ID: 960009288

View in Genome Browser
Species Human (GRCh38)
Location 3:112815911-112815933
Sequence GTTGCAGTCCAGAGACAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960009281_960009288 21 Left 960009281 3:112815867-112815889 CCATGGCCCAAGTTCACTGCTGG 0: 1
1: 0
2: 1
3: 29
4: 224
Right 960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 204
960009283_960009288 15 Left 960009283 3:112815873-112815895 CCCAAGTTCACTGCTGGACCATC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 204
960009284_960009288 14 Left 960009284 3:112815874-112815896 CCAAGTTCACTGCTGGACCATCA 0: 1
1: 0
2: 1
3: 13
4: 131
Right 960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 204
960009285_960009288 -3 Left 960009285 3:112815891-112815913 CCATCACTCATCTCACCAATGTT 0: 1
1: 1
2: 0
3: 8
4: 205
Right 960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960009288 Original CRISPR GTTGCAGTCCAGAGACAAGG AGG Exonic
901592035 1:10352345-10352367 GTTCCAGACCAGAGAGGAGGTGG + Intronic
906049158 1:42856472-42856494 GTGGCAATCCAGAGAGAGGGTGG - Intergenic
906700045 1:47851083-47851105 GTACCAGTCCACAGACCAGGTGG + Intronic
906747321 1:48231168-48231190 GTTGGGGTCCAGAGACAGGGGGG + Intronic
907873679 1:58465913-58465935 GAAGCAGTCCTGAGAAAAGGTGG - Intronic
908018495 1:59873900-59873922 GTTGCAGTGATGAAACAAGGTGG + Exonic
909708990 1:78622566-78622588 GTTTCCATCCACAGACAAGGGGG - Intronic
912185918 1:107275560-107275582 GTTCCAGTCCAAAGACCAGCAGG + Intronic
913343887 1:117788563-117788585 GTTTCAGTCTAGTGACAAGATGG - Intergenic
914007227 1:143742954-143742976 ATTGCAGCACAGAGACAAAGAGG - Intergenic
914085088 1:144447082-144447104 TTGGCTGTCTAGAGACAAGGCGG - Intronic
914363138 1:146953163-146953185 TTGGCTGTCTAGAGACAAGGCGG + Intronic
914488541 1:148133979-148134001 TTGGCTGTCTAGAGACAAGGCGG - Intronic
914588904 1:149089060-149089082 TTGGCTGTCTAGAGACAAGGCGG - Intronic
914646044 1:149653448-149653470 ATTGCAGCACAGAGACAAAGAGG - Intergenic
916474044 1:165151401-165151423 GTTGCAGTGGAGAAACATGGTGG - Intergenic
920302999 1:205000929-205000951 GTCGCTGTCCAGGGACAAGCAGG - Intronic
921771210 1:219041995-219042017 GTTTCAGTCCCCAGACAATGAGG - Intergenic
921836012 1:219779529-219779551 GTTGGAGTCCAGGCACAATGAGG + Intronic
924028648 1:239865128-239865150 AATGCAGTCCAAAGAGAAGGAGG + Intronic
1062790197 10:298785-298807 GGTGCAGCCCAGTGACAGGGAGG - Intronic
1064920104 10:20506885-20506907 TTTGCAGACCAGAGACAGAGTGG + Intergenic
1065427247 10:25618632-25618654 GTTTCAGTCCCCAAACAAGGAGG + Intergenic
1067497791 10:46774986-46775008 CTTGATGTCCAGAGAGAAGGAGG + Intergenic
1067596858 10:47565428-47565450 CTTGATGTCCAGAGAGAAGGAGG - Intergenic
