ID: 960010660

View in Genome Browser
Species Human (GRCh38)
Location 3:112831421-112831443
Sequence GTGAAGAATACAATGACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 2, 1: 0, 2: 6, 3: 19, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960010660 Original CRISPR GTGAAGAATACAATGACTAT TGG Intronic
901744224 1:11361959-11361981 GTGAAGAAGTGGATGACTATGGG + Intergenic
904439294 1:30519670-30519692 ATGAAGAAGATAATGATTATGGG + Intergenic
904539581 1:31223834-31223856 ATGAAGACTACAAGGACAATAGG - Intronic
906079682 1:43076851-43076873 ATAAGGAATACAAAGACTATAGG - Intergenic
906215817 1:44037919-44037941 GAGAAGAATACAAAGATTACTGG - Intergenic
909390806 1:75119319-75119341 GTGAAGAATAGAATGAATGCTGG + Intergenic
910359417 1:86400130-86400152 ATGAAGAATACAAAGATTGTGGG - Intergenic
911684594 1:100760471-100760493 GTGAGGAATAAAATGACTAGAGG - Intergenic
915432280 1:155876143-155876165 TTGAAGAATACAAGGAATAAGGG + Intronic
916089622 1:161297609-161297631 GGGATGAATACAATCACTGTTGG + Intergenic
916999558 1:170341649-170341671 TTGAATAACACAATAACTATAGG - Intergenic
918840148 1:189525461-189525483 TTCAAGAATACAGTAACTATTGG + Intergenic
921402773 1:214744504-214744526 CTGAAAGATACAATGACTTTGGG - Intergenic
923861198 1:237893802-237893824 ATGAATACTACCATGACTATGGG - Intergenic
1062782775 10:231256-231278 GTAAAGAATATACTGAGTATTGG + Intronic
1063309103 10:4936249-4936271 GGGAAGAATCTAAGGACTATGGG + Intronic
1065274156 10:24068289-24068311 CTGAAGAATACAATAACTGAGGG - Intronic
1065949465 10:30638866-30638888 CTGTTGAATAAAATGACTATGGG - Intergenic
1066591266 10:36996936-36996958 CTGAAAAATACAAGGACTGTTGG + Intergenic
1071102901 10:82060058-82060080 GTGAAGGATACAATTAAGATTGG + Intronic
1072948282 10:99830322-99830344 AAGAAGAAGACGATGACTATGGG + Exonic
1073846676 10:107564026-107564048 CTGGAGAATAAAATGACTACAGG + Intergenic
1080124427 11:28715646-28715668 GTGAAGAATATAATGACTACTGG + Intergenic
1080162859 11:29199201-29199223 GTAAAGCATAGAACGACTATGGG - Intergenic
1084442975 11:69186446-69186468 GTGGAGAATACAATGGCACTAGG - Intergenic
1086152901 11:83632364-83632386 GTGGAGAATACAATAAGAATGGG + Intronic
1090269587 11:125376652-125376674 GTGGAGTAAGCAATGACTATTGG - Intronic
1091503029 12:1038174-1038196 GTGAAGAGTTCAATGACTTAGGG - Intronic
1093783646 12:23167288-23167310 GTGAAGAAGACAAAAGCTATGGG - Intergenic
1097790178 12:63807196-63807218 GTGAAGAATAAAATGAAGAAAGG - Intronic
1099381055 12:81953168-81953190 GTTAAGGATAAAATGATTATTGG - Intergenic
1099659967 12:85545017-85545039 GAAATGAATACAATGACCATAGG + Intergenic
1099944871 12:89233275-89233297 GTGAAAAGTACAGTGACTAGAGG + Intergenic
1100493501 12:95103312-95103334 GTGGAGCATGCTATGACTATTGG + Intronic
1100943133 12:99747027-99747049 GTGAAGAATATAGGGAATATGGG - Intronic
1101197126 12:102395034-102395056 GTACAGAACACCATGACTATAGG + Intergenic
1101700177 12:107166523-107166545 ATGAATAATACATTGAATATGGG - Intergenic
1102429731 12:112873789-112873811 TTGAAGAACTCAATGACTGTTGG + Intronic
1102750878 12:115292898-115292920 ATGAATAATACAATGAACATAGG + Intergenic
1103430561 12:120881604-120881626 ATGAGTAATACAATGAATATTGG - Intronic
1105612529 13:21981615-21981637 GTGAAAGATGCAATGATTATAGG - Intergenic
