ID: 960005936

View in Genome Browser
Species Human (GRCh38)
Location 3:112781197-112781219
Sequence TGTCCCTTCAGTCCTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960005932_960005936 8 Left 960005932 3:112781166-112781188 CCAAGCTCTGGTACACACTATCT 0: 1
1: 0
2: 2
3: 27
4: 258
Right 960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG 0: 1
1: 0
2: 3
3: 28
4: 257
960005930_960005936 25 Left 960005930 3:112781149-112781171 CCAGGTGACTCTGACTTCCAAGC 0: 1
1: 1
2: 2
3: 25
4: 248
Right 960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG 0: 1
1: 0
2: 3
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960005936 Original CRISPR TGTCCCTTCAGTCCTGTGGG TGG Intronic
900318573 1:2071145-2071167 TGTGACTTCAGGCATGTGGGTGG + Intronic
900506681 1:3032800-3032822 TGCCCCTTCACTGCTGTGGAGGG - Intergenic
900613945 1:3555994-3556016 GATCCCGTGAGTCCTGTGGGTGG - Intronic
901678949 1:10902150-10902172 TCTCCCAACAGCCCTGTGGGAGG + Intergenic
902164948 1:14562611-14562633 TTTCTCTCCAGTCTTGTGGGTGG + Intergenic
904647338 1:31977791-31977813 TGTCCCTTCAGGCCTAAGGGTGG - Intergenic
904992011 1:34600677-34600699 TGTTCCTTGCCTCCTGTGGGTGG - Intergenic
907438373 1:54463705-54463727 TGTCCCTTTTGTTCTGGGGGTGG + Intergenic
908347692 1:63252169-63252191 TGTCATTTCAGCCCTTTGGGAGG - Intergenic
908807886 1:67949476-67949498 TGGCCCCTGATTCCTGTGGGAGG - Intergenic
909052276 1:70780752-70780774 AGTCCTTTCAGTGCTGTGTGAGG + Intergenic
911136287 1:94444713-94444735 TTTACCCTCAGTTCTGTGGGTGG + Intronic
912809093 1:112780286-112780308 TGTCCCTTCATTTCTATGTGTGG + Intergenic
915115812 1:153598805-153598827 TGCCCCAGCAGTCCTGAGGGAGG + Intergenic
915328329 1:155092762-155092784 TGGTCCCTCAGTCCCGTGGGGGG - Intergenic
915597561 1:156904263-156904285 CGTCCCTTAGTTCCTGTGGGAGG + Intronic
917267935 1:173241767-173241789 TGACCCTTGTTTCCTGTGGGAGG + Intergenic
917709071 1:177666080-177666102 CGCCCCTTTAGACCTGTGGGTGG + Intergenic
918429415 1:184443684-184443706 TGTCCCTGCAGGCTTGAGGGAGG - Intronic
918723864 1:187892379-187892401 TGTTCCTTCAGACCTGGGAGTGG + Intergenic
919078415 1:192839982-192840004 GGTCCATTCAGTCCGTTGGGGGG + Intergenic
919680579 1:200430872-200430894 TGTAATCTCAGTCCTGTGGGAGG - Intergenic
920938237 1:210456076-210456098 TGTCCCTCCAGGCCTGTTGATGG + Intronic
921318981 1:213918977-213918999 TGTACCTTCACTCCTGTTGCTGG - Intergenic
921759875 1:218900676-218900698 TATCCCTTCAGTCCTGTGAGGGG + Intergenic
923327607 1:232894719-232894741 AGTCCCTTCATTCCTGTTGCTGG - Intergenic
923700611 1:236296644-236296666 TGTACTCTCAGTGCTGTGGGAGG + Intergenic