1068119101 10:52768095-52768117 GTTGCAGTAAAAAGACAAGGAGG + Exonic
1069641836 10:69961373-69961395 GGTGCAGTCCAGTGATAGGGTGG - Intronic
1071569675 10:86690139-86690161 TTTGCAATCCAGAGAGCAGGTGG - Intronic
1072831252 10:98661006-98661028 CTAGCAGTCCAGATTCAAGGTGG - Intronic
1073526173 10:104184265-104184287 GTTTCAGTCCCCAAACAAGGAGG - Intronic
1073609558 10:104929624-104929646 CTTGAAGCCCAGAGACAATGGGG - Intronic
1074305018 10:112269035-112269057 GTTCCAGTGCATAGAAAAGGAGG + Intergenic
1076705051 10:132296955-132296977 GAGGCAGCCCAGAGACAGGGAGG + Intronic
1078241614 11:9535565-9535587 GTTGCAATCCTGTGACAAGAAGG + Intergenic
1080335369 11:31189430-31189452 GTTTCAGTCCTGAGATAAGAAGG - Intronic
1080335936 11:31196287-31196309 GTTGGTGTCCAGAGACTTGGAGG - Intronic
1081724947 11:45321528-45321550 GGTGGAGGCCAGAGACAAAGAGG - Intergenic
1084670630 11:70604576-70604598 GTTGCTGTGTAGAGACAATGAGG + Intronic
1087170525 11:95045371-95045393 ACTGCAGTCCAGAGGCAATGAGG - Intergenic
1091200859 11:133779820-133779842 GTGGGAGTGCAGAGACAAAGAGG - Intergenic
1092125494 12:6072336-6072358 GTTGCAGTCTCGAGAGAGGGAGG + Exonic
1093572893 12:20689021-20689043 GTTTCAGGCCAGAGCAAAGGGGG - Intergenic
1094172976 12:27513724-27513746 GTAGCAGGCAAGAGAGAAGGAGG - Intergenic
1094676760 12:32628134-32628156 GTTGAAGTCCACAGACATTGTGG + Intronic
1094725795 12:33114510-33114532 ATTGTATTCCAGAGACAAGAGGG - Intergenic
1096137799 12:49217094-49217116 GATGCAGTCCAGGGACCATGTGG + Intronic
1096555150 12:52399286-52399308 CTTTCATTCCAGAGACAAGCTGG - Intronic
1102885936 12:116521770-116521792 GATGCAGTCCAGACACCATGGGG + Intergenic
1106172119 13:27297175-27297197 ATTGAGGTCCAGGGACAAGGAGG + Intergenic
1108226407 13:48294215-48294237 GATGCAGTGCAGATAGAAGGTGG - Intergenic
1109284590 13:60396530-60396552 CTGGCAGTACAGAGCCAAGGTGG + Intronic
1114407182 14:22467782-22467804 ACTGCAGTCCAGAGACATGGTGG - Intergenic
1118203317 14:63697963-63697985 GTTGCAGGCCAGAGCTAAGGGGG + Intronic
1122198708 14:100108897-100108919 TTTGGGGTCCAGAGACAAAGAGG - Intronic
1122890482 14:104729914-104729936 GTGGCAACCCAGAGGCAAGGAGG + Exonic
1122898494 14:104772226-104772248 GCTGCAGTCCTGGTACAAGGAGG - Intronic
1123697958 15:22892505-22892527 GGTGCATTCCTGAGATAAGGAGG - Intronic
1125676779 15:41506209-41506231 GATGCGGGCCAGAGTCAAGGTGG + Intronic
1126362612 15:47861734-47861756 GCTGCAGACCTGAGAAAAGGAGG + Intergenic
1126941118 15:53766674-53766696 GTTGCAGTCAAGATACCAGCTGG - Intergenic
1128504598 15:68257729-68257751 GATGAAGGCCAGAGAAAAGGTGG - Intergenic
1129018139 15:72487739-72487761 CTGGAAGCCCAGAGACAAGGAGG - Intronic
1130092499 15:80832826-80832848 GATGCAGAACAGAGACAAGTTGG - Intronic
