ID: 959990344

View in Genome Browser
Species Human (GRCh38)
Location 3:112624348-112624370
Sequence TGTGCTTTGCATAAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959990342_959990344 -7 Left 959990342 3:112624332-112624354 CCAAAACTCTCTTGGTTGTGCTT 0: 1
1: 0
2: 1
3: 14
4: 197
Right 959990344 3:112624348-112624370 TGTGCTTTGCATAAGCCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959990344 Original CRISPR TGTGCTTTGCATAAGCCAGG AGG Intronic
900905133 1:5551802-5551824 TGTGCTCTGCACGTGCCAGGAGG + Intergenic
902923967 1:19683414-19683436 TCTGCTTGGCATAGTCCAGGTGG + Exonic
904953736 1:34265858-34265880 TGTGCTTAGCAAAAGCCATAAGG - Intergenic
906458787 1:46021641-46021663 CATGCTTTCCATCAGCCAGGTGG - Intronic
912953319 1:114135560-114135582 TGCCCTTTTCAGAAGCCAGGTGG + Intronic
915463665 1:156083356-156083378 TGAGCTTTGGATATGACAGGAGG + Intronic
916385428 1:164262244-164262266 TGTGCGTTGCATATGCCATGAGG - Intergenic
919787572 1:201269594-201269616 TGTGATTAGGCTAAGCCAGGAGG + Intergenic
923280661 1:232440029-232440051 TGTACTTTGCAGCAGCCAAGTGG - Intronic
923759455 1:236827473-236827495 TTTACTTTACATAATCCAGGGGG - Intronic
1064481660 10:15746310-15746332 CCTGCTCTGCATAAGCCTGGGGG + Intergenic
1067522551 10:47019281-47019303 TGGGCTGTGCATCAGCCTGGGGG + Intergenic
1067582849 10:47456383-47456405 TGGTCTCTGCAGAAGCCAGGAGG + Intergenic
1070380690 10:75878170-75878192 TGTCCTTGGGATAAGCCAGAGGG - Intronic
1070545954 10:77452645-77452667 TGTGGTTGGCAGAAGCCAAGTGG - Intronic
1070701364 10:78603969-78603991 TGTGCTCTTCAGGAGCCAGGTGG + Intergenic
1071257264 10:83882004-83882026 AGTACTGTGCACAAGCCAGGAGG - Intergenic
1075623725 10:123946917-123946939 TATGCTTTGCATAAGAGAGAAGG - Intergenic
1075967997 10:126629434-126629456 TGTGCTGTGCATCAGGGAGGAGG - Intronic
1081258951 11:40934440-40934462 TGTTATTTGAATAAGGCAGGTGG - Intronic
1084494376 11:69495611-69495633 TGGGCTTTGAATTATCCAGGTGG - Intergenic
1086424267 11:86669042-86669064 GGTACTTTGCATCAGCCAGGTGG - Intronic
1088919802 11:114252536-114252558 TGTGCTTTCCAAAATTCAGGAGG - Intergenic
1090879947 11:130824665-130824687 TGTGATCTGCTTAAACCAGGTGG - Intergenic
1093584924 12:20823248-20823270 TGTGATTTTCTTAAGCCATGGGG - Intronic
1094033791 12:26044796-26044818 TGGGCTTTAAATAATCCAGGAGG - Intronic
1097520307 12:60660328-60660350 TGTGCTTTGCAGAGGTAAGGTGG + Intergenic
1098014315 12:66088342-66088364 TCTGCCCTGCAGAAGCCAGGAGG + Intergenic
1098868667 12:75790558-75790580 TGTGGTATGCATGAGCAAGGAGG - Intergenic
1101271189 12:103146827-103146849 TGTGGTTTGCATAAACCACTGGG + Intergenic
1103039160 12:117680611-117680633 TGTGCTTAGCAAAAGACTGGAGG + Intronic
