7227051 TTGGAGAGGCAGAACAAGGTAGG + Intronic
1143712455 17:8744074-8744096 ATGGTGCAGAAGAAGAAGGTGGG - Exonic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143976207 17:10831795-10831817 ATGGAGGAGCAGGAGAAGCCTGG + Intronic
1144035033 17:11357214-11357236 AAGAAGAAGAAGAAGAAGCAGGG + Intronic
1144058042 17:11558981-11559003 ATGGGGAGGCAGCTGAAGGAAGG - Exonic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144235665 17:13258067-13258089 AAGGAGAAGGGGAAGAAGAAGGG - Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144360239 17:14485220-14485242 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144540087 17:16132913-16132935 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1144646149 17:16974929-16974951 AAGGAGAAAGAGGAGAAGGAAGG + Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147256108 17:39183347-39183369 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147450510 17:40501142-40501164 ATGGAGAAGCTGAAGACAAAAGG + Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1147834003 17:43317153-43317175 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1147946815 17:44084989-44085011 GTTGAGAGCCAGAAGAAGGAGGG + Intronic
1148271450 17:46265244-46265266 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148616861 17:49007279-49007301 CTACAGAAGCAGAAGAAGTAGGG - Intronic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1148885399 17:50768518-50768540 ATGGAGAGGCGGAAGTAGCAGGG + Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149235658 17:54587707-54587729 ATAGAGATTCAGTAGAAGGATGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150565181 17:66332571-66332593 GTGGAGAAGCTGCAGAGGGAGGG + Intronic
1150605573 17:66687781-66687803 GTAGAGAAGGGGAAGAAGGAAGG + Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1150771996 17:68050193-68050215 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150772007 17:68050257-68050279 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150841667 17:68613302-68613324 ATAGGGAAGAGGAAGAAGGAAGG - Intergenic
1150918496 17:69459945-69459967 AGGGAGAAGGAAAGGAAGGAAGG - Intronic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151271551 17:73000234-73000256 AGGGAGAAGGAGAAGAAGAGGGG - Intronic
1151327640 17:73388873-73388895 AGGGAGAAGGAAGAGAAGGAGGG - Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1151960229 17:77401966-77401988 AAGGAGCAGCAGAGGAAGGCAGG - Intronic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152084072 17:78206692-78206714 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152462436 17:80448650-80448672 AGGGAGGAGGAGAAGAGGGAAGG - Intergenic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1203170238 17_GL000205v2_random:141719-141741 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1153100641 18:1465182-1465204 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153460580 18:5328397-5328419 AAAAAGAAGAAGAAGAAGGAAGG + Intergenic
1153509453 18:5835926-5835948 AGGGAGTAGAAGAAGAGGGAAGG + Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154448226 18:14452245-14452267 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155317045 18:24582257-24582279 ATTGAGACGGAGAAGAAGGGAGG - Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155417476 18:25614488-25614510 AAGGAAAAGTAGAAAAAGGAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1155986740 18:32238220-32238242 AAGGGGAAGCTGAAGAATGATGG + Intronic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156315458 18:35965129-35965151 AAGGAGAAGGAGAAAAAAGAAGG - Intergenic
1156511337 18:37639465-37639487 AGGAAGAAGAGGAAGAAGGAAGG - Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157031336 18:43912118-43912140 GGGAAGAAGCAGAAGAAGAAAGG - Intergenic
1157134034 18:45036702-45036724 ATGGAGAATAGGAGGAAGGAAGG + Intronic
1157237598 18:45979151-45979173 AGGGAGAAGAAGAAGAAGAGAGG - Intergenic
1157369634 18:47098995-47099017 AAGGAGAAGAAAGAGAAGGAAGG - Intronic
1157429328 18:47611628-47611650 AGGGAAAAGCAGAGGAAGGCAGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1158040408 18:53086228-53086250 AGGAAGAAGAAGAAGAAGAACGG - Intronic
1158040409 18:53086248-53086270 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040410 18:53086274-53086296 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040411 18:53086297-53086319 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040412 18:53086323-53086345 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040413 18:53086352-53086374 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040414 18:53086378-53086400 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040415 18:53086401-53086423 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040416 18:53086427-53086449 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040417 18:53086450-53086472 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158197057 18:54899642-54899664 AAGAGGAAGAAGAAGAAGGAAGG - Intergenic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158333997 18:56394897-56394919 ATGGGGAGGCAGAAGAAGATAGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158423121 18:57313477-57313499 GGGGAGAAGGAGGAGAAGGAAGG + Intergenic
1158506075 18:58046296-58046318 ATGGAGAAGTAGAGGATGCAAGG - Intronic
1158682905 18:59584671-59584693 ATGGTGAAGCACAAGCAAGAGGG - Intronic
1158812018 18:61048875-61048897 ATGGAAGAGCATAAGAAGAAAGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158840744 18:61383872-61383894 AGGGAGAAGCTGAAGTAGTAGGG + Intronic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159150632 18:64518742-64518764 AAGGAGAAGGAAAGGAAGGAGGG - Intergenic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1159850313 18:73519569-73519591 TTAGAGAGGCAGAAGAAGGTGGG - Intergenic
1159877391 18:73827645-73827667 AGGGAGGAGCAAGAGAAGGATGG + Intergenic
1159971304 18:74657899-74657921 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161428956 19:4219741-4219763 AAGGAGAAGGACAAGAAGGTGGG + Exonic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161446030 19:4319684-4319706 AGGGAGAAGCAGAAGATATAGGG + Intronic
1161647589 19:5463381-5463403 AAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1161701163 19:5796352-5796374 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1161751717 19:6102577-6102599 AAGGAGAGGCAGAAGAGGCAGGG - Intronic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161918332 19:7247399-7247421 ATCGAGAAGAGGAACAAGGAAGG - Intronic
1161958008 19:7506885-7506907 AGGGAGGAGCCAAAGAAGGAGGG - Intronic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162076586 19:8191965-8191987 AAGGAGGAGGAGGAGAAGGAGGG + Intronic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162791569 19:13065731-13065753 ATGGAGCGGCAGAAGAAGCCAGG - Intronic
1162846062 19:13393564-13393586 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163235657 19:16029087-16029109 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1163353814 19:16796648-16796670 AATGAGAAGGGGAAGAAGGAAGG - Intronic
