ID: 960022328

View in Genome Browser
Species Human (GRCh38)
Location 3:112968956-112968978
Sequence GCTTAGGAGAAAATACATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960022323_960022328 25 Left 960022323 3:112968908-112968930 CCAAATAAAACTATTTAATTTAC 0: 1
1: 0
2: 4
3: 82
4: 901
Right 960022328 3:112968956-112968978 GCTTAGGAGAAAATACATTAAGG 0: 1
1: 0
2: 2
3: 15
4: 204
960022325_960022328 -4 Left 960022325 3:112968937-112968959 CCAAGAAAATGTGGCCTATGCTT 0: 1
1: 0
2: 2
3: 22
4: 199
Right 960022328 3:112968956-112968978 GCTTAGGAGAAAATACATTAAGG 0: 1
1: 0
2: 2
3: 15
4: 204
960022322_960022328 26 Left 960022322 3:112968907-112968929 CCCAAATAAAACTATTTAATTTA 0: 1
1: 0
2: 17
3: 172
4: 1465
Right 960022328 3:112968956-112968978 GCTTAGGAGAAAATACATTAAGG 0: 1
1: 0
2: 2
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960022328 Original CRISPR GCTTAGGAGAAAATACATTA AGG Intronic
910574269 1:88741502-88741524 GAGTAAGAGAGAATACATTAGGG - Intronic
916995162 1:170288851-170288873 GCTTATTAGAAAATAATTTAAGG + Intergenic
917499214 1:175570830-175570852 GTGTGGGAGAAAAAACATTATGG - Intronic
920537282 1:206746417-206746439 TCTTAGGAGTAAGTACATTCCGG - Intergenic
1062962562 10:1584204-1584226 GATTAGGAGAAAATATATAAAGG + Intronic
1064817416 10:19282024-19282046 GCTAAGGGTACAATACATTATGG + Intronic
1065624611 10:27617505-27617527 GCTAAGAAGAAAACACATTCTGG + Intergenic
1070394647 10:76001489-76001511 GTTTAAGAGTAAATTCATTATGG + Intronic
1071590431 10:86867632-86867654 GCTTTGGAGAAACTAGGTTAGGG + Intronic
1071796430 10:89011490-89011512 GTTTAGCTGAAAATACATTTGGG + Intronic
1072910552 10:99497194-99497216 TCTTTGGAGAAAACACATTTTGG + Intergenic
1074523383 10:114244523-114244545 GATTAGGAGAGAAGACATGAAGG + Intronic
1079739690 11:24041741-24041763 GCTATGGAGGAAATACAATATGG - Intergenic
1080329024 11:31114172-31114194 GCTAAGGAGAAATTGAATTAGGG - Intronic
1082558448 11:54590852-54590874 GGTAAGGAAAAAATACATTTAGG - Intergenic
1082662935 11:55936203-55936225 GCTAAGGAAAAAATACATGGGGG + Exonic
1087541292 11:99523962-99523984 GCTCTGGAGAAAAGAGATTATGG - Intronic
1088274456 11:108069904-108069926 CCTTAGGGGAAAATACACTTTGG + Intronic
1088691465 11:112332076-112332098 GCTAAGAAGAAAACACATTTGGG + Intergenic
1089918530 11:122184178-122184200 GATTAGGAGAAATTACAATATGG - Intergenic
1090412294 11:126517625-126517647 GCTTAGAAGAAAACTGATTAGGG - Intronic
1090881516 11:130836191-130836213 GCTTTTTACAAAATACATTATGG + Intergenic
1092373439 12:7935922-7935944 ACTTAGGAGAAAATAGAACAAGG + Intronic
1092466221 12:8734948-8734970 GCTAAGCAAATAATACATTAAGG + Intronic
1093606143 12:21090662-21090684 GTTTGGAAGAAAATACATCAAGG - Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094303108 12:28988317-28988339 GATTAGGACAACATCCATTAGGG - Intergenic
1095645147 12:44535140-44535162 GTTTATATGAAAATACATTATGG - Intronic
1098095991 12:66956613-66956635 GTTTAGGAGAAGATACATTGAGG + Intergenic