1106008851 13:25798468-25798490 TGTACTTTGGATAGGCCAGTTGG - Intronic
1112967189 13:105211480-105211502 TGTCCTGTGCATAAGCCTGGCGG + Intergenic
1115186341 14:30692234-30692256 AGTGCTTGTTATAAGCCAGGTGG + Intronic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1116218575 14:42052786-42052808 TGGGCTGTGCAGAAGACAGGTGG + Intergenic
1120073281 14:80126928-80126950 TTTGCTGTGCAGCAGCCAGGTGG + Intergenic
1121311350 14:92936876-92936898 TGTGCTTTGCAGGGGGCAGGGGG - Intergenic
1121564898 14:94901884-94901906 TCTGCTTTGCAGAAGCTGGGAGG + Intergenic
1124626443 15:31310208-31310230 TGTGCTCTCCAGAAGGCAGGGGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127261507 15:57330030-57330052 TGTGCTGTGGACAAGCCAAGAGG + Intergenic
1128735980 15:70054263-70054285 TGTCCCTCGCATAAGGCAGGCGG + Intronic
1128878115 15:71218641-71218663 TGTGATTTTCATCAGCCGGGAGG - Intronic
1130357758 15:83149897-83149919 TGTGCTTTGGAGAAAACAGGAGG + Intronic
1131379784 15:91954361-91954383 TGTGCTGAGCCTCAGCCAGGCGG + Intronic
1133705040 16:8346461-8346483 TGTGCTGTCCACAAGCCATGGGG + Intergenic
1135509699 16:23071677-23071699 TGTGCTTTGCCCAGGCCACGTGG - Intronic
1141069189 16:80937903-80937925 GGTTCTTTACGTAAGCCAGGAGG - Intergenic
1141498238 16:84425131-84425153 TTTGCTTTGCAGGGGCCAGGGGG - Intronic
1143053003 17:4142446-4142468 TTTGCTTTGGAGAGGCCAGGCGG - Intronic
1147533121 17:41298726-41298748 TGTCCTTGCCATAAGGCAGGGGG + Intergenic
1147703392 17:42409950-42409972 TGTGCTTGGCAAAGGGCAGGGGG - Intronic
1148894543 17:50832320-50832342 TGGGGTGTGCATAAGCCACGTGG + Intergenic
1149434963 17:56625934-56625956 TGTGTCTTGCATTAGCCAGTGGG - Intergenic
1151945136 17:77315615-77315637 CCTGCTTTGCGTCAGCCAGGGGG - Intronic
1152791436 17:82282515-82282537 TGAGCCTTGAAGAAGCCAGGTGG + Intergenic
1158668401 18:59453269-59453291 TTTGCATTTCATAAGCCAGAAGG - Intronic
1159176229 18:64838384-64838406 TGTTTTTTGCATAAGCTAGATGG + Intergenic
1160102994 18:75940789-75940811 TGTGATTTGCAAAAGACATGTGG + Intergenic
1161723979 19:5918027-5918049 TGTGTTCTGCAGAAGGCAGGAGG - Intronic
1162962087 19:14134374-14134396 TGTGCTTTGGGTAGGCCAGTGGG - Intronic
1164434350 19:28216432-28216454 TGTGTTTTGCATGACCCAAGGGG - Intergenic
1167139716 19:47641405-47641427 TTTGCATTGCCTGAGCCAGGGGG - Intronic
925628511 2:5865731-5865753 AGTGCTTTGCATTAACAAGGAGG + Intergenic
926335225 2:11857741-11857763 TGTTCCTTGCAGAGGCCAGGAGG - Intergenic
926859783 2:17297016-17297038 TAAGCATTTCATAAGCCAGGAGG - Intergenic
926921952 2:17947742-17947764 GTTGCACTGCATAAGCCAGGAGG + Intronic
933997021 2:87677491-87677513 TGGGCTTTGCATAGAGCAGGTGG + Intergenic
936296828 2:111273419-111273441 TGGGCTTTGCATAGAGCAGGTGG - Intergenic