923721059 1:236467278-236467300 TGCTTCTTCAGTACTGTGGGTGG + Intronic
1062803495 10:397271-397293 TGTCATTCCAGCCCTGTGGGAGG + Intronic
1062910705 10:1209826-1209848 TGTCCCCTCCGTCCTCTGTGTGG - Intronic
1063171321 10:3512463-3512485 TATCCCATGTGTCCTGTGGGGGG - Intergenic
1065294229 10:24259354-24259376 TGTAACTTCAGTGCTTTGGGAGG + Intronic
1066699738 10:38114389-38114411 AGTCCTTTAAGTCCTGTGGTAGG + Intronic
1067728855 10:48794367-48794389 TCTCCCTTCCTTCCTGTCGGCGG - Intronic
1069003450 10:63291854-63291876 TGTCTCTTCATTTCTTTGGGTGG + Intronic
1071456057 10:85852457-85852479 TGACCCTCCAGTCCTGTGCCTGG - Intronic
1073195747 10:101689874-101689896 TGTACATTCATTCCTGTGGAGGG - Intronic
1073615633 10:104992023-104992045 TGTCCCTGCTGCCCTGTGTGAGG + Intronic
1074211418 10:111338886-111338908 GCTCACTTCAGGCCTGTGGGCGG + Intergenic
1074873414 10:117595596-117595618 CGTCCCTTCAGCCCTAAGGGTGG - Intergenic
1076229595 10:128808998-128809020 TGTCCCAGCAGACCAGTGGGTGG - Intergenic
1076584843 10:131539653-131539675 TGTACCTCCACTGCTGTGGGAGG - Intergenic
1076669357 10:132111222-132111244 TGCCCCTGCAGACCTGTGGAGGG + Intronic
1077232036 11:1462049-1462071 TGCCCCTGCCGTCCTGTGTGTGG - Intronic
1078269043 11:9777579-9777601 GGTCCATTCAGTCATCTGGGGGG + Intergenic
1078650443 11:13186023-13186045 TGTTCCTTCAGGCCTAAGGGTGG - Intergenic
1081814505 11:45930917-45930939 TGTCCCCTCAGACCTGGGCGGGG - Intronic
1083150194 11:60787068-60787090 TGTTCCTTCAGTTCTGGGAGTGG - Intronic
1083545953 11:63549588-63549610 TGTCCCGTCACTCCTGGGTGGGG - Intergenic
1086782293 11:90922290-90922312 GGTCCATTCAGTCATTTGGGGGG + Intergenic
1088610604 11:111572680-111572702 TGTCCCTTAAGTAGTGTTGGAGG - Intergenic
1088708211 11:112482666-112482688 TGTCCCTTCAGTGCTCGGGGTGG - Intergenic
1089262051 11:117230169-117230191 TGTGCTTTGAGCCCTGTGGGTGG - Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090224330 11:125060954-125060976 TACCCCAACAGTCCTGTGGGTGG + Intergenic
1090363207 11:126187266-126187288 TGTCCCTTCTCTCCTCTGGGTGG - Intergenic
1091079784 11:132655496-132655518 TGTCACTCCAGAGCTGTGGGTGG + Intronic
1092532242 12:9354120-9354142 TGTCCCTGCAGTTTTGTGGGTGG + Intergenic
1092895594 12:13007354-13007376 GGTCCATTCAGTCGAGTGGGGGG - Intergenic
1093907983 12:24714414-24714436 TATCCCTTCAGGCCTAGGGGTGG + Intergenic
1094831978 12:34304490-34304512 TTTCCCATCAGCCCTGTGTGGGG + Intergenic
1095730229 12:45498466-45498488 TGTTCATACAGCCCTGTGGGGGG - Intergenic
1096123595 12:49104287-49104309 TGTCCCTACAGGCCTAAGGGTGG + Intronic
1097279511 12:57835930-57835952 TATCCTTTCAGTCCTGAGTGAGG - Intronic