1163463092 19:17450740-17450762 AAGGAGGAGGAGGAGAAGGAAGG - Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1163818068 19:19479762-19479784 ATGGTGGAGCAGGGGAAGGAGGG - Intronic
1164397501 19:27878816-27878838 AAGGAGAAAAAGAAGAAGTAGGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164511862 19:28904109-28904131 ATGGGGAAGTGGAAGAAGAAAGG - Intergenic
1164588640 19:29494333-29494355 ATGGAGGAAGGGAAGAAGGAAGG + Intergenic
1164591928 19:29512133-29512155 ATGAAGAGGAAGAAGAGGGAGGG + Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1164763183 19:30743568-30743590 AAGGAGAGGAGGAAGAAGGAAGG - Intergenic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1164788018 19:30952207-30952229 AGGAAGAAGCAAAAGAGGGAGGG - Intergenic
1164896716 19:31883264-31883286 ACGGAGAAGTAGAAGAGAGAAGG + Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165817074 19:38648747-38648769 ATGGAGAAGCCGAAGTAGAGGGG + Intronic
1165847388 19:38827042-38827064 AGGGAGAAGGAGGGGAAGGAGGG + Intronic
1165912358 19:39237130-39237152 AGGGAGAAGGAGAAGATGAAGGG + Intergenic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166008621 19:39925123-39925145 AAGAAGAAGAAGAAGAGGGAAGG + Intronic
1166104253 19:40589688-40589710 AGGAAGGAGCAGAAGAAAGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166353296 19:42211390-42211412 AGGGAGAAGAAAAGGAAGGAAGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166548578 19:43649659-43649681 AAGGAGAAGGGAAAGAAGGAAGG + Intronic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167501423 19:49850930-49850952 ATGGGGTGGCAGAAGAACGAAGG - Intronic
1167579084 19:50331530-50331552 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579096 19:50331570-50331592 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579108 19:50331610-50331632 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167604299 19:50473288-50473310 AGGGAGAAATAGAGGAAGGAGGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167634243 19:50644785-50644807 ATGGAGAATTAGATAAAGGATGG + Intronic
1167706403 19:51083736-51083758 ATAGAAAAGCAAAAGACGGAGGG + Intronic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1167845913 19:52164018-52164040 AAGGAAAAGAAAAAGAAGGAAGG + Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
925231456 2:2236755-2236777 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
925259148 2:2515094-2515116 ATTAAGAAGAAGAAGAAGAAAGG - Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925684079 2:6453285-6453307 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
925842592 2:8006585-8006607 AGGGAGGAGGAAAAGAAGGATGG - Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
926334486 2:11853040-11853062 AGGGGGAAGGGGAAGAAGGAAGG + Intergenic
926334892 2:11855612-11855634 ATGGCAAAGAAGAAGAAGGCAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926537156 2:14127560-14127582 ATGGTGAAGCAGGAGAGAGACGG + Intergenic
926591866 2:14749124-14749146 TTGGACAAGCAGGAGAAGGTTGG + Intergenic
926598477 2:14816016-14816038 ATGGAGAGGCAAAAGAATAAAGG - Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
926829035 2:16940169-16940191 ATGGTGGAGCTGAAGAAAGAGGG - Intergenic
927260469 2:21083499-21083521 ATGGGGAAGCAGAAGAGTGCTGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927866198 2:26589228-26589250 AAGGAGAAGTAGAAGAAGAGGGG - Intronic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
927923756 2:26994804-26994826 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
928108440 2:28488172-28488194 GAGGAGAAGGAGGAGAAGGAGGG + Intronic
928148980 2:28809690-28809712 GTGTGGAAGCACAAGAAGGAAGG + Intronic
928268248 2:29830992-29831014 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
928268281 2:29831105-29831127 GAGGAGAAGAAGAAGAAGAAGGG + Intronic
928320566 2:30279978-30280000 GAGGAGAAGAAGAAGAAGAATGG - Intronic
928454711 2:31409104-31409126 ATGGAGATAGAGTAGAAGGATGG + Intronic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
928687981 2:33768953-33768975 AGGGAAAAGCAGGAGAAGGGTGG + Intergenic
928781949 2:34833876-34833898 GTGGAGAAGGGGAAGAAGAAGGG + Intergenic
929242530 2:39666549-39666571 AAGGAGAGGGAGAAGAAGGGAGG - Intronic
929374080 2:41262952-41262974 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930140908 2:47950575-47950597 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930271303 2:49260774-49260796 ATTATGATGCAGAAGAAGGATGG + Intergenic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931482516 2:62656150-62656172 AGAGTGAAGAAGAAGAAGGAAGG - Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931771365 2:65500829-65500851 ACGGAGAAGCAGCAGATGAAAGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931992793 2:67807873-67807895 AAGGGGAAGAAGAAGAAGAAGGG - Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932766012 2:74470638-74470660 ATAGAGAAGAAAAAGAATGAAGG + Intergenic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933427877 2:82136055-82136077 AGGGAGAAGTAGGAGAAGGGAGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933909182 2:86924044-86924066 ATCTACCAGCAGAAGAAGGATGG - Intronic
933928772 2:87126624-87126646 ATCTACCAGCAGAAGAAGGATGG - Intergenic
933998740 2:87688910-87688932 AAGAAGAAGAAGAAGAAGCATGG + Intergenic
934000105 2:87702409-87702431 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934023542 2:87979341-87979363 ATCTACCAGCAGAAGAAGGATGG + Intergenic
934107899 2:88712854-88712876 AAGAAGAAGAAGAAGAAGCAAGG - Intronic
934166666 2:89300163-89300185 ATGGGGAATCAGCAGAAGTACGG - Intergenic
934200615 2:89882294-89882316 ATGGGGAATCAGCAGAAGTACGG + Intergenic
934526480 2:95055273-95055295 AAAAAGAAGAAGAAGAAGGAGGG + Intergenic
935001380 2:99019570-99019592 ATGGGGAAGGATAAGAAGCATGG - Intronic
935013515 2:99157722-99157744 ACGGACATACAGAAGAAGGAGGG - Intronic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935309970 2:101773763-101773785 ATGGAGATATAGTAGAAGGATGG - Intronic
935629618 2:105202378-105202400 ATGGTGAAGCAGGAGAGAGAGGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936295110 2:111261968-111261990 AAGAAGAAGAAGAAGAAGCATGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936502494 2:113077416-113077438 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
936783846 2:116068356-116068378 ATAGAGTAGAAGATGAAGGATGG - Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936870701 2:117131948-117131970 AAGGAGCAGCCTAAGAAGGAGGG - Intergenic
936885486 2:117306269-117306291 ATGGAGAGAGAGTAGAAGGATGG + Intergenic
936929218 2:117769880-117769902 ATAAAGAAGAAGAAGAAGAAGGG + Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937169583 2:119852196-119852218 AAGGAGAAGCGGAAAAAAGAAGG - Intronic
937285258 2:120746524-120746546 AAACAGAAGCAGAAGAAAGAGGG - Intronic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937791275 2:125964933-125964955 AGGGAAATGCAGATGAAGGAGGG + Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
937934882 2:127235320-127235342 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
937969413 2:127537723-127537745 AAGGAGGAGGAGGAGAAGGAAGG + Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