936936851 2:117847252-117847274 TGTGGTTTGGATAAGCTAGATGG - Intergenic
937473148 2:122190689-122190711 CATGCTTAGCATAAGACAGGTGG + Intergenic
940190825 2:151038375-151038397 AGTGCTTTGCATTAGACAGGTGG - Intronic
941325524 2:164109473-164109495 TGTGCTTGCGATAAGGCAGGGGG + Intergenic
942208208 2:173644809-173644831 TGTACCTTGCATAAGTAAGGGGG - Intergenic
945108341 2:206338563-206338585 TGTGGGTTGCTTAAGCCTGGAGG + Intergenic
947046350 2:225991197-225991219 GCTGCTTTCCATAATCCAGGTGG + Intergenic
948372370 2:237497548-237497570 TGTGCTCTGCTCAAACCAGGTGG + Intronic
1169248903 20:4045510-4045532 TGTGCTTTGCCTGATTCAGGTGG + Intergenic
1174950115 20:55033556-55033578 TGTGCTTTCCAGAAGCAAGACGG - Intergenic
1175518405 20:59583783-59583805 TGGGCTTTGCATTGGGCAGGGGG + Intronic
1175681930 20:60995388-60995410 TGTTCTCTGCATGAGTCAGGAGG + Intergenic
1179561099 21:42216722-42216744 TGTACTTAGCTTAAGCCAGTTGG + Intronic
1180129969 21:45821024-45821046 GGTGCTTTGCAGAAGCCACATGG - Intronic
1182584282 22:31334882-31334904 TGTGCTTTGCTTTGGCCAGTGGG - Intronic
1182706360 22:32283059-32283081 GGGGCTTTGCAGAATCCAGGAGG - Intergenic
1184318520 22:43719421-43719443 GGTGCTTTTCATAAGCAAGATGG + Intronic
1185194200 22:49458301-49458323 TGTTGTTTGCATAAGCCCGCTGG + Intronic
949991129 3:9580133-9580155 TGTGCTTTGAGGAAGCAAGGTGG + Intergenic
954049695 3:47964006-47964028 TGTTCCTTGAACAAGCCAGGTGG - Intronic
955522266 3:59786299-59786321 TGTTTTTTGCATTAGCCAGTGGG - Intronic
955883070 3:63568401-63568423 TCTGCTGTGCACAAGACAGGTGG + Intronic
957922718 3:86767269-86767291 TGTGCTGTGCATAAGACAATAGG - Intergenic
958907785 3:99961069-99961091 TGGGCTGTGCATAATCCAGAGGG - Intronic
959990344 3:112624348-112624370 TGTGCTTTGCATAAGCCAGGAGG + Intronic
961475815 3:127145612-127145634 GGTGCTTAGCAGGAGCCAGGAGG - Intergenic
965425849 3:168521937-168521959 TGTGCTATGAAAAAGACAGGTGG + Intergenic
965774974 3:172219286-172219308 TGTGCTATGCAAAGGCCAAGAGG - Intronic
965787026 3:172346372-172346394 GGTGCTTTGCATTGTCCAGGAGG - Exonic
967790227 3:193540556-193540578 TGTGTTTTGTATAAGCTAGAAGG - Intronic
969339629 4:6532025-6532047 AGTGCTTTGCAAAGGGCAGGAGG + Intronic
971633203 4:29021801-29021823 TGTGGTTTGCCTTAGCCAGTAGG - Intergenic
975994092 4:80294416-80294438 TGTGCTCTGCACCAGCAAGGTGG - Intronic
978760115 4:112348363-112348385 TGTGCTTTGCACAAGCCATGAGG + Intronic
980193864 4:129562155-129562177 TGTCATTTGCAAAAGCCAAGAGG - Intergenic
981012584 4:139940687-139940709 TGTGCTATGGAGAAGCCAAGTGG - Intronic
983127238 4:163968923-163968945 CCTGCTTTACATAAGCCTGGGGG - Intronic
986154836 5:5164354-5164376 TGTGTTCTGCATAAGTCAAGGGG + Intronic
987394080 5:17404568-17404590 TGTGCTTTGGAAAAGCAATGAGG + Intergenic