1099020471 12:77397385-77397407 CCTTAGCAAAAAATGCATTATGG + Intergenic
1099380759 12:81949479-81949501 GCTCAGGAGAAAGAACATAAAGG + Intergenic
1100710399 12:97250140-97250162 GCTTGGGGGAAGATTCATTAAGG + Intergenic
1103758102 12:123226063-123226085 GCTTATGAGTAGATACATTAAGG + Intronic
1106656488 13:31752375-31752397 GGTTGGGAGAAATTCCATTAGGG + Intronic
1106830647 13:33578373-33578395 GCATAAGAGCAAATAAATTAGGG + Intergenic
1106965205 13:35056502-35056524 GCTATGGAGAAAATAAATTGGGG + Intronic
1107723221 13:43271351-43271373 GCTCAGCAAAAAATACATTCAGG + Intronic
1109175951 13:59155916-59155938 CCTTACTAAAAAATACATTAAGG - Intergenic
1110191087 13:72729180-72729202 GGTAAGGAGGAAATACATTATGG + Intronic
1110587200 13:77207659-77207681 ATTTGGGAGAAAATATATTATGG + Intronic
1111393284 13:87627196-87627218 GGTTACAAGAAAATAAATTATGG - Intergenic
1113291051 13:108906623-108906645 GCTTAGGAGACAAGACAGTTGGG + Intronic
1114144380 14:19956769-19956791 GCTAAGAAGAAAGTACATTGGGG - Intergenic
1114164736 14:20209442-20209464 CCCTAGGAGAATATACATTGGGG - Intergenic
1116019845 14:39447091-39447113 GCAAAGGAGAAAAAAAATTAAGG + Intergenic
1117584754 14:57189612-57189634 GCTAATGAGAAAATACAAAATGG - Intergenic
1119092758 14:71800199-71800221 GCATATCAGAAAATGCATTAGGG + Intergenic
1123538080 15:21259639-21259661 GCTATGGAGAAAATAAATTGGGG - Intergenic
1124947188 15:34279750-34279772 TCTTAGGACAAAATACAATCAGG + Intronic
1126857100 15:52849142-52849164 GCTGAGCAGAAAATACTTCAGGG - Intergenic
1127611386 15:60640826-60640848 GCTATGAAGAAAATAAATTAGGG - Intronic
1128777657 15:70335851-70335873 GCATAGGAGAAGATGCATCATGG - Intergenic
1131252591 15:90840029-90840051 GCTAAGGAGACAATACAGTGTGG - Intergenic
1131385503 15:92003367-92003389 GCTTCAGAGAAGATACACTATGG + Intronic
1131807846 15:96141598-96141620 GCTTAGGAGAAAAATCATGGTGG + Intergenic
1133084519 16:3351514-3351536 GCTTAGGAGGAAATAGTTAAAGG - Intergenic
1133671163 16:8022280-8022302 TTTTAGCAGAAAATACATCAAGG - Intergenic
1141347159 16:83257184-83257206 GAGTAGGAGAAAAGACAGTAGGG + Intronic
1146417263 17:32647156-32647178 GATAAGGAGAAAACACATCATGG + Intronic
1148751434 17:49947745-49947767 CATTAGGAGAAAATAAATGAAGG + Intergenic
1149104928 17:52951541-52951563 GCCTAGGAGAAAATAATTAATGG - Intergenic
1149122550 17:53187168-53187190 ACTTAGTAGAAAATGCATTTGGG + Intergenic
1150641688 17:66953778-66953800 GCTTTGGGGAAAATACCTTCTGG - Intergenic
1153501921 18:5758345-5758367 GTTTGGGATAAAATACAATATGG + Intergenic
1153709853 18:7787133-7787155 AGTGTGGAGAAAATACATTATGG - Intronic
1154166722 18:12020763-12020785 ACTTAGGAAAAATTACATAAAGG - Intronic
1155841689 18:30652778-30652800 TCATTGGTGAAAATACATTACGG - Intergenic
1156392245 18:36661281-36661303 GCATAGGTGAAATTAGATTATGG - Intronic
1157788825 18:50511605-50511627 GCTTAGGAAGAAATACGTAAGGG + Intergenic
1158372616 18:56826592-56826614 CGTGAGGAGAAAATACATTCAGG - Intronic
1158470446 18:57731392-57731414 TCTGCAGAGAAAATACATTAAGG - Intronic