938742444 2:134245601-134245623 AAGGAGAAGCAGAGGAGGAAGGG - Intronic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
939014181 2:136882376-136882398 AGAAAGAAGAAGAAGAAGGATGG - Intronic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939276590 2:140005573-140005595 ATGGAGATAGAGAAGAATGATGG + Intergenic
939320369 2:140612422-140612444 ATGGGGATGAAGATGAAGGAAGG - Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
940124773 2:150311160-150311182 ATGGAGAACTAGCAGAAGCAGGG + Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940322173 2:152389303-152389325 ATGAAGATACAGCAGAAGGATGG - Intronic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
942962146 2:181843670-181843692 ATGGATATGTAGAAGAGGGAGGG + Intergenic
942998051 2:182289041-182289063 ATGGACAACCAGAAGTAGCAAGG - Intronic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943575936 2:189631096-189631118 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
943839068 2:192554275-192554297 AAGGAGAAGAAGAGGAAGAAAGG + Intergenic
943860067 2:192850169-192850191 ATAGAGAAGCCTAAGAAGGGGGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945155162 2:206830426-206830448 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
945284241 2:208066132-208066154 AGGGAGAAGCAGAAAAAGCCAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945897363 2:215498723-215498745 ATCGACAAGCAGCAGAAGGCAGG - Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946076477 2:217077743-217077765 ATGAAAAAGCAGAACAAAGAGGG - Intergenic
946149709 2:217756066-217756088 ATGCAGAGGCAGAAAAATGAGGG - Exonic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946346486 2:219115166-219115188 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
946526966 2:220531042-220531064 ATGGAATAGCAGAAAAAGTATGG + Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947395927 2:229686623-229686645 ATGGAGGAGCAGCAGAAGACAGG - Intronic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
948100760 2:235370925-235370947 ATGGAGAAGCATAAGATGAGAGG - Intergenic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948488314 2:238295350-238295372 GAGAAGAAGTAGAAGAAGGAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169655242 20:7915353-7915375 AAGGGGAAGGAGAAGAAGAAGGG + Intronic
1169663461 20:8006684-8006706 ATAGAGAGGGAGAAGTAGGAGGG - Intronic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1169748250 20:8964736-8964758 AGGGAGAAACAGAGGAATGAAGG + Intronic
1169940037 20:10927033-10927055 AAGAAGAAGAAGAAGAAGCATGG + Intergenic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170117584 20:12877124-12877146 ATGGAAAAGCAGGGGATGGAGGG + Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170623368 20:18012110-18012132 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1170815186 20:19708074-19708096 AGGGAGAATCAGAAGAAAGGGGG + Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171178743 20:23075575-23075597 ATGGAAAAGAAAAAGAAGGCCGG + Intergenic
1171202629 20:23254531-23254553 AGGATGAAGGAGAAGAAGGAAGG + Intergenic
1171820387 20:29831223-29831245 ATGGAGAACCACGAGAAAGAAGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1171897454 20:30821921-30821943 AAGGAGAACCAGGAGAAAGAAGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172065795 20:32219390-32219412 ATGGTGAAGGAGCAGAAAGAAGG + Intronic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1172536908 20:35680992-35681014 AAGGAGAAGGGGTAGAAGGAGGG - Intronic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1172928641 20:38564911-38564933 AAGAAGAAGAAGAAGAAGAAGGG - Intronic
1173053942 20:39593034-39593056 ATGGAGTAGCTGCAGAATGAAGG + Intergenic
1173131946 20:40402194-40402216 ATGGGGAGTCAGAAGAAGTAAGG - Intergenic
1173133269 20:40414590-40414612 AGGGAGAAGCCAAAGAAGGGAGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173564125 20:44027322-44027344 ACGGGGAAACATAAGAAGGAGGG - Intronic
1173667748 20:44774842-44774864 ATGGAGAGGCAGCAGACGCAAGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174119049 20:48248598-48248620 ATTGAGAAGCAGGAGAGGGGTGG - Intergenic
1174166093 20:48584539-48584561 AAGGGGACGTAGAAGAAGGAAGG - Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174709505 20:52690030-52690052 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1175296327 20:57911259-57911281 AGAGAGAAGAAGAGGAAGGAAGG + Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175682827 20:61003593-61003615 ATTGAGAAGTGGCAGAAGGAGGG - Intergenic
1175978566 20:62725786-62725808 AGGGAGAGGGAGAAGAAGGGAGG + Intronic
1176326229 21:5503515-5503537 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176401528 21:6317436-6317458 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1176422044 21:6523931-6523953 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1176435629 21:6671668-6671690 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176459891 21:6998738-6998760 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176483452 21:7380516-7380538 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1176671555 21:9739510-9739532 TGGGAGAAGAAGAAGAAAGAAGG + Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177024233 21:15902427-15902449 ATGGAGATAGAGTAGAAGGATGG + Intergenic
1177057119 21:16319636-16319658 AGGAAGAAGAAGAAGAAGAAAGG - Intergenic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1178016125 21:28347596-28347618 AAGGAGAAGGAGAAGAAAAAGGG - Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178348321 21:31851155-31851177 TTGGAGGAGCAGAGGAGGGAGGG - Intergenic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178752504 21:35318054-35318076 AGGGCTAAGCAGAAGAAGCATGG + Intronic
1179137541 21:38693413-38693435 ATGGAGATGAAGAGGATGGATGG - Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179548613 21:42128548-42128570 ATAGAGAAGCAACACAAGGAAGG + Intronic
1179697534 21:43132246-43132268 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180013087 21:45064252-45064274 AGGGAGAGGAAGAAGAAGGGTGG - Intergenic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1180903742 22:19393864-19393886 ATGGAGAAGCATAAGACGAGTGG + Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181786029 22:25227931-25227953 ATGGACCAGCAGCCGAAGGACGG + Exonic
1181886029 22:26023107-26023129 GTGGTGATGGAGAAGAAGGAAGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182016633 22:27045879-27045901 ATGGAGAGGCCGCAGAATGAGGG - Intergenic
1182048994 22:27298997-27299019 AAGGAGAAAGAGAAGAAGAAGGG + Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182466783 22:30521859-30521881 AAGGAAAAGAAAAAGAAGGAAGG - Intergenic
1182550563 22:31098809-31098831 ATTGAGAAGCTGGAGAAGGAGGG + Exonic
1182738376 22:32547443-32547465 AATGAGAAGGAGAAGAAGAATGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182799533 22:33020303-33020325 ATTGAGAAGAAGAAGAAGTGAGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1182973012 22:34595292-34595314 AAGGAGATGGGGAAGAAGGAAGG + Intergenic
1183091100 22:35522770-35522792 AGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183499311 22:38168940-38168962 ATGGACAAAGGGAAGAAGGAAGG - Intronic
