ID: 960016840

View in Genome Browser
Species Human (GRCh38)
Location 3:112900543-112900565
Sequence AACTCACCAGTCTCTTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960016840_960016841 12 Left 960016840 3:112900543-112900565 CCAAGGCAAGAGACTGGTGAGTT No data
Right 960016841 3:112900578-112900600 CTCTAAACATTCCCAGAGAACGG No data
960016840_960016842 13 Left 960016840 3:112900543-112900565 CCAAGGCAAGAGACTGGTGAGTT No data
Right 960016842 3:112900579-112900601 TCTAAACATTCCCAGAGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960016840 Original CRISPR AACTCACCAGTCTCTTGCCT TGG (reversed) Intergenic
No off target data available for this crispr