1131546106 15:93316821-93316843 TCAGAAGTCCAGAGACAAGGAGG + Intergenic
1132648208 16:1008729-1008751 GTTGAGGTCCAGAGAGATGGGGG + Intergenic
1132779748 16:1616335-1616357 GTTGGAGGCCAGGGACATGGGGG - Intronic
1136142307 16:28295259-28295281 GCTGCAGTCCAGAGACTATCTGG - Intronic
1136342723 16:29655446-29655468 GTTACAGTCCAGAGGGAGGGGGG + Intergenic
1136591972 16:31223064-31223086 GCGGCAGTCCAGAGGCAAAGGGG - Intronic
1138041457 16:53674272-53674294 TTTGAAGTCCCGAGACAAGGAGG - Intronic
1138541192 16:57688835-57688857 GTGGGAGGCCAGTGACAAGGAGG - Exonic
1139476064 16:67203159-67203181 GCTGCAGTACGGAGACATGGAGG + Exonic
1141073933 16:80985177-80985199 AGTGCAGTCCAGAGACACCGAGG + Intronic
1144090175 17:11849311-11849333 GTTGCAGTGCAGACACACTGTGG - Intronic
1144759228 17:17698058-17698080 CCTGCAGTCCAGAGACTAGAGGG + Intronic
1144960805 17:19042931-19042953 GCTGGAGTCCAGTGACAAAGAGG - Intronic
1144974355 17:19131593-19131615 GCTGGAGTCCAGTGACAAAGAGG + Intronic
1147570673 17:41568570-41568592 GGTGCAGTCCAGTGCCAAGGAGG - Exonic
1150222968 17:63507674-63507696 GCTGCAGAACATAGACAAGGCGG + Intronic
1151000593 17:70370819-70370841 GTTTCAATCCAGAAAGAAGGAGG + Intergenic
1151238200 17:72736892-72736914 GTTGCAGGCCATAGAGAAGAAGG - Intronic
1151640678 17:75390644-75390666 GTTACTGTCCAGAGAAAAAGAGG - Intronic
1152076598 17:78163929-78163951 GCAGCAGCCCAGACACAAGGTGG + Intronic
1152800399 17:82328193-82328215 TTTGCAGGCCTGAGACAAGATGG - Intronic
1155328518 18:24690846-24690868 GTAGCAGCCCTGAGACAATGTGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155731977 18:29171969-29171991 GGAGAAGTGCAGAGACAAGGTGG + Intergenic
1156671837 18:39479947-39479969 GTTTCAATACAGAGACAAGGTGG - Intergenic
1156704512 18:39863267-39863289 GTTGCAATTCAGAGACAGGCAGG + Intergenic
1158442432 18:57488893-57488915 GTTGGAGTCCAGAGAGAGTGAGG - Exonic
1160474407 18:79169153-79169175 GTCCCATTCCAGAGACAGGGTGG - Intronic
1162316547 19:9942367-9942389 GTTGCAATTCAGAGATACGGAGG - Intergenic
1162337628 19:10071421-10071443 GGCGCAGCCCAGGGACAAGGAGG + Intergenic
1163811415 19:19434818-19434840 GATGCTGTCCAGAGAGAAAGAGG - Intronic
1165749481 19:38251438-38251460 GATGAAGTCCTGAGACAGGGTGG + Exonic
1166335093 19:42101056-42101078 GCTGCAGTGCAGAGACACAGTGG - Intronic
925564434 2:5235151-5235173 GTTGCATTGAAGAGAAAAGGAGG - Intergenic
926061138 2:9805933-9805955 GGGGGAGCCCAGAGACAAGGGGG - Intergenic
926616203 2:14999094-14999116 GTGGCAGACCAGAAAGAAGGGGG + Intergenic
928393001 2:30923598-30923620 GATGCTGCCCAGAGACAGGGTGG + Intronic
930153927 2:48086109-48086131 GTTGCAGGCAAGAGAGCAGGTGG + Intergenic
930739789 2:54819423-54819445 TTTCCAATCCAGAGACAAGAAGG - Intronic