1101715597 12:107309311-107309333 TGTCCCTTCAGCCTTGGGGGTGG + Intergenic
1103229952 12:119320982-119321004 TGTCCCTTCAGGTCTAGGGGTGG + Intergenic
1104043667 12:125146447-125146469 GATTCCTTCATTCCTGTGGGAGG - Intergenic
1107594889 13:41952921-41952943 TGCCCCTTCAGGCCTAGGGGCGG - Intronic
1109604503 13:64674771-64674793 TGTCCATTCAGTCATGTGAGGGG + Intergenic
1109774288 13:67019575-67019597 TAGCCCTACAGTCTTGTGGGAGG - Intronic
1110755654 13:79171200-79171222 TTTCCCTTCAGTGCTAAGGGTGG - Intergenic
1111213960 13:85119210-85119232 TGTCCCTTCAGTCCTATGAGAGG + Intergenic
1113484518 13:110644695-110644717 TTACCCATCAGTCATGTGGGTGG + Intronic
1117424734 14:55581319-55581341 TGGCCCTTCTTTCCTGTGGGAGG + Intronic
1117516667 14:56508774-56508796 TGTCCCTCCAGGCCTATAGGTGG - Intronic
1117960140 14:61154301-61154323 TGTCCTTTCAGGCCTGGGGATGG + Intergenic
1118331674 14:64820256-64820278 TTTCCCTTCAGTACTGTTGTTGG - Intronic
1118915304 14:70098019-70098041 TGCCCCATCAGGTCTGTGGGAGG + Intronic
1120846882 14:89134009-89134031 TGTTCCTGCAGTGGTGTGGGAGG - Intronic
1121645103 14:95512909-95512931 TGTTTCTTCAGTCCAGTGGTAGG - Intergenic
1121704298 14:95979906-95979928 AGACCATTCAGTCCTCTGGGGGG - Intergenic
1121892052 14:97603449-97603471 TGTCCTTTCAGCCCTGTAGTCGG - Intergenic
1121896169 14:97649963-97649985 TGTTCCGTCAGACCTGAGGGTGG + Intergenic
1122994742 14:105256926-105256948 TGTCTCTTCTGTGCTGTGTGTGG - Intronic
1123968208 15:25480000-25480022 GGTCCCTGAAGTCCTGTGAGTGG + Intergenic
1125766890 15:42142192-42142214 TGTCGCTCCACACCTGTGGGTGG + Exonic
1128239870 15:66094483-66094505 TGTCCCCTCAGCCCTGTGTACGG - Exonic
1130324798 15:82871371-82871393 TTTCCCTACAGGGCTGTGGGTGG + Intronic
1130556945 15:84929595-84929617 TGTCATTTCAGTACTTTGGGAGG + Intronic
1132568122 16:632425-632447 TGTCCTTTCCATCCTGTGTGAGG - Intronic
1133647473 16:7777648-7777670 TGTAACCTCAGTCCTTTGGGAGG + Intergenic
1136685103 16:31989370-31989392 TGTCCCTTCTGTCCTCCAGGGGG - Intergenic
1136785716 16:32932905-32932927 TGTCCCTTCTGTCCTCCAGGGGG - Intergenic
1136884054 16:33920899-33920921 TGTCCCTTCTGTCCTCCAGGGGG + Intergenic
1139357611 16:66376647-66376669 TCTCCTGTCAGTCCTGTGGCTGG + Intronic
1139581649 16:67877408-67877430 TATCCATTCCTTCCTGTGGGTGG + Intronic
1141149262 16:81552840-81552862 TGTTCCTTCATTGCTGTGGCTGG + Intronic
1141244035 16:82290045-82290067 TGTCCTTTCAGTCTTGGGGGTGG + Intergenic
1203087947 16_KI270728v1_random:1194567-1194589 TGTCCCTTCTGTCCTCCAGGGGG - Intergenic
1143412501 17:6719188-6719210 GGTCGCTTCAGCCCAGTGGGTGG + Intergenic
1144733079 17:17539980-17540002 TGTCCCTGCACTCCTGGGGTGGG - Intronic
