ID: 960008767

View in Genome Browser
Species Human (GRCh38)
Location 3:112810493-112810515
Sequence GAGAAATATATGACCACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960008767 Original CRISPR GAGAAATATATGACCACTAA AGG (reversed) Intronic
900858863 1:5210210-5210232 GCGAAATATATGTCAACTATAGG + Intergenic
901624409 1:10615872-10615894 GATAAATGTAAGACTACTAATGG + Intronic
907819624 1:57954188-57954210 GAAAAATAGATGGCCACTAAAGG - Intronic
908345625 1:63229356-63229378 GATTAAAATATGGCCACTAAGGG + Intergenic
909034957 1:70586433-70586455 GAGAAATATGTAACCACAATAGG - Intergenic
909230766 1:73086654-73086676 GAAAAATATATGACCTCAAGCGG + Intergenic
909653679 1:78005292-78005314 GAGAAATATATGATCAGTTTGGG + Exonic
909844624 1:80376416-80376438 GGGAAATATATGACTACAGAAGG + Intergenic
912139156 1:106700475-106700497 GAGGAATTTATGGCCACTAAAGG + Intergenic
916326401 1:163564726-163564748 GAGAAATATATCAGCATTTATGG - Intergenic
916907881 1:169308421-169308443 GAGAAACATAAGAACACTATTGG + Intronic
917686680 1:177423716-177423738 GACCAATATATTACCACTTATGG - Intergenic
919324300 1:196086871-196086893 GTAAAATATATGACCAAAAAAGG + Intergenic
921141941 1:212316676-212316698 GAGAAATACATGATCCCAAAGGG - Intronic
921147125 1:212368414-212368436 GAGAGATGTGTGACCACTCAGGG + Intronic
924480002 1:244421400-244421422 GATAAATGTATGATCACTCATGG + Intronic
1063422944 10:5928101-5928123 AAGAAATACATGACCACTGCTGG - Intronic
1063764560 10:9123575-9123597 TAGAAATATTTGAACACTAATGG - Intergenic
1065339667 10:24693082-24693104 GAGAAAACAATGACCACAAAAGG + Intronic
1069855766 10:71440139-71440161 GAGAAATACTTGAGCTCTAAGGG + Intronic
1073409588 10:103329426-103329448 GAAAAAAATATAACCAGTAACGG + Intronic
1074045440 10:109833800-109833822 TAGAATTATATCTCCACTAATGG + Intergenic
1074553011 10:114462842-114462864 GAGAAATATGTCACTTCTAAGGG - Intronic
1074839219 10:117331983-117332005 GAGAAATGTATAAAAACTAACGG + Intronic
1074989569 10:118691225-118691247 TGGACATATTTGACCACTAAAGG + Intronic
1078066939 11:8084877-8084899 GAGAACTAGATGACCTGTAAAGG - Intronic
1078289267 11:9990651-9990673 GAGAACTGGATGAACACTAAGGG + Intronic
1080933620 11:36839011-36839033 GAGAAATATATGTGCATGAAGGG + Intergenic
1081440803 11:43078636-43078658 GTGGACTAAATGACCACTAAAGG + Intergenic
1084138960 11:67210553-67210575 GAAAAATATATTAACATTAAAGG + Intronic
1086013076 11:82129324-82129346 AAGTAATAAATGACAACTAAGGG - Intergenic
1087368050 11:97247273-97247295 GAGAAATATGACACCACCAAAGG - Intergenic
1087385961 11:97468703-97468725 TAAAAATATATGACCAGTTAAGG - Intergenic
1089437975 11:118487516-118487538 GAGAAACATATTAACACTTAGGG - Intronic
1090477615 11:127037729-127037751 GATAATTATATGCCCACTATGGG + Intergenic
1090971411 11:131646742-131646764 GAGAAAAACATGAACTCTAAAGG + Intronic
1093481320 12:19606709-19606731 GAGAAATATTTAAAGACTAAGGG - Intronic
1093985919 12:25533221-25533243 GAGAAAAAGATAACTACTAAAGG - Intronic
1094228415 12:28074204-28074226 GAGAAATATGAGACCATTTAAGG - Intergenic