1159079937 18:63725601-63725623 CCTTAAGAGAAGATAGATTAAGG - Intronic
1159178489 18:64870049-64870071 CCTCAAGTGAAAATACATTATGG - Intergenic
1164238268 19:23357531-23357553 TCTTAGGTGTAAATAAATTATGG - Intronic
1164319474 19:24129952-24129974 CCTTAGGTGTAAATAAATTATGG + Intronic
1165174889 19:33921563-33921585 TATTAGGAAAAAATACATGAGGG - Intergenic
927220706 2:20706211-20706233 GCTTAGGAGAAAAAAAAGTTTGG + Intronic
927752912 2:25686003-25686025 GCTTTTGAGAAAATACATCTGGG + Intergenic
928934734 2:36663800-36663822 GCTGTGCAGCAAATACATTAAGG - Intergenic
930131093 2:47851733-47851755 TATTATGTGAAAATACATTAGGG - Intronic
930662610 2:54069968-54069990 TCTTAAGAAAAAATACATTTGGG + Intronic
931200971 2:60097001-60097023 GCTGAGGACAAAATGCATTCAGG - Intergenic
931381596 2:61758625-61758647 GTTTAAGGAAAAATACATTAAGG + Intergenic
931997937 2:67856863-67856885 ACTTGGGAGAAAATACTCTATGG - Intergenic
932309906 2:70731410-70731432 GATTAGGAGAAAGTTCATTGGGG + Intronic
937871150 2:126787306-126787328 GCATAGGAGAAAATACAATACGG + Intergenic
938487977 2:131734323-131734345 GCTATGGAGAAAATAAATTGGGG + Intronic
938674053 2:133613097-133613119 GGTAAGGAGGAAATACATTAAGG - Intergenic
940446155 2:153780297-153780319 GCTTAGGAGGAATTATATTAAGG - Intergenic
940483852 2:154273152-154273174 GCCTAGAAGAAAATAAAATAAGG + Intronic
940616607 2:156056386-156056408 GCTTGGGAGAAATTATTTTATGG + Intergenic
942257234 2:174115455-174115477 GCAAACTAGAAAATACATTATGG + Intronic
943181054 2:184541915-184541937 GCTAAGGAGTAAGTACACTATGG - Intergenic
943389181 2:187241609-187241631 GCTTAAGAGAAAATAAAAAAGGG - Intergenic
943824324 2:192369926-192369948 ACATCGGAGAAAATTCATTAAGG + Intergenic
944775246 2:202957227-202957249 CCTTAGAAAAATATACATTAGGG - Intronic
945932788 2:215872532-215872554 GTTTAGGATAAAATAGAATAAGG + Intergenic
946323406 2:218967934-218967956 GCTATGAAGAAAATAAATTAGGG - Intergenic
948906752 2:240983316-240983338 GTTTAGGAGAAAATAAGTTGAGG + Intronic
1174812723 20:53660841-53660863 TCCTAGGAGAGAAGACATTAGGG - Intergenic
1178682475 21:34684570-34684592 GCTTAGGTGAAAAGAACTTATGG - Intronic
1179077584 21:38137501-38137523 GCTTAGCAGAAAATACAGCTGGG - Intronic
1181904206 22:26180581-26180603 ACTTAGGAAAAAATAATTTAGGG + Intronic
1183404886 22:37625579-37625601 GCTAAGAAGGAAATACATTCCGG + Intronic
1184936831 22:47730816-47730838 GCTAAGGAAAAAATAAAGTAAGG + Intergenic
950849518 3:16049674-16049696 TCTTAAGAAAAAATAGATTATGG - Intergenic
951300839 3:20994614-20994636 TTTTAGGAGAAAAAGCATTAGGG + Intergenic
951831652 3:26935909-26935931 TCTTAGGAGGAAAAACATTGTGG + Intergenic
952704965 3:36368008-36368030 CCTTAGGGGAAAAAATATTAAGG - Intergenic
954158551 3:48702680-48702702 GCTGAGGAGAAAATAAAGCAGGG - Intronic
956939553 3:74141656-74141678 GCTTAGATGAAAATAATTTAAGG - Intergenic
957160695 3:76605825-76605847 GCCTGGGAGAAAATACACTTTGG + Intronic
957608706 3:82439004-82439026 GCTTATGAGAAAATACATGTAGG - Intergenic