1144968765 17:19094006-19094028 TGGCCCATCTGCCCTGTGGGTGG + Exonic
1144979151 17:19158060-19158082 TGGCCCATCTGCCCTGTGGGTGG - Exonic
1144989071 17:19220172-19220194 TGGCCCATCTGCCCTGTGGGTGG + Exonic
1145994476 17:29097556-29097578 GGTCCCAGCAGTCCTTTGGGGGG - Intronic
1147146047 17:38485051-38485073 TGTCCCTTCTGTCCTCCAGGGGG - Intronic
1149074020 17:52576356-52576378 GGTGCCCTCAGTCCTGTGGTTGG - Intergenic
1150299523 17:64036713-64036735 TGGCCGGTCAGTCCTGTAGGTGG - Intergenic
1152822387 17:82443954-82443976 TGTGCCATGGGTCCTGTGGGCGG + Exonic
1203173355 17_GL000205v2_random:172412-172434 TGGCCCTTCAGTTCTGTATGTGG + Intergenic
1153095105 18:1392107-1392129 TGCCCCTTCAGACCTATGGATGG - Intergenic
1154023104 18:10682553-10682575 TCTCCCTTCAAGACTGTGGGTGG + Intronic
1158321468 18:56268661-56268683 TGTCCCTTCAGGTCTGGGGGTGG + Intergenic
1158882370 18:61793055-61793077 TCATCCTTCAGTCCTGGGGGAGG - Intergenic
1160874454 19:1290677-1290699 TTGCCCCTCAGTCCTGTGTGTGG + Intronic
1161559026 19:4960573-4960595 TGTCCCCACAGTCCTGGGAGAGG + Intronic
1162189644 19:8934718-8934740 TATTCCTTCAGTCCTGTTTGGGG + Intronic
1162936677 19:13984755-13984777 TGGCCCTTCAGTCCTGCCGGGGG - Intronic
1164005080 19:21141239-21141261 TCTCCCTTCAGTTCTGAGGGTGG - Intergenic
1165715772 19:38044878-38044900 TGCCACGTCAGTCCTGTTGGTGG - Intronic
1166825743 19:45607786-45607808 TGTCCCTTCTGCCCTAAGGGTGG + Intronic
1167997975 19:53421894-53421916 TGTCCATTAATTCCTGTGGTAGG + Intronic
1168007402 19:53502184-53502206 TGTCCATTAATTCCTGTGGTAGG + Intergenic
1168180817 19:54662118-54662140 AGTCCCTGAAGGCCTGTGGGAGG + Exonic
1168383799 19:55945997-55946019 TGCTCCTTCCGTCCAGTGGGTGG - Intergenic
1168649752 19:58085606-58085628 TGTCCTTCCTGTCCTGTCGGTGG - Intronic
925046888 2:778959-778981 TGTCCTTACATTCCTGGGGGTGG - Intergenic
927943166 2:27118545-27118567 TGTTCCAGCAGTCCTGGGGGAGG - Intronic
929053994 2:37860418-37860440 TGTACATTGAGTCCTGTGGGAGG + Intergenic
929812256 2:45200679-45200701 TGCCACTGCAGTCCTCTGGGTGG - Intergenic
931303055 2:61000059-61000081 TGTCCCTTGATATCTGTGGGGGG - Intronic
932317525 2:70795858-70795880 TTTCCCTCCATGCCTGTGGGCGG + Intergenic
932657733 2:73624856-73624878 TGTGCCTTGAGTCGGGTGGGGGG + Intergenic
932664410 2:73685140-73685162 TGTGCCTTGAGTCGGGTGGGGGG + Intergenic
932835446 2:75031537-75031559 TGTGCCTTCAGGCCTATGGGTGG + Intergenic
933554057 2:83809907-83809929 TGTACTTCCAGTACTGTGGGAGG + Intergenic
934522947 2:95031321-95031343 TGTCCCTTCATTCCTGTTGGGGG - Intronic
934668852 2:96194736-96194758 ATTCCCAACAGTCCTGTGGGAGG + Intronic
936491194 2:112973561-112973583 TGTCCTTTCAGGCCTAGGGGCGG + Intronic