1094321440 12:29188319-29188341 GAGAAATAAATGAAAATTAAGGG - Intronic
1094687060 12:32728343-32728365 GAAAAATAGATTACCACAAATGG + Intronic
1098140915 12:67449670-67449692 GCAAAATACATGACCACTTAGGG - Intergenic
1098520755 12:71432861-71432883 GAGAAATAGATAACCAGGAAAGG + Intronic
1099403688 12:82232581-82232603 GAGAAATATTTAACCTCTTATGG - Intronic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1099815217 12:87638053-87638075 CAAAATTATATGATCACTAAGGG - Intergenic
1100080535 12:90843906-90843928 GAGAAATATAAGAACATCAAAGG + Intergenic
1100722037 12:97369366-97369388 GAGGGATAAATGACCACAAATGG + Intergenic
1100801997 12:98241802-98241824 CAGAAATGTAGGACCACAAATGG - Intergenic
1106057405 13:26251688-26251710 GAGAAAGAGATAGCCACTAAGGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108385153 13:49892837-49892859 GAGAAATGTCTGTCCACTGAGGG + Intergenic
1109153999 13:58881627-58881649 CAGAAAAATCTGAACACTAAAGG - Intergenic
1109350055 13:61168791-61168813 GAGAAATAAATGAAAAGTAATGG - Intergenic
1109657934 13:65419319-65419341 GACAAATATATAAACACTACTGG + Intergenic
1110197178 13:72803736-72803758 GAGAATGTTATGACCACTAGAGG + Intronic
1110414576 13:75238080-75238102 GAGAAACATCTGTCCACTGAGGG - Intergenic
1110639863 13:77810510-77810532 GTGACATATATAACCACTATTGG - Intergenic
1111152343 13:84271455-84271477 GATAAATATATGAATACTTAAGG - Intergenic
1112959810 13:105109778-105109800 GAGAAAGATATGTCTAGTAAAGG - Intergenic
1114241363 14:20871426-20871448 GAGAAAAATATGATTACCAAGGG + Intergenic
1118447878 14:65868170-65868192 GAGCAATATAAAACCACTGAAGG + Intergenic
1119339616 14:73865759-73865781 CAGAAATATTTGACCACGAAGGG + Intronic
1125444811 15:39743088-39743110 GAAAAATATATTACCACTTCAGG - Intronic
1127591684 15:60431406-60431428 GAGGAAGATATTACCACAAAAGG + Intronic
1131582701 15:93660780-93660802 CAGAAATTTCTGAGCACTAATGG + Intergenic
1134432466 16:14223329-14223351 AAGAAAAATATGACCATTCAGGG + Intronic
1135035770 16:19075666-19075688 GAGACAGATATGACCGGTAATGG - Intronic
1135233266 16:20729630-20729652 GAGAATTAAATGACCACTTTTGG - Intronic
1136670723 16:31854728-31854750 GTGGAATATTTGACCACTAAGGG - Intergenic
1137396780 16:48121715-48121737 GAGAAAAGTATGATCACCAAAGG - Exonic
1138894255 16:61183661-61183683 GAAAAATATGTGCCCATTAATGG + Intergenic
1140280886 16:73554685-73554707 CAGGAAAATATGACCACCAACGG - Intergenic
1140948201 16:79790944-79790966 GAGAAATATATGACAGGGAATGG - Intergenic
1142524218 17:527413-527435 GAGGACTTTATGACCACCAAAGG - Intronic
1144175310 17:12699422-12699444 GAGAAATATATGATCAAAGAAGG - Intronic
1145758671 17:27411832-27411854 GTGAAATGTATGGCCACTACGGG + Intergenic
1146050142 17:29543654-29543676 TAGAAATCCATGAACACTAAAGG + Exonic
1154529231 18:15327822-15327844 GGATAATATGTGACCACTAAAGG - Intergenic
1156726957 18:40140106-40140128 AATGAATATATGACCACTGATGG + Intergenic
1157137542 18:45071422-45071444 GAGAAAAAGATGCCCACTCAGGG - Intergenic
1158183790 18:54748243-54748265 GATAAAGATATAAGCACTAAAGG + Intronic
1159447497 18:68558550-68558572 GGTAAATATATGACCCTTAAGGG + Intergenic
