ID: 959997860

View in Genome Browser
Species Human (GRCh38)
Location 3:112698328-112698350
Sequence GAGAGCTCTTGGCCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959997856_959997860 13 Left 959997856 3:112698292-112698314 CCTTCCATCTTCTGCAGATAACT 0: 5
1: 198
2: 191
3: 123
4: 339
Right 959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG No data
959997854_959997860 15 Left 959997854 3:112698290-112698312 CCCCTTCCATCTTCTGCAGATAA No data
Right 959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG No data
959997855_959997860 14 Left 959997855 3:112698291-112698313 CCCTTCCATCTTCTGCAGATAAC No data
Right 959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG No data
959997857_959997860 9 Left 959997857 3:112698296-112698318 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959997860 Original CRISPR GAGAGCTCTTGGCCTGCTAC TGG Intergenic
No off target data available for this crispr