937447183 2:121968444-121968466 TGTCCCTTCAGCCCTGTTGTTGG + Intergenic
937603697 2:123771523-123771545 TTCCCCTTCAGTTCTGTGTGTGG + Intergenic
937851429 2:126639559-126639581 TGTCCCTTAAGACCTAAGGGTGG + Intergenic
937986149 2:127638985-127639007 TGTCCCTGGAGGTCTGTGGGCGG + Exonic
938930019 2:136078534-136078556 TGTGCCTTAATTCCTTTGGGTGG + Intergenic
940977330 2:159960651-159960673 TGTCCCAGCAGATCTGTGGGAGG - Intronic
941041828 2:160631611-160631633 AGTCTCTTCAGTCATGTGAGTGG + Intergenic
944648846 2:201808250-201808272 TCACTCTTCAGGCCTGTGGGAGG + Intronic
945745341 2:213713638-213713660 TGTCTCTTGAGTCCTCTGTGTGG - Intronic
945947081 2:216004744-216004766 TGGCCTTACAGTCTTGTGGGAGG + Intronic
946155696 2:217805179-217805201 GGTCACTCCAGTCCTGCGGGTGG - Intronic
946396757 2:219447356-219447378 TGTCCCATCAGTGCTCGGGGTGG + Intronic
948489541 2:238303675-238303697 GCTCCCTGCAGACCTGTGGGCGG + Intergenic
1169054631 20:2610497-2610519 TGCCACTTCAGTCCAGTGCGTGG - Exonic
1171540032 20:25942999-25943021 TGTCCCTTCAGGTCTGGGGATGG + Intergenic
1171801031 20:29617322-29617344 TGTCCCTTCAGGTCTGGGGATGG - Intergenic
1172885508 20:38228228-38228250 TTTATCTTCAGGCCTGTGGGTGG + Exonic
1172976194 20:38907795-38907817 TGCCCCTTCAGACCTGTGCGAGG + Exonic
1174568601 20:51484859-51484881 TGTGTCTTCAGTCCTGCAGGAGG + Intronic
1175147335 20:56906892-56906914 TTTCCCTTCATTCCTCTGGCTGG - Intergenic
1175683154 20:61006034-61006056 TGTACCTTCAGATCTGTGTGCGG + Intergenic
1178943425 21:36926249-36926271 TGTCCCTTTGCTTCTGTGGGTGG - Intronic
1179345445 21:40551926-40551948 TGTCCATTCAGTCAGCTGGGGGG + Intronic
1179710754 21:43211771-43211793 AGTCCCCTAAGTGCTGTGGGAGG + Intergenic
1179788613 21:43743214-43743236 TGTCCCCACAGTGCTGGGGGCGG - Intronic
1179788682 21:43743417-43743439 TGTCCCCACAGTGCTGGGGGCGG - Intronic
1181325778 22:22044728-22044750 TGTCCCTGGAGCCATGTGGGGGG - Intergenic
1181862453 22:25829324-25829346 TGCCCTTTGAGTCCTGTGGGTGG + Intronic
1182029112 22:27143634-27143656 TGTCCTTCCAGGCCTGGGGGTGG + Intergenic
1183636635 22:39067636-39067658 TGTCCCTGAAGTCTTGTGGCAGG + Intronic
1183964231 22:41431776-41431798 TGTCCCTGCATCCCTGTGTGTGG - Intergenic
1184354294 22:43968573-43968595 TTTCCCTTCTGTCATGTGGCTGG + Intronic
1185203957 22:49526125-49526147 TGTACCTTCAGGCATGTTGGGGG - Intronic
1185225604 22:49650220-49650242 TTTCCCTTTAGTCCGGTGGAAGG - Intronic
950144527 3:10639687-10639709 TGTCCCTTCAGGCCTAGGTGTGG - Intronic
950880299 3:16317734-16317756 GGGCCCGCCAGTCCTGTGGGGGG - Intronic
952008280 3:28867922-28867944 TGTCCCCTCAGCCCTAAGGGAGG + Intergenic