931095497 2:58935667-58935689 TTTGCAGTCCACAGAGAAGCAGG - Intergenic
933895374 2:86806441-86806463 GCTGCAGGCCAAGGACAAGGAGG - Intronic
934754358 2:96815567-96815589 GTAGCTGTCCAGATTCAAGGCGG + Intergenic
936155253 2:110042825-110042847 GTTACACTGCAGTGACAAGGAGG - Intergenic
936189427 2:110328588-110328610 GTTACACTGCAGTGACAAGGAGG + Intergenic
936691262 2:114892052-114892074 TTTTCAGCCCAGAGACATGGTGG - Intronic
938064281 2:128272647-128272669 GTTGGGGGCCAGAGACAGGGAGG + Intronic
941175562 2:162193912-162193934 GTTGGAGGCCAGGGACAATGAGG - Intronic
942077609 2:172371111-172371133 GTTTCAGTCCCTAAACAAGGAGG + Intergenic
942272697 2:174292711-174292733 GCGGCACTCAAGAGACAAGGTGG - Intergenic
946925145 2:224619054-224619076 GTGACAGTTCAGAGACAAGCAGG + Intergenic
948502838 2:238407590-238407612 TTTGCTGTCGAGAGAGAAGGTGG + Intergenic
1169217612 20:3802544-3802566 GGTGGAGTCAGGAGACAAGGAGG - Intronic
1172173695 20:32959961-32959983 GTGGGAGTCCAGGGACAAGCAGG + Intronic
1172323841 20:34018999-34019021 GTTTGAGCCCAGGGACAAGGAGG + Intronic
1172593440 20:36133178-36133200 GTCCCAGGCCAGAAACAAGGCGG - Intronic
1174311445 20:49658569-49658591 TTTGCAGTGCAGAGGAAAGGAGG - Intronic
1174440481 20:50548121-50548143 GGAGCAGTTCAGAGGCAAGGGGG - Intronic
1179247941 21:39649595-39649617 GGTGCAGCCCAGAAACAGGGTGG + Intronic
1180177021 21:46095857-46095879 CTGGCAGCCAAGAGACAAGGTGG + Intergenic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
1184031375 22:41896851-41896873 GTGACAGCCCAGAGACACGGAGG + Intronic
1184853199 22:47132519-47132541 GTTGCAGGCCAGAGACAGCAGGG - Intronic
950741628 3:15056867-15056889 GTTGCACTCCAGTCACAGGGTGG - Intronic
950747227 3:15100036-15100058 GCTCCTGTCCAGAGACCAGGTGG - Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
954680363 3:52342713-52342735 AATGCTGTTCAGAGACAAGGAGG + Intronic
958436182 3:94098626-94098648 GTAGGAGTCCTGAGACAATGAGG - Intronic
959397769 3:105862814-105862836 GTTGGAGTCCAGTGAGATGGAGG - Intronic
960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG + Exonic
961048242 3:123724435-123724457 ATTGCATTCCAGCCACAAGGAGG + Intronic
962010351 3:131385303-131385325 GTTGCTGGCCAGAGCCAGGGAGG + Intronic
962756841 3:138471284-138471306 GTTGAGGTCAAGAGACATGGAGG - Intronic
962873731 3:139519755-139519777 GTTGGACTTCAGAGGCAAGGTGG + Intronic
963864074 3:150341534-150341556 TTTGCAATTCAGAGACAAAGAGG + Intergenic
964220507 3:154339343-154339365 GTTGTAGTCCAGAAAAAAAGGGG + Intronic
965816692 3:172643784-172643806 CTTGCAGGCCTGAGAAAAGGAGG - Intronic
966533848 3:181009227-181009249 GTTCCAGTCCACACCCAAGGGGG - Intergenic
967016684 3:185488682-185488704 GCTGCTGTCCAGTGACCAGGTGG + Exonic