1164069544 19:21754187-21754209 GAGAAATAAATGATAAATAATGG + Intronic
1164598962 19:29548485-29548507 GAGGAATAATTGAACACTAACGG - Intronic
1164946938 19:32303656-32303678 GGGAAATATAACACCACCAAAGG - Intergenic
1168086269 19:54049639-54049661 GAGAAAGATATGAAATCTAATGG - Intronic
931357621 2:61550861-61550883 GAGGAAAAGAGGACCACTAAAGG + Intergenic
932382900 2:71301836-71301858 AAAAAATATCTTACCACTAATGG + Intronic
932573068 2:72948290-72948312 GAGAAATATATAAACATAAAAGG + Intronic
933189314 2:79315384-79315406 GAGAAATAACTGACTGCTAATGG - Intronic
934500290 2:94855708-94855730 GAATAATATGTGACCACTGAAGG - Intergenic
939670153 2:145001223-145001245 GAGAAATATGTGACTTCTAGGGG + Intergenic
939949617 2:148454049-148454071 GAAAAATCTATGTCCACCAAAGG + Intronic
942306078 2:174608881-174608903 CAGAACTATATGGACACTAAAGG + Intronic
944706807 2:202297885-202297907 CAGAAAAATATGAACACAAAAGG + Exonic
945478494 2:210316112-210316134 GAGAAATTTAAGACCACCAATGG + Intergenic
946557313 2:220872910-220872932 GAGAAAGATATGAATAATAATGG + Intergenic
948687870 2:239681506-239681528 CAGAAATTTATGAACATTAAAGG - Intergenic
1170551941 20:17485409-17485431 GGGAAATCTGTGACAACTAAGGG + Intergenic
1171096325 20:22335647-22335669 GAGAAATATAAGACCATGACAGG - Intergenic
1171235670 20:23522419-23522441 AAGAAATATATTATGACTAAAGG - Intergenic
1174013057 20:47466165-47466187 GATAAATATACCACCACAAATGG - Intergenic
1175394470 20:58649520-58649542 GGGAAATATTTGCCCAATAAGGG - Intergenic
1176893534 21:14348142-14348164 GAGAAATAGAAGAACACTAAGGG - Intergenic
1177784677 21:25658441-25658463 GAGAAATGTATAACCACTCTGGG + Intronic
1179609363 21:42539966-42539988 GCGAAAGATTTGACCACTTAGGG + Intronic
1182484981 22:30634214-30634236 GAGAAATCTGGGACCCCTAAGGG - Intergenic
1182950747 22:34373422-34373444 GAAATAAATATGACCACTCAGGG + Intergenic
950956333 3:17057423-17057445 GAGTAATATATGAACACGGAGGG - Intronic
951424155 3:22523054-22523076 CATAAATATATGCACACTAAAGG + Intergenic
951689400 3:25380126-25380148 GAGAAAAATCTGACAACTAATGG + Intronic
951922244 3:27869614-27869636 GAGAAGTATAATACCACCAAAGG - Intergenic
955713966 3:61809324-61809346 GAGAAAAATGTGATCACTGATGG + Intronic
956102691 3:65784965-65784987 GAGAAGGAAATGACTACTAATGG + Intronic
957817530 3:85320904-85320926 CAGAAATAAATCACCACTATAGG - Intronic
960008767 3:112810493-112810515 GAGAAATATATGACCACTAAAGG - Intronic
964489812 3:157223812-157223834 GAGAAATATTTGTCCTCAAAGGG - Intergenic
964584631 3:158283625-158283647 GAGAACTAAATGCCCAATAATGG - Intronic
965677128 3:171209530-171209552 GAGAGATATATGACAACAAAGGG - Intronic
965946553 3:174249053-174249075 GACAAATATATGGGCACTAATGG - Intronic
971937770 4:33174990-33175012 AAAATATATATTACCACTAATGG + Intergenic
973006197 4:45009825-45009847 GAGAAAAATAAGAACAGTAAGGG + Intergenic
974404024 4:61442254-61442276 GAGAAATCTGTGACAAGTAAAGG + Intronic
975962443 4:79929147-79929169 TGGAAATAGATGACCACTACTGG + Intronic
976615852 4:87076035-87076057 GAGAAAGATTAGAACACTAAGGG + Intronic