952582194 3:34847576-34847598 TGTTCCTTCAGGCCCATGGGTGG - Intergenic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
953545616 3:43861917-43861939 TGTCCTTTCAGTCCTAGGGGTGG + Intergenic
954307612 3:49737900-49737922 TCAACCTTCTGTCCTGTGGGTGG + Intronic
954307655 3:49738211-49738233 TGTCCCTTGAGACCTCTGAGAGG - Exonic
954653828 3:52181933-52181955 TGACCCCTCTGCCCTGTGGGTGG - Intergenic
955835231 3:63047311-63047333 TGACCCTTGGTTCCTGTGGGAGG - Intergenic
957289414 3:78258935-78258957 AGTCCCTTCTTCCCTGTGGGAGG + Intergenic
959143655 3:102517248-102517270 TGTCCCTTCTGCCATGTGAGGGG + Intergenic
960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG + Intronic
962046026 3:131759893-131759915 TGTACCTTAAGTGCTGTGGAGGG + Intronic
962398324 3:135036569-135036591 TCACCCTTCAGACCTGTGGAGGG + Intronic
963290783 3:143485092-143485114 TCACCCTTCAGCCCTGTGGCAGG + Intronic
963580635 3:147122689-147122711 TGTCCCTTGGTTCCTGTGGGAGG - Intergenic
963961908 3:151318880-151318902 TGTCCCTTCACTACAGTAGGTGG + Intronic
966433423 3:179856740-179856762 TTTCCCTTCATTCCTTAGGGAGG + Intronic
967835132 3:193956074-193956096 TGACACTGCAGTCCTCTGGGTGG + Intergenic
967852510 3:194093108-194093130 TGTCCAGTCACTCCTGTGAGGGG - Intergenic
967862233 3:194160748-194160770 TTTGCCTTCAGTCCTTGGGGAGG + Intergenic
968008101 3:195256464-195256486 CTTCCCTTCCGTCCTCTGGGAGG - Intronic
968881266 4:3301410-3301432 TTTCCCTTGAATCCTGTAGGTGG + Intronic
972046857 4:34676565-34676587 TGTCCCTCCAGTCCTAGGAGTGG + Intergenic
973858513 4:55037245-55037267 TGTAACTTCAGCACTGTGGGAGG + Intergenic
974014354 4:56635290-56635312 AGTCCGTTCAGTCATTTGGGAGG - Intergenic
981869016 4:149464168-149464190 TGTCCTTTCTGTCAGGTGGGAGG - Intergenic
982107760 4:152025542-152025564 TGTCCCTTCAGGCCTAAGGATGG + Intergenic
986228601 5:5840801-5840823 TATCCCTTCATGCCTATGGGTGG - Intergenic
987071504 5:14341153-14341175 TTCCCCTTCAGTCCTGTGTATGG + Intronic
987230796 5:15891834-15891856 TGCCCCTTCAGGACTGTGTGTGG - Intronic
988106019 5:26749079-26749101 TCTCTCTTCAGTCCTGAGGTTGG + Intergenic
988923038 5:35962299-35962321 TGTACTTTAAGTCCTGTAGGGGG + Intronic
989064195 5:37443351-37443373 GATCCCTTCAGCCCTGTGAGTGG + Exonic
992028617 5:72697386-72697408 GTTCCCTTCACTCCTGTGAGTGG - Intergenic
993858081 5:93100009-93100031 TTTCCCTCCAGCTCTGTGGGAGG + Intergenic
993945346 5:94111524-94111546 TGCCCCCTCAGCCCTGTGGCTGG - Exonic
994418008 5:99499182-99499204 AATCCCTTCAGCCCTGTGAGTGG + Intergenic
994461957 5:100075971-100075993 AATCCCTTCAGCCCTGTGAGTGG - Intergenic
999092656 5:148951082-148951104 TTTGCCTTCAGTCTTGTGGAAGG + Intronic