967229548 3:187324439-187324461 GTGGAAGTCCAGAGACCAGTCGG + Intergenic
968958664 4:3731630-3731652 GGTGAAGTCCAGAGGCAAGCTGG + Intergenic
975469310 4:74747075-74747097 ATGGCAGTCCAGAGGTAAGGTGG - Intronic
976986227 4:91302314-91302336 GTTGCAGTGAAGAGAAAAAGAGG - Intronic
978603342 4:110451142-110451164 GTTGAAAGCCAAAGACAAGGAGG - Intronic
983797606 4:171884133-171884155 GTTTCAGTTGAGAGGCAAGGAGG - Intronic
987183164 5:15387113-15387135 GTTACAGTCCAGAAAGAATGAGG + Intergenic
987250509 5:16095809-16095831 CTTGCAGTCCAGGGACAATGGGG - Intronic
987970005 5:24930345-24930367 CTTGCCCTCCAGAGACAAGGTGG + Intergenic
988275183 5:29071764-29071786 GATGTATTCCAGAGACAATGAGG + Intergenic
990266067 5:54077160-54077182 GTTGCATTCCAGCCAAAAGGAGG - Intronic
990448058 5:55911190-55911212 GTGGCAGTCAAGAGAGAATGAGG + Intronic
992392005 5:76338098-76338120 TTTGCAGTCCAGACACCAGGTGG + Intronic
993700640 5:91114695-91114717 AATGGAGTTCAGAGACAAGGAGG - Intronic
995200404 5:109419005-109419027 GTGGCAGTCCAGAGTCAGGTTGG + Intergenic
995607486 5:113872623-113872645 GTGGCAGGCCAGAGTCAAGAAGG - Intergenic
996338491 5:122410896-122410918 GTTCCAGTCAAGAGAAAAAGGGG - Intronic
996787424 5:127255445-127255467 ATTTCAGTCCCCAGACAAGGAGG + Intergenic
997886912 5:137638456-137638478 GATAGAGTCCAGAGGCAAGGAGG + Intronic
999796919 5:154997387-154997409 GTAGCTGTTGAGAGACAAGGTGG - Intergenic
1002457999 5:179356594-179356616 CTGGCAGCACAGAGACAAGGGGG - Intergenic
1003453935 6:6263061-6263083 TTTGCAGTCCAGAGAGAGGACGG - Intronic
1004279167 6:14265886-14265908 TGTGCAGTACAGAAACAAGGGGG + Intergenic
1004604393 6:17180180-17180202 GTTTCAGTCCCTAAACAAGGAGG + Intergenic
1006285287 6:33088624-33088646 TTTGAAGTCTAGTGACAAGGTGG - Intergenic
1006499463 6:34448652-34448674 CTTTCAGGCCAGAGACAGGGAGG - Intergenic
1008969418 6:57349190-57349212 GTTGGAGTCCAGGAACAATGAGG - Intronic
1009132746 6:59492638-59492660 GCTGCATTCCACACACAAGGTGG + Intergenic
1009145354 6:59667521-59667543 GCTGCATTCCACACACAAGGTGG + Intergenic
1009147144 6:59692485-59692507 GCTGCATTCCACACACAAGGTGG + Intergenic
1009158391 6:60251021-60251043 GTTGCAGTCCAGGAACAATGAGG - Intergenic
1010447323 6:75962653-75962675 GTAGCTGTCCAGAGAGAAAGAGG + Intronic
1012324124 6:97893359-97893381 ATTCCAGTCAAGAGACATGGTGG - Intergenic
1012559797 6:100566565-100566587 GTTGAAGTACAGATATAAGGAGG - Intronic
1013327093 6:109057131-109057153 GTTGCAGTCAAGATACCAGCTGG - Intronic
1013556998 6:111266517-111266539 GTTGCTATCCAGAGACAAATTGG - Exonic
1016692812 6:146958189-146958211 GTGGCAGTCTAGAGGGAAGGTGG + Intergenic
1016749003 6:147612115-147612137 GTTGCTGTCCAGTGAATAGGTGG + Intronic
1017516427 6:155160242-155160264 GTTCAAGTCCAAAGCCAAGGGGG + Intronic