1106211734 13:27654806-27654828 GTAAAGAGTACAATGACCACTGG + Intronic
1106442076 13:29784388-29784410 CTTAAGAATAAAATGAGTATTGG + Intronic
1106824568 13:33506043-33506065 CTGAAGAGTACAGTGACTATGGG - Intergenic
1107924471 13:45245478-45245500 GAGAATGATACAATGACTTTTGG - Intronic
1108895651 13:55324486-55324508 GTGAAAAATATACAGACTATTGG + Intergenic
1108988595 13:56626993-56627015 TTGAAGAATACAATAACAAATGG + Intergenic
1109405844 13:61898894-61898916 TTGAAGAATGCAATGACTAGTGG - Intergenic
1109927031 13:69157332-69157354 GTGAATAATGCTATGAATATTGG - Intergenic
1111476034 13:88749006-88749028 GTGAAGACTACAATTTCTAATGG - Intergenic
1112505528 13:99972353-99972375 GTGAAGAAGATAAAGTCTATTGG + Intergenic
1113673146 13:112188554-112188576 GTGTAGAATACCATGACAGTGGG + Intergenic
1113880237 13:113621279-113621301 GTGAAGAAAACACAGACTTTCGG - Intronic
1114355853 14:21907316-21907338 GTGATGAAGTCAATGACTTTTGG + Intergenic
1116156034 14:41207210-41207232 GTGAAGAATTCATTGAATTTTGG + Intergenic
1117869206 14:60181672-60181694 ATGAATAATACTATGAATATTGG + Intergenic
1123125918 14:105945913-105945935 GTGAAGAAAACAATGCCAAGGGG - Intergenic
1124682995 15:31753096-31753118 GTGAGGAATACAATGACTAATGG + Intronic
1124686124 15:31783475-31783497 GTGAAGAATATGAAGACTACTGG - Intronic
1126028736 15:44474850-44474872 GAAAAGAATACAATGACTGTTGG + Intronic
1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG + Intronic
1128819650 15:70640245-70640267 CTGAAGAATTCAAGGACTGTGGG + Intergenic
1133702149 16:8318716-8318738 GGGAAGAAAAAAATAACTATGGG - Intergenic
1135198330 16:20413604-20413626 CTGGAGAATCCAATGTCTATGGG + Intronic
1135219903 16:20604954-20604976 CTGGAGAATCCAATGTCTATGGG - Intergenic
1135719082 16:24799483-24799505 GTGATGAATACAATGACCCTTGG - Intronic
1141303145 16:82836798-82836820 ATGCAGATTAGAATGACTATGGG - Intronic
1144301050 17:13923272-13923294 GGGAAGAATACAAGGATTAATGG + Intergenic
1144434906 17:15231614-15231636 GTGAAGCAAGCAATGCCTATGGG + Intronic
1144673861 17:17148467-17148489 GTGAAGAATCCAGTGACCACTGG - Intronic
1146388472 17:32399049-32399071 ATGAAGAATACAGTGACTACTGG + Intergenic
1149915521 17:60605163-60605185 GTGAAGAATGCAGTGACTAATGG + Intronic
1155820755 18:30372331-30372353 GTTAAACATACAAGGACTATTGG - Intergenic
1158950378 18:62488820-62488842 GTGAAGAATACCATGACTAATGG - Intergenic
1158990384 18:62862899-62862921 GAGAAGAATATAATGACAACTGG + Intronic
1161359231 19:3837446-3837468 TTGATGAACACCATGACTATGGG + Intronic
1161359247 19:3837620-3837642 TTGATGAACACCATGACTATGGG + Intronic
1161359258 19:3837747-3837769 TTGATGAACACCATGACTATGGG + Intronic
1162044847 19:7991805-7991827 TTGAAAAATACAATGTCTAATGG - Exonic
1165269678 19:34695269-34695291 TGGCAGAATAGAATGACTATAGG + Intergenic
925394607 2:3524136-3524158 GTGAAAAACACAATGACTGCTGG + Intergenic
925767716 2:7252944-7252966 GTGAAGAGCACAAGTACTATTGG + Intergenic
927262416 2:21105564-21105586 GTGTATAATTCAATGACTTTTGG + Intergenic
928015556 2:27653662-27653684 GTGAAGAAGGCAATGTCTCTGGG - Exonic
929182620 2:39059742-39059764 GTGGAGAACACAATGATTCTTGG + Intronic
929836659 2:45407641-45407663 GTAAAGAACACAAAGAATATGGG + Intronic
930794471 2:55373561-55373583 GTGAAGGATACACAGATTATGGG - Intronic