999956747 5:156711204-156711226 GGTCCATTCAGTTCTTTGGGGGG + Intronic
1002604002 5:180371308-180371330 TCTCCCATCTGTCCAGTGGGTGG - Intergenic
1002692308 5:181059070-181059092 TGCCACTTCAGTCCTGGGGAGGG + Intronic
1003568936 6:7243312-7243334 TGTCTCCACAGTCCTGTAGGAGG + Intronic
1005087858 6:22025446-22025468 TTTCCATTCATTGCTGTGGGTGG + Intergenic
1005411922 6:25558552-25558574 TGTCCCTTAAGTTCTGAGGGTGG - Intronic
1005888367 6:30115035-30115057 TCTCCATTCAGTCCAGTGGATGG - Intergenic
1006405821 6:33844198-33844220 TGGCCCTTCAGGCCTAGGGGTGG + Intergenic
1006613745 6:35311275-35311297 TGACCCTTTAGTCCTCTTGGTGG + Intronic
1007284066 6:40735312-40735334 TGGTACTTCTGTCCTGTGGGAGG + Intergenic
1007552722 6:42742502-42742524 TGTCCCTTCAGCCCTAAGGATGG + Intergenic
1010471226 6:76230602-76230624 TGTCCTTTCAGACCTAAGGGTGG + Intergenic
1010481060 6:76354983-76355005 TGTCCTTTCTGTCATGTGAGGGG - Intergenic
1011295886 6:85826490-85826512 TGACACTTCAGCCCTCTGGGTGG - Intergenic
1012008887 6:93754523-93754545 TGTCGCTTCATACCTGTGGTAGG + Intergenic
1013720401 6:113019307-113019329 TTTCCCTTCTCTCCTGTGGAAGG - Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1015873585 6:137800807-137800829 TGTTCCTTCAGCCCTATGGACGG + Intergenic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1020221653 7:6243000-6243022 TGCCCCTTCAGTTCTCTAGGAGG + Intronic
1021762563 7:23915519-23915541 TGTCAGTTCACTCCTGTGGAAGG + Intergenic
1021974303 7:25997016-25997038 TGTCCCTTCAGCCCTAGGGGTGG - Intergenic
1022349129 7:29550379-29550401 TGTCTGTGCAGTCTTGTGGGTGG - Intergenic
1022965128 7:35465441-35465463 TGCCCCTTCAGACCTAGGGGTGG - Intergenic
1023628311 7:42138556-42138578 TTTCCCTTCACCCCTGGGGGAGG + Intronic
1026036481 7:66833463-66833485 TCTCCCTGCAGTTCTCTGGGAGG - Intergenic
1026350890 7:69514172-69514194 TGTCCCTGCAGTCTAGTGAGGGG - Intergenic
1028420963 7:90632349-90632371 TGCCTGTTCAGTGCTGTGGGTGG + Intronic
1028683457 7:93565699-93565721 TGACCTTTCAGTCCTGTAGAAGG + Intronic
1028771603 7:94630958-94630980 TGTCCCTGCAGTTCGGTGGATGG + Intronic
1028942166 7:96533674-96533696 AGTCCCTGGAGTCCTCTGGGGGG + Intronic
1029705704 7:102274691-102274713 TGACCCTTCAGCCCTGCCGGTGG + Intronic
1029915166 7:104201343-104201365 GGTCCCTTCAGGCCTGGAGGTGG + Intronic
1030561475 7:111092171-111092193 TGTCCCTTCAGACCAGCGAGGGG - Intronic
1032197269 7:129796586-129796608 TGTCCCTTCTGTCCTGGGAGAGG + Intergenic
1032882039 7:136100365-136100387 TGTCCATGCAGTACTGTGTGAGG + Intergenic
1033282333 7:140015211-140015233 TGTCCCCTCCCTCCTGTGGATGG - Intronic
1035417722 7:158704305-158704327 TGTCCCCTCAGTCCTGGGCATGG - Intronic