1183573163 22:38669449-38669471 ATGCAGAAGTGGATGAAGGAGGG + Intronic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184815789 22:46868751-46868773 AAGGAGAAGAGGAAGAAGCATGG - Intronic
1184959117 22:47916076-47916098 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185035534 22:48474779-48474801 AAGGAAAAGCAGAAAAAGCAGGG + Intergenic
1185037057 22:48484878-48484900 AAGGAGAAGGAAGAGAAGGAGGG - Intergenic
1185329044 22:50243636-50243658 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949295321 3:2514917-2514939 AGGGGGTAGCAGAAGATGGAGGG - Intronic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950299660 3:11865803-11865825 ATGGAAAACAAAAAGAAGGAGGG - Intergenic
950403648 3:12790516-12790538 ATTCAGAAGAAGAAGAAGGGTGG + Intergenic
950590621 3:13933709-13933731 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950711802 3:14818526-14818548 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
951397845 3:22192040-22192062 ATGGAGAAAGAGATGAATGATGG - Intronic
951530763 3:23696051-23696073 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
951704344 3:25528527-25528549 CTGGAGGAGGAGTAGAAGGAAGG + Intronic
951729598 3:25796061-25796083 AAGGAGAAGATAAAGAAGGAAGG + Intergenic
952056811 3:29457157-29457179 ATGGAGGTGGAGAAGAAGGGAGG - Intronic
952108503 3:30095971-30095993 AGGGAGAAACAGAGGAAGGGAGG - Intergenic
952139330 3:30460428-30460450 ATGGAGATAGAGTAGAAGGATGG + Intergenic
952174068 3:30842547-30842569 ATGGAGAAAGGGAGGAAGGAAGG + Intronic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
952708873 3:36408648-36408670 ATTCAGAAGCAGAAGAATGATGG - Intronic
952783867 3:37132663-37132685 ATGGATAAGCAGGAGTAGCAAGG + Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953295541 3:41711858-41711880 ATGGAGGACCAAAAGAAGCATGG + Intronic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955103518 3:55874706-55874728 ATGGAGAAGCTACAGAAGTAGGG + Intronic
955292766 3:57707772-57707794 ATGGAGACAGAGTAGAAGGATGG + Intergenic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955515162 3:59719185-59719207 ATCGAGAAGCACAAGAATTAGGG - Intergenic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
956198845 3:66684173-66684195 AAGTAGAAGAAGGAGAAGGAGGG - Intergenic
956705730 3:71997442-71997464 ATGAAGAAGAAGAAGAAAGGAGG + Intergenic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956864654 3:73357086-73357108 AGGGAGGGTCAGAAGAAGGAAGG - Intergenic
957047336 3:75386185-75386207 AGAAAGAAGGAGAAGAAGGAAGG + Intergenic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957169832 3:76724174-76724196 ATGGAGAAGCAAATGAAGACAGG - Intronic
957334163 3:78805326-78805348 ATTAAGAAACAAAAGAAGGAGGG - Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957680190 3:83424018-83424040 GTGGAGTACCAGATGAAGGAAGG + Intergenic
957894139 3:86398381-86398403 TTAGAGAAGGAGAAGAAGGGAGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958111983 3:89159940-89159962 AGGAAGAAGGAAAAGAAGGAAGG - Intronic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958154594 3:89740352-89740374 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
958612695 3:96447730-96447752 ATGGATAATAAGTAGAAGGATGG + Intergenic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959460551 3:106620748-106620770 ATAGAGAAGAAAGAGAAGGAAGG + Intergenic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960066164 3:113375437-113375459 ATGGAGAAAGACAAAAAGGATGG + Intronic
960155577 3:114294381-114294403 AAGGAGCAGGAGAAGAAGAAGGG + Intronic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960680170 3:120239394-120239416 AGGAAGAAGAAGAAGAAGAAGGG - Intronic
960840039 3:121948402-121948424 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961259133 3:125585733-125585755 ATGGAAAAGGGGAAGAATGAGGG - Intronic
961405544 3:126677160-126677182 AGGAAGAAGCAGAAGAAAGGAGG + Intergenic
961542547 3:127609807-127609829 ACTGAGAAACAGAGGAAGGAAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
962627443 3:137239880-137239902 ATGGAGAAAGAGAGGAAGGTGGG + Intergenic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
963090477 3:141478985-141479007 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963465182 3:145670438-145670460 ATAGAGAAGCAGAACCAGTAGGG - Intergenic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963584537 3:147168390-147168412 AAGGAGAAGGAGAAGAAGAGAGG + Intergenic
963711817 3:148755212-148755234 ATGGGGGAGCAGGAGAAGAAAGG - Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963988220 3:151622480-151622502 AAGGAGGAGAAGAAGAAAGATGG - Intergenic
964548569 3:157861607-157861629 ACATAGAAGCAGAAGAAGGGTGG + Intergenic
964703456 3:159593707-159593729 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
964704657 3:159605174-159605196 AGGGCGAAGCATTAGAAGGAGGG + Intronic
964778124 3:160303042-160303064 ATAGAAAACCAGAAGAAGAATGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965117362 3:164508454-164508476 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965551267 3:169967071-169967093 GTGGAGCAGCAGGGGAAGGAAGG + Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
965985684 3:174750398-174750420 AAGAAGAAGAAGAAGAAGAATGG - Intronic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966472484 3:180306824-180306846 ATGCAGAGGAAGAAGAAAGAGGG - Intergenic
966522167 3:180885606-180885628 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967344058 3:188433761-188433783 AGAGAGAAGGAAAAGAAGGAAGG + Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
967691568 3:192479979-192480001 ATTGAGAAAGAGAAGAAAGAAGG + Intronic
967861593 3:194155997-194156019 GTAGGGAAGCAGAGGAAGGAAGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967997081 3:195174766-195174788 AAGGAGAAGGAGAAGAGGAAGGG - Intronic
968292725 3:197551248-197551270 ATGGAGATGTAGTAGAATGATGG - Intronic
968292861 3:197552470-197552492 ATGGAGACCCAGAACATGGAGGG - Intronic
968460684 4:723404-723426 CTTGGGAAGCAGAAGAAGGTGGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968835736 4:2963297-2963319 ATGGCGAAGGCGAAGAAGGTCGG - Exonic
968978660 4:3835053-3835075 ATGGAGAGAGAGAAGAGGGAAGG + Intergenic
968991632 4:3917301-3917323 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969848881 4:9941528-9941550 AGGGAGAAGAAGTGGAAGGAGGG + Intronic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970010629 4:11454995-11455017 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970122162 4:12768182-12768204 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
970219689 4:13797969-13797991 AGGAAGAAGGAGAAGAAAGAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970341852 4:15115683-15115705 AGGGAGGAGGAGGAGAAGGAAGG - Intergenic
970838382 4:20438135-20438157 TTGGAGAATCATAAGAAGGGAGG - Intronic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971094925 4:23389883-23389905 ATGGAGGAGCACATGAATGAAGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
972675274 4:41254535-41254557 AAGAAGAAGAAGAAGAAGTAGGG - Intergenic
972917391 4:43897469-43897491 ATGGAGAATGAGCAGAAGCAGGG - Intergenic