957631351 3:82719950-82719972 TCTTAGGATAAAATACAGAATGG - Intergenic
958263908 3:91414793-91414815 GAGAGGGAGAAAATACATTAGGG - Intergenic
958557104 3:95693454-95693476 GCTTATGAGAAAACACATCAAGG - Intergenic
959642987 3:108662728-108662750 GTTTAGGAGAAAAGAGATTGGGG - Intronic
960022328 3:112968956-112968978 GCTTAGGAGAAAATACATTAAGG + Intronic
960175713 3:114515388-114515410 GCTGAGGAGAACATACATGTGGG - Intronic
960796801 3:121496054-121496076 GCTTAGGGTTTAATACATTAAGG + Intronic
962143025 3:132810490-132810512 GCTTAGGAAAAAAAACGTTCTGG - Intergenic
964469498 3:157037733-157037755 GCTAAGGAAAAAATAAATCAGGG + Intronic
964802025 3:160567186-160567208 GCTTATGATAAAATCCATGATGG - Intergenic
966234092 3:177681632-177681654 GGCAAAGAGAAAATACATTATGG - Intergenic
966528231 3:180943767-180943789 GCTTTGGTGAAAATAGAATAAGG + Intronic
967996740 3:195172677-195172699 GTTTCGGAGAAAATAAAATAGGG + Intronic
969862010 4:10044355-10044377 GATGAGGTGACAATACATTATGG - Intronic
973108142 4:46366205-46366227 GTTTAGCAGAAAATCTATTAGGG - Intronic
974984156 4:68998447-68998469 GCTTAAGGGAAAACACATGAAGG - Intergenic
975078529 4:70245129-70245151 GCTATAGAGAAAATACATTCAGG + Intronic
976978443 4:91193100-91193122 GCTAAGGATAAAATGCAGTAGGG - Intronic
978313390 4:107410354-107410376 TCTTTGGAGAACATACATTCTGG - Intergenic
978707814 4:111736719-111736741 ACTTTGGAGGAAATACATTTAGG - Intergenic
979707812 4:123741799-123741821 GCTGAGAAGAAAACACTTTAAGG + Intergenic
980578872 4:134722183-134722205 TCTTACCACAAAATACATTAAGG - Intergenic
980958134 4:139449023-139449045 GCTTAGGAGAGGATAAAATAAGG - Intergenic
981821810 4:148895938-148895960 GCGTAGGATTTAATACATTATGG + Intergenic
982433327 4:155349424-155349446 GCTTGGGAGGAAAGGCATTATGG + Intronic
984711597 4:182890019-182890041 GCTTCGGAGACAATACAGAAAGG + Intergenic
985349149 4:189039133-189039155 GCACAGGAGAAAATGCATTAAGG + Intergenic
986329499 5:6707121-6707143 ATTTAGGAGAAAATAAATTAGGG - Intergenic
987719734 5:21617970-21617992 GCTGAGGAGAAAGTCCATTTAGG - Intergenic
988972369 5:36482288-36482310 GATTAAGGGAAAATACATCATGG - Intergenic
989413071 5:41142192-41142214 GTTTTGGAGAAAATACAACACGG - Intergenic
991423844 5:66470005-66470027 GCTTAAGAGAAATAACTTTACGG - Intergenic
992512903 5:77457409-77457431 TCTTATAAGAAAATACATTATGG - Intronic
993378739 5:87181094-87181116 GCTCAGGAAAAAAGAGATTAAGG + Intergenic
994095146 5:95841238-95841260 GTTTAAGAAAAAATACATGAAGG - Intergenic
994241509 5:97427016-97427038 GTTTAGGAGAAAAGGCATCAAGG - Intergenic
994808703 5:104485099-104485121 GTTTAGTAAAAAATAAATTAAGG + Intergenic
994885308 5:105553681-105553703 GGTTATGAGAAAATTCAGTATGG + Intergenic
995323450 5:110863412-110863434 GCTTAGAACATAATACATTTTGG + Intergenic
996945694 5:129064702-129064724 CATTAGCAAAAAATACATTATGG - Intergenic
997042949 5:130278709-130278731 GATTAGGAGAAAATAGAGAAAGG + Intergenic
998016088 5:138733570-138733592 GCTATGAAGAAAATACAATAGGG + Intronic