976674284 4:87687129-87687151 GAGAAATGTATGACAAATATGGG - Intergenic
977188820 4:93974778-93974800 GTAAAATATATTACCAATAATGG - Intergenic
979825130 4:125223260-125223282 GATAAATATAAAACCCCTAAAGG + Intergenic
980452261 4:132989446-132989468 GAGACATATATGTCCACAAAAGG + Intergenic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
982034487 4:151332208-151332230 GAGAAGGATATGATCACTAGGGG - Intergenic
983162871 4:164438626-164438648 GAAAAATATATGACAATCAATGG - Intergenic
984233483 4:177129371-177129393 GGGAAATATGACACCACTAAAGG - Intergenic
989489001 5:42028626-42028648 GAGAAAAACATGCTCACTAAAGG - Intergenic
991620179 5:68536639-68536661 AAGAAAAATATCACCAGTAATGG - Intergenic
992548536 5:77839662-77839684 AAGAAATCCATGACCACTGAAGG + Intronic
993692618 5:91021346-91021368 GAGAAAAATAATACCACCAAGGG - Intronic
995895979 5:117010969-117010991 TAGAAAGAAATGACCACTACTGG - Intergenic
996035866 5:118758336-118758358 GAGATATATAGGATCAATAATGG - Intergenic
999075160 5:148788736-148788758 GATGAAGATATGACCACTAGTGG - Intergenic
999186143 5:149710872-149710894 GAAAAAAATATGTCCACTCAAGG - Intergenic
999819471 5:155211345-155211367 GAGAAATATATGGCTACAGATGG - Intergenic
1002680884 5:180963049-180963071 AAGAGATATAATACCACTAAAGG - Intergenic
1003958256 6:11186247-11186269 TATAAATATATGAGCACTTAAGG + Intronic
1004321099 6:14632336-14632358 TAGAAATATATGACCACTCTAGG - Intergenic
1005070775 6:21860526-21860548 GAGAAATAAATGACCCAAAAGGG + Intergenic
1005387864 6:25303721-25303743 GAGAAATATATGTTAAATAACGG + Intronic
1006003385 6:30984071-30984093 GAGAGAAATGTGACCACTACTGG + Intronic
1009788484 6:68368781-68368803 ATGAAATATATGACCAGAAATGG - Intergenic
1012256251 6:97036397-97036419 GGGAAACATAACACCACTAAAGG - Intronic
1014961015 6:127684989-127685011 GAAAAATATATCACTACAAAGGG - Intergenic
1016370374 6:143367392-143367414 GAGAAATTTGTGAACACTGAGGG + Intergenic
1016432665 6:144003908-144003930 GAGAGATATATGTCTACCAACGG + Intronic
1016446219 6:144134466-144134488 GAGAAATATGTGACTACAAATGG + Intergenic
1020425475 7:8061398-8061420 GATATACAAATGACCACTAAAGG - Intronic
1020552755 7:9627247-9627269 AAGAAATAATTGACCTCTAAAGG - Intergenic
1021680190 7:23122265-23122287 GAGAAATCTATGGCCAGTGATGG - Intronic
1022206998 7:28174507-28174529 CCGAAATATATGAACTCTAAAGG + Intronic
1022617919 7:31951592-31951614 GAGAAATCCCAGACCACTAAGGG - Intronic
1022774070 7:33506250-33506272 GAGATATATATGACCACCACGGG + Intronic
1023599426 7:41866529-41866551 GATAAAAATATGAACAGTAAAGG - Intergenic
1023665471 7:42518447-42518469 AAGAAAGATGTGATCACTAAGGG + Intergenic
1024802698 7:53099382-53099404 GAGAAATCTGTGAACACTATGGG - Intergenic
1025291396 7:57727939-57727961 AAGAAATATATGCACTCTAATGG - Intergenic
1026143005 7:67722307-67722329 GAGAAATAAATGACGAATGAAGG + Intergenic
1027822499 7:83064873-83064895 GAGAAAAATGTGACTATTAAAGG - Intronic
1028302708 7:89221356-89221378 GAGAAATAAAAGACCAGGAAAGG + Intronic
1030215366 7:107039621-107039643 AAGAAATATATACCCACTCAAGG - Intergenic