931585870 2:63827242-63827264 GAGAAGAATACAATGACACAGGG - Intronic
932346062 2:70995802-70995824 GTGAATAATGCTATGAATATTGG - Intergenic
933314261 2:80697264-80697286 GTGAAGAATATAATGACAATAGG + Intergenic
933405116 2:81848139-81848161 CTGAAGAATACAATGGAAATTGG + Intergenic
933916434 2:86998873-86998895 GTGAATAATTCAATGTTTATTGG + Intronic
934006559 2:87771053-87771075 GTGAATAATTCAATGTTTATTGG - Intronic
935770208 2:106411963-106411985 GTGAATAATTCAATGTTTATTGG - Intronic
935968002 2:108500846-108500868 GTGAATAATTCAATGTTTATTGG + Intronic
936131665 2:109849091-109849113 GTGAATAATTCAATGTTTATTGG + Intronic
936213032 2:110522394-110522416 GTGAATAATTCAATGTTTATTGG - Intronic
936422171 2:112376950-112376972 GTGAATAATTCAATGTTTATTGG - Intronic
938649567 2:133368494-133368516 GTGAAAAATACAATTATTAGCGG + Intronic
939200251 2:139024744-139024766 GTGATGGATATAATGACTGTTGG + Intergenic
939352360 2:141056125-141056147 ATGAAGAATACAAAGATAATAGG - Intronic
940130840 2:150379759-150379781 GTGCGGTATACAATGACTACTGG - Intergenic
940181554 2:150939739-150939761 TTGAACAAAACAATTACTATAGG - Intergenic
940649619 2:156428429-156428451 GTGAAGAACACAATAAAAATTGG + Intergenic
943297392 2:186155305-186155327 GTGAAGAATTCAGTGACTACTGG - Intergenic
943993336 2:194726787-194726809 ATCAATAATACAATGACAATTGG - Intergenic
945401904 2:209392730-209392752 GTCATGCATAAAATGACTATAGG - Intergenic
945409930 2:209496108-209496130 ATGAATAATACAATGTCTAGAGG + Intronic
945422453 2:209656147-209656169 ATCAAGGATACACTGACTATGGG - Intronic
946873290 2:224104527-224104549 GGGAATAATACAATGAGTAGTGG - Intergenic
946998914 2:225430144-225430166 ATGTAGAATACAATGATTAAAGG + Intronic
947126818 2:226877849-226877871 GTGAAGAGTGCAGTGACTATTGG + Intronic
947764229 2:232625832-232625854 GTGAAGAGTACAATAACTCCTGG - Intronic
947776252 2:232712489-232712511 GTGAAGAATATAGTGACTGCTGG + Intronic
1168735063 20:127663-127685 GTAAAGAATCCAAGGACTGTGGG + Intergenic
1169424858 20:5487952-5487974 GTGATGTATACAATAACTGTTGG - Intergenic
1169425577 20:5494571-5494593 GTGATGTATACAATAACTGTTGG + Intergenic
1170380971 20:15759178-15759200 TGGAAGGATAGAATGACTATGGG - Intronic
1182672625 22:32009928-32009950 ATGAAGTATAAAATGACCATAGG + Intergenic
1184358915 22:44002029-44002051 GCGAAGAATACAATGGCCATAGG + Intronic
949690398 3:6630353-6630375 GTGAAGATTAAAATTACTTTTGG - Intergenic
949995966 3:9617659-9617681 GAGAATAGTAAAATGACTATTGG - Intergenic
950356263 3:12412325-12412347 ATGTAGAATACAAAGACAATGGG - Intronic
951090519 3:18568119-18568141 GTGAAGAATCAAATCACAATGGG - Intergenic
951390090 3:22091941-22091963 GTAATGGATACAATGACTGTTGG + Intronic
954049444 3:47961370-47961392 GCAATGGATACAATGACTATGGG + Intronic
955994676 3:64667706-64667728 GTGATAACAACAATGACTATAGG + Intronic
956063677 3:65374639-65374661 ATGAATAATACAATGAGTATTGG + Intronic
956147586 3:66206771-66206793 GTGGAGGTTACAATGACTACTGG - Intronic
957357463 3:79111076-79111098 GTAAAGAATACAAGGTCTGTTGG + Intronic
958594602 3:96205361-96205383 GTCAAAAATAAGATGACTATAGG - Intergenic
958682260 3:97346170-97346192 GGGAAGAACACAAGGACTTTAGG - Intronic