973291167 4:48472198-48472220 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
973306684 4:48659951-48659973 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
973307610 4:48670627-48670649 ATGGAGATAGAGTAGAAGGATGG - Intronic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
973666528 4:53164811-53164833 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974826718 4:67140552-67140574 AAGGAGAAGCAAAAGAAAAAAGG + Intergenic
974962838 4:68725013-68725035 ATGGATAGGTAGCAGAAGGAGGG + Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975035670 4:69677275-69677297 ATAGACATACAGAAGAAGGATGG + Intergenic
975375554 4:73640051-73640073 ATGGAGATGGAGTAGAAGAAGGG - Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976293812 4:83449379-83449401 AGAGAGAAGCAGGGGAAGGAGGG + Intronic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
976960024 4:90958882-90958904 AAGTAGAGACAGAAGAAGGATGG - Intronic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
978021244 4:103815511-103815533 ATGAAGAAAAAGGAGAAGGAAGG - Intergenic
978268527 4:106858860-106858882 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978912686 4:114082977-114082999 ATGGAGGAGCCCAAGAATGAAGG + Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979220182 4:118214225-118214247 ATGAAGATGAAGAAGAAGGTAGG + Intronic
979246410 4:118510061-118510083 ATGGAGAAAGAGAAGAAAAAAGG - Intergenic
979823879 4:125208689-125208711 ATGAAGAAGTATAAGAAAGAGGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980127883 4:128790839-128790861 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
980190662 4:129520370-129520392 ATAGAGGAGAAGGAGAAGGAAGG + Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980689893 4:136281524-136281546 AAGGACAAGAAGAAGAAGGTGGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980838271 4:138224785-138224807 AGGAAGAAGGAAAAGAAGGAAGG + Intronic
980884957 4:138752352-138752374 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981056004 4:140362273-140362295 AAGAAGAAGAAGAAGAAGTAAGG - Intronic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981514027 4:145587770-145587792 GTGGAGGAGGAGGAGAAGGAAGG + Intergenic
982397563 4:154928506-154928528 ATGGAGAAGGAAATGAGGGAAGG + Intergenic
982473304 4:155820313-155820335 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
982504175 4:156197018-156197040 ATGGGGAGCCAGAAGAAGCATGG - Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982893751 4:160890200-160890222 ATGCAGAAGCAAGAGAAAGAAGG + Intergenic
983201448 4:164864492-164864514 AAGAAGAAGAAGAAGAAGAATGG + Intergenic
983500933 4:168499222-168499244 AGGGAGACGGGGAAGAAGGAAGG + Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983928940 4:173432422-173432444 AGGAAGAAGGAGGAGAAGGAAGG - Intergenic
984453758 4:179938717-179938739 ATGGACAAGCAAATGAAGGGGGG + Intergenic
984523346 4:180826616-180826638 AAGAAGAAGAAGAAGAAGCAAGG + Intergenic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985052023 4:186000544-186000566 ATGGAGGAAAAGAAGATGGAAGG - Intergenic
985140993 4:186840564-186840586 AGGGAGAGGGAGGAGAAGGAGGG - Intergenic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985311072 4:188600007-188600029 GTGAAGAAGCTGAAGAAGAAAGG - Intergenic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
985884340 5:2664981-2665003 AGAGAGGAGCAGAAGAAGGCTGG + Intergenic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
986210187 5:5664760-5664782 ATGGCCAAGGAGAAGAGGGAGGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986712680 5:10499367-10499389 GTGGAGAGGCGGAAGAAGGGGGG - Intergenic
986847280 5:11770192-11770214 AGGGAGAGACAGAAGAAGAATGG + Intronic
987015216 5:13811044-13811066 ATGGAGATAGAGTAGAAGGATGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987272680 5:16328186-16328208 ATGGATAATAAGAAGAAAGATGG + Intergenic
987384709 5:17318360-17318382 ATTAAGAACCAGAAGAAGGCTGG + Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987518601 5:18948261-18948283 AAAGAGAAGAAGGAGAAGGAAGG + Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988168446 5:27624647-27624669 AGGGAGAAGCAAGAGAAGCAGGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988255767 5:28818379-28818401 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
989214363 5:38888599-38888621 ATGGAGAAAGAAAAGAGGGAAGG - Intronic
989352988 5:40508997-40509019 ATGAAGAAGAAGAAGAAAAAAGG - Intergenic
989428437 5:41323785-41323807 ATGTAGAAGGAGAGGAAGAAAGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989981922 5:50655684-50655706 AGAGAGAAAAAGAAGAAGGAAGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990629848 5:57656306-57656328 ATGAGGAAGCTGAAGAAGAAAGG + Intergenic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
990944787 5:61238556-61238578 ATGGCAAAGCAGAAGCAGCATGG - Intergenic
991000261 5:61775655-61775677 ATGGAGACACGGAAGACGGAGGG + Intergenic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991860882 5:71011993-71012015 ATGTAAGAGCAGTAGAAGGAGGG + Intronic
991927435 5:71719194-71719216 AGGGAGGAGGCGAAGAAGGAAGG - Exonic
991930796 5:71750788-71750810 AAGGAGAAGGAGAAGAAGAGAGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992095851 5:73361833-73361855 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992239965 5:74757899-74757921 ATGAAGAAAAAGTAGAAGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993418795 5:87673586-87673608 ATGGAGAAACGGAAAAAGCAAGG - Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
993569182 5:89515018-89515040 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
993767588 5:91879907-91879929 ATGGAGACAGAGTAGAAGGATGG - Intergenic
993837754 5:92835602-92835624 ATGGAGAAGGAGGAAAAGCAGGG - Intergenic
993869524 5:93235640-93235662 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994387024 5:99144581-99144603 ATGGAGATGGAGGAGAACGATGG + Intergenic
994572562 5:101532909-101532931 ATGGAGAACAAAAAGAAGAAAGG - Intergenic
994714665 5:103307098-103307120 GTGGAGAAGGAGAAGAAGAAGGG + Intergenic
995086572 5:108117975-108117997 ATGAAAAAGCAGGAGATGGAGGG + Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
995907442 5:117142504-117142526 AGGAAGAGGAAGAAGAAGGAGGG - Intergenic
995910361 5:117179612-117179634 ATGAAGAAGCAGGGGAAGCAGGG + Intergenic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
996055113 5:118973953-118973975 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
996108447 5:119535704-119535726 ATGGAAAAGCACATGAAAGAAGG - Intronic
996127536 5:119744002-119744024 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
996289832 5:121839689-121839711 ATGGAAAAGAAGAAGCAGCATGG + Intergenic
996337485 5:122400633-122400655 ATGGAGAAGCAGAACACAGCTGG + Intronic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996930967 5:128886616-128886638 ATTGAGAAGGAGAAGAAGTTGGG + Intronic
997197075 5:131987458-131987480 ATAGGGAGGCAGGAGAAGGAGGG + Intronic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
997753815 5:136375535-136375557 ATTGGGCAGCAGAAGAAGGCAGG - Intronic
997896650 5:137724687-137724709 ATGGAGGAGCAGGGGAAGAAAGG - Intronic