1030498991 7:110335463-110335485 GACAGATATATGAACATTAAAGG - Intergenic
1032140069 7:129320769-129320791 GAGGAAAATACCACCACTAATGG - Intronic
1033910780 7:146260633-146260655 GAGAAATAGATGAAAACAAAGGG - Intronic
1034623539 7:152474909-152474931 GAGAAATACGAGAGCACTAAGGG - Intergenic
1034910043 7:154988381-154988403 GATACATATATGACCACTCAGGG - Intronic
1037515462 8:19626960-19626982 GTGAAATGTACAACCACTAACGG + Intronic
1038760384 8:30380382-30380404 GAGAATTATAAGACCACAAAGGG - Intergenic
1045014979 8:97993362-97993384 TTGAAATAAATGACCACTGATGG - Intronic
1046904798 8:119560837-119560859 GAGAAATTTATAGCTACTAAGGG - Intronic
1047443691 8:124901045-124901067 GAGAAATATATGACAAGGGAGGG + Intergenic
1047638331 8:126791103-126791125 GAGGAAGATATGCCCATTAAGGG - Intergenic
1048822098 8:138390087-138390109 AATAAAAATATGACCAATAATGG + Intronic
1050614136 9:7383972-7383994 GAGAAATATCTGTCCACAATTGG - Intergenic
1051513216 9:17903185-17903207 GAGAAATATAGGAAGACTGAGGG + Intergenic
1051934373 9:22427463-22427485 GAGAAATATTTAACAACTAAAGG - Intergenic
1052568450 9:30189098-30189120 GAGAGAAATATGACCAAAAAAGG + Intergenic
1053656879 9:40224836-40224858 GAATAATATGTGACCACTGAAGG + Intronic
1053753906 9:41283690-41283712 GAGAAAAATAAGAACAGTAAGGG + Intergenic
1053907246 9:42854123-42854145 GAATAATATGTGACCACTGAAGG + Intergenic
1054259426 9:62848051-62848073 GAGAAAAATAAGAACAGTAAGGG + Intergenic
1054332350 9:63771986-63772008 GAGAAAAATAAGAACAGTAAGGG - Intergenic
1054368997 9:64371111-64371133 GAATAATATGTGACCACTGAAGG + Intronic
1054527720 9:66151393-66151415 GAATAATATGTGACCACTGAAGG - Intronic
1054676628 9:67860865-67860887 GAATAATATGTGACCACTGAAGG + Intronic
1056535609 9:87524909-87524931 GAGAAATAAAAGACTACAAATGG + Intronic
1057852659 9:98577264-98577286 TAGAACTATATGACCACCAGGGG - Intronic
1057873218 9:98733517-98733539 GAGAAAAAGGTGACCACCAAGGG + Exonic
1059581492 9:115554191-115554213 GAGATATATATCATCAATAAAGG - Intergenic
1059798207 9:117722836-117722858 AATAAACATATAACCACTAAAGG - Intergenic
1060332313 9:122684034-122684056 GGGAAATATAACACCACCAAAGG + Intergenic
1061563066 9:131419069-131419091 GAGAAATAAATGAGCAGTACTGG + Intronic
1188578075 X:31677653-31677675 GAGACACATGTTACCACTAATGG - Intronic
1189417755 X:40830112-40830134 GGGAAATTCATGACCACTATGGG - Intergenic
1189972334 X:46430927-46430949 GATAAAAATATGAACAATAAAGG + Intergenic
1191638860 X:63409016-63409038 GAAAAAAATATTTCCACTAAGGG + Intergenic
1192142032 X:68654101-68654123 GAGGAATAGATGACCTCCAAGGG - Intronic
1193168685 X:78311247-78311269 GAGAGAAATATGACCAAGAAGGG + Intronic
1193454863 X:81718830-81718852 GAAAACTATATGACCATAAAAGG - Intergenic
1194472748 X:94317537-94317559 AACAGATATATGAACACTAAAGG - Intergenic
1195799887 X:108696103-108696125 AAAATATCTATGACCACTAATGG + Intronic
1197681310 X:129388009-129388031 GAGAAATAAGAGACCATTAAAGG - Intergenic
1200904299 Y:8465771-8465793 GAGAATCACATGACCCCTAAAGG - Intergenic
1201366655 Y:13214046-13214068 GAGAGATATATGAAGACAAATGG - Intergenic