958918947 3:100081206-100081228 GTGAAGATTAGAAGGACTCTTGG - Intronic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
962020375 3:131493799-131493821 TTGAAAATTACAATTACTATTGG - Intronic
962150784 3:132891291-132891313 AATAAGAATACAATGACTAATGG + Intergenic
962723753 3:138201409-138201431 GGGAAGAAGACAAGGACTCTAGG - Intronic
963547659 3:146681414-146681436 GTCAAGAGTACACTCACTATAGG - Intergenic
964249458 3:154694791-154694813 GTGAACAATACAATGGCTATCGG + Intergenic
965195949 3:165594640-165594662 GTGAAGAATTCAATGATTACTGG + Intergenic
968257535 3:197290421-197290443 GGGTAAAAAACAATGACTATAGG + Intronic
969507757 4:7598731-7598753 TTGAAGAATATTATGTCTATTGG - Intronic
972953037 4:44353007-44353029 GTGTACAATACAATGAGTTTTGG + Intronic
973606629 4:52593560-52593582 GTGAAGCCTACAGTAACTATGGG - Exonic
976389490 4:84494251-84494273 GTGAAGACTAGAATTACCATTGG + Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977179141 4:93852771-93852793 GTGAACAAAACAATGACCTTTGG + Intergenic
978530593 4:109708367-109708389 GTGAAGAGCTCAATGAATATTGG + Intergenic
979094134 4:116522621-116522643 GTGAAAAACACAGTGACTACTGG - Intergenic
979898255 4:126187911-126187933 GTGTGGAATACCATGACGATGGG + Intergenic
979937494 4:126716148-126716170 GTGAAAAATGCACTGACTATAGG - Intergenic
982096574 4:151928815-151928837 GTAAACAAGACAATGACCATGGG - Intergenic
982655201 4:158140057-158140079 GTGAAGAGTACAATGACCACCGG + Intronic
982865066 4:160500050-160500072 GTCAAGAATTCATTGACTTTGGG + Intergenic
983053282 4:163073544-163073566 TTGAAGAACTCAAGGACTATGGG - Intergenic
983466513 4:168099667-168099689 GTGAATACTAGAATGACTGTGGG + Intronic
985948635 5:3205629-3205651 GTGATGAAAACATTGACTAAAGG - Intergenic
986482966 5:8207347-8207369 GTGAATAATGCAATGAGCATGGG + Intergenic
987043156 5:14082215-14082237 GTAAAGAATACAATGACACCTGG + Intergenic
991244168 5:64491185-64491207 TTGAAGAATATGATGACTGTAGG - Intergenic
992364444 5:76077720-76077742 GTCAAGACTACAATGAGTTTTGG + Intergenic
996211393 5:120815526-120815548 GACAGGAATACAATGACAATGGG - Intergenic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
1004103123 6:12635647-12635669 GTGAAGAACATGCTGACTATTGG - Intergenic
1006533075 6:34673995-34674017 GTGAAACAAACAATTACTATGGG + Intronic
1006660325 6:35636675-35636697 GTGGAAAATACCATGACTACTGG + Intronic
1008007204 6:46423346-46423368 GTGTAAAATACAAACACTATAGG - Intronic
1009265461 6:61549085-61549107 GTGAATAATGCAATGACCTTAGG + Intergenic
1009899477 6:69794258-69794280 GTGAAGAATACAATGATTACTGG - Intronic
1010557251 6:77298367-77298389 GTAAAGAAAACAATGATTACAGG + Intergenic
1012198146 6:96370571-96370593 GAGAATAATGCAATGACTAGGGG + Intergenic
1013899253 6:115133250-115133272 AAGAAGAATACAATGATTACTGG + Intergenic
1014004594 6:116403707-116403729 TTGAAGTTTACAGTGACTATGGG + Intronic
1014004967 6:116407634-116407656 GGGAAGAGAAAAATGACTATGGG - Intronic
1015294885 6:131579179-131579201 GTGAAGAATCCAAGGTCTGTGGG + Exonic
1016889497 6:148992031-148992053 GTGAAGAATACCATGACCTGTGG + Intronic
1020749260 7:12119869-12119891 GTGAAAAATACCATGACTTTAGG + Intergenic
1022811163 7:33870271-33870293 GTGATGAATGCACTGACTACAGG - Intergenic
1022816005 7:33914847-33914869 TTGAAGAAGACAAAGACTAGTGG + Intronic