998226763 5:140333148-140333170 ATGGAGTAGCACCAGAAGAATGG + Exonic
998333172 5:141347118-141347140 AGAGAGAAACAGAGGAAGGAAGG - Intronic
998342547 5:141431109-141431131 ATGGAGTAGAAGTAGAAGTAAGG + Exonic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
998729333 5:145056244-145056266 ATAGCGAAGCAGAGGAGGGAGGG - Intergenic
998813697 5:145991568-145991590 ACGGAGAAAAAGAAGAAAGAGGG + Intronic
998883298 5:146667485-146667507 ATGGAGAAAAAGAAGAAAGCAGG + Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999751713 5:154632358-154632380 AGGGAGAAGGGAAAGAAGGAAGG - Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
1000113609 5:158133017-158133039 AGGGAACAGCAGAAGAAGGGTGG + Intergenic
1000190996 5:158910413-158910435 ATGGATATGCTGAAGAAGGTGGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000485407 5:161836150-161836172 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000759676 5:165206810-165206832 ATGGAGACGGAGAACAAAGAGGG + Intergenic
1000829940 5:166090243-166090265 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001737804 5:174021087-174021109 AGAAAGAAGAAGAAGAAGGAAGG + Intergenic
1001931992 5:175679728-175679750 ATGCAAAGGCAGAGGAAGGAGGG + Intronic
1002382669 5:178841380-178841402 TTGGAGAAGGAGAGGAAGAAGGG - Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002598250 5:180338303-180338325 ATGGAAAAATAGAAGAAGCAAGG - Intronic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1002855252 6:1030895-1030917 ATGCAGAAGTAGCAGAATGAAGG + Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1002904698 6:1438868-1438890 AGGGAGGAGCAGGAGAAGGGAGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003142005 6:3479564-3479586 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1003359254 6:5408691-5408713 ATGAACAAACGGAAGAAGGAAGG + Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003487812 6:6595074-6595096 GTGGACCAGCAAAAGAAGGATGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1004253461 6:14041901-14041923 ATGGAGAGGCAGGAGATGAAGGG - Intergenic
1004343571 6:14828390-14828412 AAGGAGCTGCAGAAAAAGGAGGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1004869526 6:19890718-19890740 AAGGAGAAAGGGAAGAAGGAAGG - Intergenic
1004933010 6:20479786-20479808 ATGGACAAGAACAAGAAGGGAGG - Intronic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005167588 6:22942290-22942312 ATAGAAAAACAGAAGAATGAGGG + Intergenic
1005231776 6:23710006-23710028 ATTGAGAAGTAGTGGAAGGATGG + Intergenic
1005496152 6:26389658-26389680 ATAGAGCAGAACAAGAAGGAGGG + Intronic
1005612451 6:27539443-27539465 ATCAAAAAGCAGAAGAGGGAAGG + Intergenic
1005979194 6:30823434-30823456 AAGGAGGAGAAGAAGAAGAAGGG - Intergenic
1006205934 6:32342896-32342918 AAGGAGAAGCAGTTAAAGGAAGG + Intronic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006467358 6:34203565-34203587 ATGCAGAAGCAGGAAAAGAATGG + Intergenic
1006663799 6:35674020-35674042 AGGGAGAAAGGGAAGAAGGAAGG - Intronic
1006781231 6:36633749-36633771 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1006876611 6:37303024-37303046 ATGGAGAAGGAAAGGAAGCAAGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007510971 6:42374160-42374182 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1007602797 6:43093770-43093792 ATGAAGCAACAGAAGAACGAAGG + Intronic
1008014003 6:46497457-46497479 ATGGAAAAGGAGAAGAAGTATGG - Intergenic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009045963 6:58237767-58237789 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1009185445 6:60569027-60569049 ATTGGGAGGCAGAGGAAGGAGGG + Intergenic
1009221780 6:60992080-60992102 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1009515271 6:64608336-64608358 ATAGAGAAGAAGAGGAAGGGAGG + Intronic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010293399 6:74166895-74166917 AATGAGAAGCAGAGGAAGAAAGG - Intergenic
1010485665 6:76410430-76410452 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1011014923 6:82744037-82744059 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1011113783 6:83867335-83867357 TTGGAGAATTATAAGAAGGAAGG + Intronic
1011287806 6:85743763-85743785 ATGGTGGAGCAGGAGAATGAAGG - Intergenic
1011340719 6:86310648-86310670 ATGGTGAAGCAAGAGAAAGAAGG + Intergenic
1011702192 6:89966322-89966344 TTGCAGAAGCACAAGAAGGGAGG - Intronic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012494383 6:99818522-99818544 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012802375 6:103847238-103847260 AGGGAGAGACAGAGGAAGGAGGG + Intergenic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1013312084 6:108904656-108904678 AAAAAGAAGAAGAAGAAGGAAGG + Intronic
1013325238 6:109039097-109039119 AGGGAGGAGAAGGAGAAGGAAGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013956838 6:115852183-115852205 ATGGAGAAGCACAAAAAGTCAGG + Intergenic
1014139708 6:117927226-117927248 AGGAAGAAGCACAAGAATGAAGG + Intronic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1014443987 6:121505344-121505366 AAGGAGAGGGAGAAGAAGGTGGG - Intergenic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015495461 6:133877755-133877777 ATTGTGAAGCAGAGGAAGGAAGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016170920 6:141015559-141015581 ATGGAGAGGAATAGGAAGGATGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016497622 6:144682176-144682198 ATGGAGATAGAGTAGAAGGATGG - Intronic
1016624536 6:146150737-146150759 ATGGAGATAGAGTAGAAGGATGG - Intronic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016801470 6:148173501-148173523 AAGGAGAAGGAGAAGAAGAAGGG + Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017567097 6:155699258-155699280 AAAGAGAAAAAGAAGAAGGAAGG - Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018943194 6:168324425-168324447 AAGGAGAAGGAGAAGAAAGTAGG - Intergenic
1019021907 6:168925920-168925942 AGGAAGGAGCAGAAGATGGAAGG - Intergenic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019208764 6:170386710-170386732 AGAGAGCAGAAGAAGAAGGAAGG + Intronic
1019389994 7:781205-781227 ATGGAGATAGAGCAGAAGGATGG - Intronic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019535282 7:1526141-1526163 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535306 7:1526228-1526250 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535356 7:1526402-1526424 AAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019865849 7:3709371-3709393 AAGTAGGAGCAGCAGAAGGAAGG - Intronic
1020314453 7:6895119-6895141 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1020415465 7:7940961-7940983 AGGTAGAAGCAGAAGACTGAAGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021088226 7:16449528-16449550 AGTGAGAAGCAGAGGAAAGAAGG - Intergenic
1021138451 7:16993944-16993966 TTGGAGAAGGAGAAGAACAATGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021839600 7:24712118-24712140 ATGGAAAAGAAAAAGAAGAATGG + Intronic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022370866 7:29770117-29770139 AGGGAGAGGGAAAAGAAGGAGGG - Intergenic