1035417741 7:158704386-158704408 TGTCCCCTCAGTCCTGGGCATGG - Intronic
1038138867 8:24821345-24821367 TTTCCCTTCAGTCCAGGGAGTGG - Intergenic
1038533668 8:28338628-28338650 TCTCTCTTCAGGCTTGTGGGAGG - Intronic
1040607708 8:48951010-48951032 TGCCCCTTCCATCCTGTGGGTGG + Intergenic
1043547858 8:81335401-81335423 GGTCCCTTCATTCCTGGGAGGGG + Intergenic
1044220905 8:89668811-89668833 CTTCCCTACAGTCCTGAGGGCGG + Intergenic
1044679308 8:94761228-94761250 TGTTCCCTCAGTCCTGGTGGTGG - Intronic
1045366032 8:101477176-101477198 TGGCCTTTCAGTCATGAGGGAGG - Intergenic
1048233994 8:132673148-132673170 ACTCGCCTCAGTCCTGTGGGCGG + Intronic
1048333850 8:133489099-133489121 TGTCCCTTCAGCCCTAGGGTTGG + Intronic
1048973511 8:139658218-139658240 CAGCCCTTCAGGCCTGTGGGTGG - Intronic
1049360454 8:142210317-142210339 TGACCCTTCAGTCCTGAGTGGGG + Intergenic
1049435068 8:142582727-142582749 TGGCCCCTCAGTCCTGCTGGAGG + Intergenic
1049787635 8:144458682-144458704 TGTCCACTCTGTTCTGTGGGTGG - Intronic
1051708169 9:19902274-19902296 TGTCCATTCAGTCAGTTGGGAGG + Intergenic
1052113304 9:24617043-24617065 TGTGTCTCCAGGCCTGTGGGAGG - Intergenic
1052237931 9:26235067-26235089 TGCCCCCTCATTCCTGAGGGAGG - Intergenic
1053179850 9:35959722-35959744 TCTCTCTTCAGTCATGGGGGAGG + Intergenic
1053181617 9:35976419-35976441 TGTTCCTCCAGTCCTGAGGGTGG + Intergenic
1053514900 9:38722459-38722481 TGTACCTACAGGCCTGTGTGGGG + Intergenic
1054451358 9:65405025-65405047 TGACCTTTCAGGGCTGTGGGAGG - Intergenic
1054710076 9:68502442-68502464 TGTCCCTTTCAGCCTGTGGGTGG + Intronic
1056405154 9:86266832-86266854 TGTGCCTGTAATCCTGTGGGAGG - Intronic
1058518312 9:105796843-105796865 TGTTCCTACAGTCCGGTGCGGGG - Intergenic
1061528878 9:131194253-131194275 GATCACTTCAGTCCTGGGGGTGG - Intronic
1062308629 9:135923626-135923648 TCTCCCTCCAGTCCTGGGGACGG + Intergenic
1188193960 X:27208015-27208037 AAACCCTTCAGTCCTGAGGGGGG - Intergenic
1189589940 X:42500139-42500161 TGTCCCTTCATACTTGTGGAGGG - Intergenic
1190464647 X:50713685-50713707 AGTCCCATCAGTACTGTGGGTGG - Intronic
1190648221 X:52543363-52543385 TGTCCCTGCAGAGCTGTGGAAGG + Intergenic
1190652674 X:52582491-52582513 TGTCCCTGCAGAGCTGTGGAAGG + Intergenic
1190681543 X:52830737-52830759 TGTCCCTGCAGAGCTGTGGGAGG - Intergenic
1190998620 X:55636777-55636799 TGTCCCTGCAGAGCTGTGGGAGG - Intergenic
1192059337 X:67807363-67807385 TGTGCCTTCAGTCCTGTTTGAGG + Intergenic
1194074376 X:89370151-89370173 TGTCTCTTCAGTCCTAAGTGTGG + Intergenic
1196920590 X:120581419-120581441 TGACCTTTCAGACCTGTGCGTGG + Intergenic
1200729768 Y:6721678-6721700 TGTCTCTTCAGTCCTAAGTGTGG + Intergenic