1024638778 7:51312584-51312606 ATTAAGAAAACAATGATTATAGG - Intronic
1026601770 7:71783394-71783416 GTAAAAAATGTAATGACTATGGG + Exonic
1030516663 7:110547142-110547164 GTGAAAAATGTAATTACTATTGG - Intergenic
1031707843 7:125004333-125004355 GTGAAAAATGTACTGACTATAGG - Intergenic
1032949764 7:136894023-136894045 GTGAATAATACTAGGACTCTAGG - Intronic
1032950548 7:136905342-136905364 ATGAATAATATAATGAATATGGG - Intronic
1033400225 7:141015548-141015570 GTGCTGCATACAATGCCTATGGG - Intergenic
1034296828 7:149981128-149981150 GTGAAGAATCCAAACCCTATAGG + Intergenic
1034809197 7:154115702-154115724 GTGAAGAATCCAAACCCTATAGG - Intronic
1036530283 8:9578948-9578970 GAGAAGAAAACAATGGCCATTGG - Intronic
1037302647 8:17469144-17469166 GTGTACAAAACAATGACAATTGG - Intergenic
1037456247 8:19067406-19067428 CTGGAGAATGCAATGACTCTTGG - Intronic
1038650507 8:29398745-29398767 CTGAAAAATATAAAGACTATAGG - Intergenic
1039732231 8:40292693-40292715 GGGAAGAACACAATGACAAAAGG + Intergenic
1039735799 8:40331222-40331244 GTGAGAAATGCAATGACTATTGG - Intergenic
1040013479 8:42681575-42681597 ATTAAGAATAGAATTACTATGGG + Intergenic
1041363780 8:57080128-57080150 GAGAAGAAAAAAATAACTATTGG + Intergenic
1042492864 8:69421069-69421091 ATGAAAAATAAAATGAATATTGG + Intergenic
1042789686 8:72590136-72590158 TTGAAGAGTAAAATGACTCTGGG - Intronic
1043354691 8:79399038-79399060 GTTAACAATACAATTACTAAGGG + Intergenic
1043849263 8:85197540-85197562 GTGAACAAAGCAATGTCTATAGG - Intronic
1046735642 8:117773798-117773820 GTGAATAATTGAATGACTAGTGG + Intergenic
1048462832 8:134636890-134636912 TTGAAGAAAATAAAGACTATCGG - Intronic
1048518918 8:135136137-135136159 GGGAAGAAAACAATGACTTTTGG + Intergenic
1050996765 9:12230809-12230831 GTGATGATAACAATGAATATAGG - Intergenic
1052194165 9:25692154-25692176 GGGAAGAATCCAATGAATACAGG - Intergenic
1052433808 9:28400541-28400563 GTTAAGAATAACATGACTAAGGG + Intronic
1055854922 9:80674323-80674345 GTGAAGAGTAAAATCACTTTAGG + Intergenic
1056989407 9:91396651-91396673 CTGCAAAATACAATGACTTTGGG + Intergenic
1057811339 9:98259156-98259178 TTGTAGAATACAATCACTTTGGG + Intergenic
1057822915 9:98347020-98347042 GTGAATAATGCAATAAATATAGG + Intronic
1060574750 9:124680940-124680962 GTGACAAATACAGTGACTACTGG - Intronic
1060717543 9:125946665-125946687 TTGAAGAATACAGAGACAATAGG + Intronic
1060910973 9:127350119-127350141 GTTATAGATACAATGACTATGGG - Intronic
1186381025 X:9059182-9059204 GTGAATAATGCAATAAATATGGG - Intronic
1188395241 X:29674682-29674704 GAGAAGAAAAAAATAACTATTGG - Intronic
1189124200 X:38428618-38428640 GTGAAGAACACAATGATTTTTGG + Intronic
1193652270 X:84151802-84151824 ATGAAGACTACAATGACTACTGG + Intronic
1193987792 X:88267578-88267600 GTTAAGAAGACAATGAATTTTGG - Intergenic
1194464898 X:94221532-94221554 GTAAAGAAAACAATAACTAATGG + Intergenic
1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG + Intergenic
1195722225 X:107878071-107878093 GGGAAGAATACAGTGATTAAAGG - Intronic
1196519945 X:116661319-116661341 GGGAAGAATACAAGGATTAAAGG + Intergenic
1197546349 X:127829605-127829627 GTGAAGAATAAAATGTAAATGGG - Intergenic
1198243110 X:134803525-134803547 GTGAGGAATAAAATGATAATTGG - Intronic
1200269894 X:154672772-154672794 ATGAAGAATACAATCACTTGTGG - Intergenic