1017662113 6:156685029-156685051 GCTACAGTCCAGATTCAAGGCGG + Intergenic
1019189801 6:170245183-170245205 CTTGCAGTCGACAGACAAAGCGG - Intergenic
1020041810 7:5009301-5009323 GATGCAGTCCAGGCACAAAGAGG - Intronic
1021253396 7:18359379-18359401 GTGGCAGTGAAGGGACAAGGAGG + Intronic
1023033842 7:36113255-36113277 GTTTCAGGCGAGAGTCAAGGTGG + Intergenic
1023564079 7:41506198-41506220 GTTGCAGCCCAGAGAGAGGCAGG - Intergenic
1025215723 7:57054405-57054427 GTTTCAGTACTGAGACAAGGAGG - Intergenic
1025655657 7:63516297-63516319 GTTTCAGTACTGGGACAAGGAGG + Intergenic
1028047265 7:86138109-86138131 GTTGAAGAAAAGAGACAAGGTGG - Intergenic
1028104690 7:86863133-86863155 GTTTCAGTCCATAGAGAATGGGG + Intronic
1028415404 7:90574942-90574964 GTTTCAGAGCAGAGACAGGGAGG + Intronic
1029945637 7:104529824-104529846 GTGGAAGTCCAGAGTCAAAGAGG + Intronic
1030631293 7:111898814-111898836 TTTGCAGTACAGGGACAAGAAGG + Intronic
1031223417 7:119002633-119002655 ATTGCACTGCAGAGACAAGGCGG - Intergenic
1031265783 7:119578314-119578336 GTGCCTGTCCAGATACAAGGAGG - Intergenic
1037654660 8:20872589-20872611 GTAGCAGTTGAGAGTCAAGGGGG + Intergenic
1038428788 8:27483331-27483353 GTTGAAGTCTAGAGGCAGGGAGG + Intergenic
1038682982 8:29687317-29687339 GTTGCAGGACAGATAGAAGGGGG + Intergenic
1039280798 8:35981550-35981572 GGTGCAGTGCAGTGAAAAGGTGG + Intergenic
1040580322 8:48693631-48693653 GCTGCAGAGCAGTGACAAGGTGG - Intergenic
1043852971 8:85235202-85235224 GTTTCAGTCCAGAGCCCAGCAGG - Intronic
1044442977 8:92242916-92242938 GTTACACTCCAGATACAATGGGG + Intergenic
1047515096 8:125547056-125547078 GTGGCAGTCCAGAGTGGAGGAGG + Intergenic
1048908963 8:139115991-139116013 GATGGAGTTCAGACACAAGGTGG + Intergenic
1052555019 9:30002131-30002153 GATGCAGCACACAGACAAGGTGG + Intergenic
1053350879 9:37412526-37412548 GGTGGAGTCAAGAGCCAAGGTGG - Intergenic
1055191342 9:73528312-73528334 GCAGCAGTCCTGAGACAATGAGG - Intergenic
1056540875 9:87570143-87570165 GTTGCAGTCCAGGAAAAAGAAGG + Intronic
1056887257 9:90455385-90455407 GGTGCTTGCCAGAGACAAGGGGG + Intergenic
1057167857 9:92942460-92942482 GATGCAGTCCAGAGGGCAGGAGG + Intergenic
1058272130 9:102985878-102985900 GTTGGCTTCCAGAGAGAAGGTGG - Intergenic
1059420408 9:114187007-114187029 GGACCAGACCAGAGACAAGGTGG - Intronic
1060069563 9:120534277-120534299 GTGGAAGTCCAGAGGCAAGAAGG - Intronic
1060584768 9:124779071-124779093 CATGTACTCCAGAGACAAGGAGG + Intronic
1062174284 9:135152360-135152382 GTTGGAGTCTAGGGAGAAGGCGG + Intergenic
1187531622 X:20102462-20102484 GTTACAGGCCAGAGAGATGGGGG + Intronic
1189262353 X:39687809-39687831 GTTGCAGTGCAGAGACAGTCAGG - Intergenic
1199896635 X:152133161-152133183 GCTGCAGTCAAGTAACAAGGTGG - Intergenic