1022500153 7:30877654-30877676 AAGAAGAAGAAGAAGAGGGAAGG - Intronic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022764045 7:33390093-33390115 AAGGAAAAGGAAAAGAAGGAAGG - Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023057564 7:36302278-36302300 ATGGAGAAGCAAGAAAAGAATGG - Intergenic
1023075475 7:36478019-36478041 ATAGAGAAGAGAAAGAAGGAAGG - Intergenic
1023156115 7:37254117-37254139 ATGCAGGACCAGCAGAAGGAAGG + Intronic
1023214507 7:37847577-37847599 ACGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214548 7:37847802-37847824 AGGAAGAAGAAGAAGAAAGAAGG + Intronic
1023330992 7:39116705-39116727 ATAGAGAAGAGGAAGAAGGTTGG - Intronic
1023407501 7:39850128-39850150 ATGGAGAATCTGTAGAACGATGG - Intergenic
1023479300 7:40615809-40615831 AGGATGAAGCAGAAGAAGGTGGG - Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023729069 7:43173260-43173282 ATGGCTAAGCAGAGGAAGAATGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024032257 7:45471409-45471431 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026133194 7:67636985-67637007 AAGGAGAAGGGGAGGAAGGAAGG - Intergenic
1026148683 7:67770199-67770221 AAGAAGAAACATAAGAAGGATGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026238030 7:68545772-68545794 AAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1026319269 7:69254802-69254824 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
1026780030 7:73259987-73260009 AAGGAGAAGAGGATGAAGGAAGG + Intergenic
1027384798 7:77648949-77648971 AAGGAGAAGAAAGAGAAGGAGGG + Intergenic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027572074 7:79882186-79882208 ATGGAGAAGGAGGGGAAGAAGGG - Intergenic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027900657 7:84110130-84110152 ATGGAAAAGGAGGAGAAGGCTGG + Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028229484 7:88289296-88289318 ATGGAGAAGAGTAAGAAAGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029574966 7:101397364-101397386 AAGAAGATGAAGAAGAAGGAAGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029947811 7:104551803-104551825 AGGGAGAAGCAGGAGAACGGAGG + Intronic
1030060997 7:105621219-105621241 ATTGACAAAAAGAAGAAGGAAGG - Intronic
1030175534 7:106649690-106649712 AAGAGGAAGAAGAAGAAGGAAGG + Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030469601 7:109947122-109947144 TTGGAGGAGGAGAAGAAGTAGGG - Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031071117 7:117162983-117163005 ATGGAGAAGCAAAACAAAGTTGG - Intronic
1031377609 7:121047644-121047666 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1031510561 7:122643701-122643723 AAGGAGAGGGAGAAAAAGGAGGG + Intronic
1031683361 7:124702324-124702346 ATAGAGAAGCAGAGGAAGGGAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032055286 7:128679629-128679651 GTGTAGAAGCACAGGAAGGAAGG + Intronic
1032209498 7:129900535-129900557 ATGGAGAGGAAGAAGAAACATGG - Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032523151 7:132561436-132561458 AAGGAGGAGGACAAGAAGGAGGG - Intronic
1032669375 7:134069323-134069345 GAGGAGAAGGAGGAGAAGGAGGG - Intergenic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033432340 7:141300569-141300591 AAGGAGAAGAAGCAGAAGAAGGG - Intronic
1033433232 7:141308094-141308116 ATGAAGAAGCCGGGGAAGGAGGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033615713 7:143012296-143012318 ATGGGGGAGCAAAAGAAGGGTGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033818267 7:145102044-145102066 ATGGAGAAGAAGAAGAATTTGGG - Intergenic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1033966698 7:146984034-146984056 ATGGAGAGGAAGAACAAGAAGGG - Intronic
1034788066 7:153943457-153943479 ATGGAGAAGGACAAAAAAGAGGG - Intronic
1034944915 7:155255640-155255662 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1036912496 8:12768748-12768770 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037218213 8:16484051-16484073 AAAGAGAAGGAGAAGAAGAAAGG + Intronic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037649886 8:20826645-20826667 AAGGAACAGCAGAAGATGGAAGG + Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1038622225 8:29155149-29155171 ATGGAGAATCAAAAAAAGAAAGG + Intronic
1038668021 8:29558119-29558141 AAGAAGAAGAAGAAGAAGAATGG + Intergenic
1038776352 8:30534532-30534554 ATGGGGAACCAGAAGAACGGGGG + Intronic
1038902954 8:31864584-31864606 GTGCAGGAGCAGAAGAATGAGGG + Intronic
1039142741 8:34411146-34411168 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1039478412 8:37854020-37854042 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1039566625 8:38556575-38556597 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041347925 8:56920676-56920698 AGGGAGAAGCAGAGAAAGGTGGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041706423 8:60850974-60850996 ACTGATAAGCAAAAGAAGGAAGG - Intronic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1041982104 8:63873767-63873789 ATGGACGAACAGAAGAAAGAAGG + Intergenic
1042078824 8:65026800-65026822 ATAGCAAAGAAGAAGAAGGAAGG - Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042358477 8:67855316-67855338 TGGGAGATGCAGTAGAAGGATGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042986685 8:74592134-74592156 ATGGAGAAGTAATAGAATGATGG - Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043119402 8:76303724-76303746 ATGGAGAAAGGGAGGAAGGAAGG + Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043412981 8:80018956-80018978 ATGGAGACAGAGTAGAAGGATGG + Intronic
1043919819 8:85968532-85968554 ATGGAGAAGGAGAACAGGTAGGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044392356 8:91666320-91666342 ATAGAGAATGAGTAGAAGGAGGG - Intergenic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1044879452 8:96708169-96708191 AGGGAGAGGCAGAAGAAGAGAGG - Intronic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045474660 8:102542616-102542638 ACGATGAAGAAGAAGAAGGAGGG - Intergenic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046186616 8:110729759-110729781 AGGTAGAAGGAGGAGAAGGAGGG + Intergenic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1046558452 8:115806845-115806867 AGGAAGAAGAATAAGAAGGAAGG + Intronic
1046933611 8:119865595-119865617 ATGGAGAGGCAGTAGAATGGAGG + Intergenic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1047388245 8:124429283-124429305 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047767783 8:128003338-128003360 AAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1048026211 8:130589319-130589341 ATGGAGAATGAGGAGATGGAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048366402 8:133742529-133742551 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048430864 8:134369285-134369307 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1048519697 8:135142110-135142132 AGGGAGAAGGAATAGAAGGAAGG + Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048860451 8:138720772-138720794 AGGGAGAACCAGGAGAAAGAGGG - Exonic
1049058447 8:140257389-140257411 TTGGAGGAGAAGTAGAAGGAAGG - Intronic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1049852926 8:144843733-144843755 ATGAGGAAGCAGCACAAGGAGGG + Intronic
1049872453 8:144991096-144991118 ATGGAGAGGGAGCAGAAGCAGGG - Intergenic
