ID: 960004449

View in Genome Browser
Species Human (GRCh38)
Location 3:112767620-112767642
Sequence CAGGAGGGAGGGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17840
Summary {0: 1, 1: 10, 2: 297, 3: 2708, 4: 14824}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960004449_960004457 -10 Left 960004449 3:112767620-112767642 CCAACTTCCCTCCCTCCCTCCTG 0: 1
1: 10
2: 297
3: 2708
4: 14824
Right 960004457 3:112767633-112767655 CTCCCTCCTGTGGGGCTAAAAGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960004449 Original CRISPR CAGGAGGGAGGGAGGGAAGT TGG (reversed) Intronic
Too many off-targets to display for this crispr