987398012 5:17443712-17443734 TGTCCTTGAGATAAGCCAGGGGG + Intergenic
988435478 5:31169568-31169590 AGTGCTGTGCAAAACCCAGGAGG + Intergenic
990501469 5:56400581-56400603 TCAGCTTTGCATAGGCCAAGAGG + Intergenic
993180154 5:84542236-84542258 TGTGAAATGCACAAGCCAGGTGG - Intergenic
995781122 5:115776356-115776378 AGTGCTTCGCACAAACCAGGTGG + Intergenic
996893375 5:128450209-128450231 TGTGCTCTGCTTAAGTGAGGTGG - Intronic
999452904 5:151691708-151691730 TGTGCTTTGCATCAGGCACTGGG + Intergenic
999576717 5:152986892-152986914 TGTGATTTCCAAAAGCCAGCTGG - Intergenic
1002198528 5:177513983-177514005 TGTGCTATACATAGGGCAGGTGG - Intronic
1002517783 5:179772538-179772560 TGTCCATTGCTTAAGCCAGGAGG + Intronic
1003499762 6:6694705-6694727 TGTCCTTGGAATAAGGCAGGAGG - Intergenic
1008413721 6:51214656-51214678 TGTGCTTGGCAAATGCCAAGTGG - Intergenic
1008962608 6:57280953-57280975 TGTGGTTAGCAGAGGCCAGGAGG - Intergenic
1010393237 6:75360503-75360525 TCTGCTTAGCCTAAGCCAGTGGG - Intronic
1013745469 6:113340459-113340481 TGTACTTTCCTTAAGCCTGGAGG - Intergenic
1015351082 6:132220671-132220693 TGTGCCCTGCATAAGCCACTTGG + Intergenic
1019131519 6:169880563-169880585 AGTGCTCTGCAGGAGCCAGGTGG + Intergenic
1020072091 7:5233860-5233882 TGGTTTTTGAATAAGCCAGGCGG + Intergenic
1021733270 7:23618115-23618137 TGTGTGTTGGATATGCCAGGAGG - Intronic
1022154790 7:27649122-27649144 TGTGCTTTTAATAACACAGGAGG + Intronic
1023136324 7:37056388-37056410 TCTGCTTTGTCTAAGCCAAGAGG - Intronic
1023506061 7:40900694-40900716 TGTGCTCTGCAAAAACCACGAGG + Intergenic
1024446029 7:49480107-49480129 TAGGATTTGCCTAAGCCAGGTGG - Intergenic
1029330203 7:99847144-99847166 TCTGCTTTGCACAACCCTGGAGG + Intronic
1031004037 7:116452127-116452149 TGACCATTGCATCAGCCAGGGGG - Intronic
1031193693 7:118587109-118587131 TGTGCTTTGCAAAACCATGGGGG + Intergenic
1031827050 7:126578476-126578498 TGAGCTGTGCATTTGCCAGGTGG + Intronic
1043381305 8:79705186-79705208 TGTGCACTGCACAAGCCTGGGGG - Intergenic
1043868544 8:85402982-85403004 AGTGCTCTGCATGAGCCAAGAGG + Intronic
1044446237 8:92280109-92280131 TTTGTTTTGCACATGCCAGGAGG - Intergenic
1048600189 8:135911380-135911402 TGTGCTTTGGAAAACCAAGGTGG - Intergenic
1057179781 9:93023465-93023487 TCTGCTCTGCAGAGGCCAGGTGG - Intronic
1059837661 9:118174671-118174693 TGTGATTTGCTTTAGCCAGTAGG - Intergenic
1186472899 X:9835212-9835234 TGTGCTTTGCAGTTGCCTGGAGG + Intronic
1191731984 X:64346220-64346242 TGTGCATTTCAGAAGGCAGGAGG + Intronic
1191998338 X:67121090-67121112 TGTGCCTGCCATAACCCAGGAGG - Intergenic
1192158661 X:68766647-68766669 TGGGCTTTGCATAAGCTAAGAGG - Intergenic
1192748472 X:73963658-73963680 TGTCCTTGCCATAAGGCAGGGGG - Intergenic