1049887880 9:40399-40421 AGGAAGAAGGAGAAGAAGAAAGG - Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050475911 9:6040925-6040947 AAGGAGAAGATGAAGAAGTAAGG - Intergenic
1050475918 9:6040989-6041011 AAGGAAAAGAGGAAGAAGGAAGG - Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051502551 9:17793689-17793711 ATAGAGAAGAATGAGAAGGAAGG - Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051756337 9:20404931-20404953 ATGGAGGATCTGAGGAAGGAAGG - Intronic
1052027298 9:23587846-23587868 AGGAAGAAGTAAAAGAAGGAGGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052421085 9:28243710-28243732 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1052814666 9:33092251-33092273 AAGGAGGAGAAGTAGAAGGAGGG - Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053022802 9:34707704-34707726 GAGGAGAAGAAGAAGAAGAAAGG - Intergenic
1053037798 9:34840410-34840432 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053163198 9:35827914-35827936 GTGGAGAACCAGAAGATGGGAGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053190732 9:36064763-36064785 AGGGAGAACAAGAAGAAGAATGG - Intronic
1053279042 9:36805613-36805635 TTGGTGAAGCTGTAGAAGGATGG + Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1053306530 9:36988016-36988038 AGCGAGAAGATGAAGAAGGAGGG + Intronic
1053346219 9:37380170-37380192 AGGGAGAAAGAGAAGAAGGGAGG + Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053580548 9:39399494-39399516 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1053845044 9:42227568-42227590 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054102135 9:60958299-60958321 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054584224 9:66948564-66948586 ACTGAGAAGAAGGAGAAGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055080256 9:72261704-72261726 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
1055264631 9:74480879-74480901 AGGAAGAAGCAGAAGACAGAGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056120101 9:83479308-83479330 AAGGAGAAGGAGGAGAAGAAGGG + Intronic
1056212158 9:84374819-84374841 ATCGAGAATTAGAAGAAGGCTGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056328014 9:85497160-85497182 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1056597672 9:88021038-88021060 AAGGAGAGAGAGAAGAAGGAAGG - Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1056741856 9:89263516-89263538 ATACAGAAGAAGAAGAAGAAAGG - Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059266114 9:113032613-113032635 AGGGAGCAGAAGATGAAGGAAGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1059883103 9:118714404-118714426 AAAGAAAAGCAAAAGAAGGAAGG - Intergenic
1060176824 9:121503355-121503377 ATGGAGAATCTGAGGAAGAAAGG - Intergenic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060283524 9:122228979-122229001 GGGGAGGAGGAGAAGAAGGAGGG - Intronic
1060400462 9:123345939-123345961 ATTGAATAGCAGAGGAAGGAAGG + Intergenic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060426506 9:123511071-123511093 TTTGGGAATCAGAAGAAGGAGGG - Intronic
1060623595 9:125090469-125090491 ATGATGAAGAAGGAGAAGGAAGG + Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060805514 9:126573471-126573493 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1061632470 9:131881783-131881805 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062107231 9:134762381-134762403 TTGGAGGAGCAGAAGAGGGTGGG + Intronic
1062165389 9:135105007-135105029 GAGGAGAAGCAGCAGAAGAAAGG - Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203435896 Un_GL000195v1:136967-136989 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1203372045 Un_KI270442v1:316499-316521 ATGGAGAACCACGAGAAAGAAGG + Intergenic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185868063 X:3640165-3640187 AGGGGCAAGCAGAAGAAAGAAGG + Intronic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186064102 X:5742947-5742969 GAGGAGAAGGAGGAGAAGGAGGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1186102051 X:6167687-6167709 ATGGGGATGGAGAAGAAGCAGGG - Intronic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186539557 X:10386610-10386632 ATGGACAAGAAGAAGAAGAAGGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187167544 X:16818543-16818565 AAGGAGAAGGAGAAAAAAGATGG - Intronic
1187459905 X:19477783-19477805 AAGGAGAGGGAGAAGAAAGAGGG + Intronic
1187552406 X:20319091-20319113 GTCTAGAAGCAGAAGAAAGAGGG + Intergenic
1188142836 X:26573700-26573722 AAGGAGAATGAAAAGAAGGAAGG - Intergenic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189947103 X:46190584-46190606 AAGGAGAAGAAGGAGAAGAAGGG - Intergenic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1190644261 X:52510255-52510277 ATGGAGAGGGGGAGGAAGGAAGG - Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1190888856 X:54551901-54551923 TTGGGGAAGAAGAAGAAGGGAGG + Exonic
1190906611 X:54735293-54735315 ATGGAAAACAAGAAAAAGGAAGG - Intergenic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192427806 X:71092848-71092870 ATGTTGGAGCAGAAGAAGGCAGG + Intergenic
1193156513 X:78180072-78180094 ATGGAGAACCAGAATATGTAGGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1195089807 X:101448019-101448041 ATGGAGATAGAGTAGAAGGATGG - Intronic
1195614043 X:106898837-106898859 AGGGAGAAGGAAAAGAAAGATGG + Intronic
1195662490 X:107393703-107393725 ATGGAGATAAAGTAGAAGGATGG - Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196054161 X:111336968-111336990 AAGGAGGAGGAGAAGAAGAATGG + Intronic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1196087857 X:111705885-111705907 AGGGAAAATCAGGAGAAGGAGGG - Intronic
1196473595 X:116057413-116057435 ATGGTGGAGCAGGAGAAAGATGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197526732 X:127573927-127573949 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197616691 X:128699912-128699934 ATGGAGGAAGAGAAGAAGGGAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197816933 X:130507307-130507329 ATGGGGCAACAAAAGAAGGATGG - Intergenic
1197888021 X:131238364-131238386 ATGGGGAAGTACAAGAAGGTGGG + Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198005950 X:132492539-132492561 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198105031 X:133453961-133453983 TTGGAGATGCAGAAGAGGGTAGG - Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198229169 X:134673274-134673296 ATGGAGGAAGGGAAGAAGGAAGG + Intronic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1199751592 X:150824495-150824517 AGAAAGAAGAAGAAGAAGGAAGG + Intronic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1200036268 X:153333892-153333914 ATCGACCAGCAGACGAAGGAAGG - Intergenic
1200269858 X:154672330-154672352 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201452070 Y:14127767-14127789 ATGGAGAAAAAGAAGAGGAAAGG - Intergenic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201517700 Y:14835664-14835686 ATGGAGACAAAAAAGAAGGAAGG + Intronic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic
1201761582 Y:17545266-17545288 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1201839970 Y:18360724-18360746 ATGGAGAATGAGGAGAAAGAAGG - Intergenic