998861966 5:146453160-146453182 GCTGTGGAGAAAATACATTAGGG + Intronic
999089891 5:148926861-148926883 GCATAGGAAAGAATACATTCTGG - Intronic
1002779587 6:356289-356311 GTTTAGCAGAAAAGACATTTTGG + Intergenic
1003574531 6:7280179-7280201 AGTTAGGAAAAAATATATTAGGG - Intronic
1004100565 6:12606042-12606064 GCTCACCAGAAAATACATAACGG + Intergenic
1004196323 6:13509131-13509153 GCTTGGGGCAAAATACATTGGGG + Intergenic
1007230940 6:40347473-40347495 GCTTGGGAAAAAATGCATTTTGG - Intergenic
1009180044 6:60506421-60506443 GAGAGGGAGAAAATACATTAAGG + Intergenic
1011029792 6:82909408-82909430 GCTTAGCAGAGAATATATTCTGG - Intronic
1011811654 6:91139045-91139067 GCTTGGAAGAAAATAGATAAAGG + Intergenic
1012718434 6:102707443-102707465 TCATAGGTGGAAATACATTACGG - Intergenic
1012789105 6:103670412-103670434 GCTCAGGACCAAATACATTCTGG - Intergenic
1012975966 6:105781256-105781278 GCTTACAAGAAAACACATTTTGG + Intergenic
1013636309 6:112033010-112033032 GCTCATGAGATAATACATTGAGG + Intergenic
1013689083 6:112618306-112618328 GCCAAGGTGAAAATATATTAAGG - Intergenic
1014147961 6:118020110-118020132 ACTGAGAAAAAAATACATTATGG - Intronic
1014257473 6:119176480-119176502 GCTAAGCAGAAAATAAAATAGGG + Intergenic
1014948562 6:127526850-127526872 GATTAGGAGAAAATATTTTTTGG + Intronic
1015035032 6:128643471-128643493 GCTTAGGAAAAGTTACATAAAGG + Intergenic
1015570334 6:134614663-134614685 TGTAATGAGAAAATACATTATGG - Intergenic
1015853859 6:137603013-137603035 GCTGCAGAGACAATACATTATGG - Intergenic
1016094355 6:140017764-140017786 ACTTATGAGAAAATATATAATGG + Intergenic
1018212648 6:161497027-161497049 CCCTAGGAGCAAATACATCAAGG + Intronic
1020601846 7:10285360-10285382 GTTTGGTAGAAAATAGATTAAGG + Intergenic
1021351943 7:19604449-19604471 TCTAAGGACAAAAAACATTAAGG - Intergenic
1021797518 7:24271892-24271914 GCTCAGGAGAAAATAGAATGAGG + Intergenic
1022229021 7:28395054-28395076 TCTTAGGAGAAAAAAATTTAGGG + Intronic
1026258378 7:68732586-68732608 GCCTAGAAGGAAACACATTAAGG + Intergenic
1027137112 7:75632390-75632412 GCTTAGGAGAAAAGAATTTTTGG - Intronic
1027346193 7:77262172-77262194 GCTTACGAGAAAGTTCATCATGG - Exonic
1030358054 7:108565243-108565265 GCTTTTTAGAAAATACTTTAAGG - Intronic
1031159196 7:118145600-118145622 GCTTATGAGAAAATGGAATAGGG + Intergenic
1033007240 7:137579936-137579958 GCTTAGAAGAAAATTCTTTTGGG - Intronic
1033763529 7:144462850-144462872 GCTGATGACATAATACATTAGGG - Intronic
1038465001 8:27753727-27753749 GATTTAGAGAAAATAAATTATGG - Intronic
1039283097 8:36007490-36007512 GCTTCGGAGAAGAGACATTCTGG - Intergenic
1042233903 8:66588720-66588742 GTTTAGGAAAAAAAACTTTAGGG + Intronic
1042405488 8:68400455-68400477 GCTGAGAAGAACATACACTAGGG - Intronic
1042415642 8:68514530-68514552 GCTTAGGAGAAAATAACCTGTGG - Intronic
1042456373 8:69008784-69008806 GTTTAGGACAAAACACTTTACGG - Intergenic
1043580742 8:81710482-81710504 GATGAGCAGAAAATACATGATGG + Intronic
1044121187 8:88398517-88398539 CCTTAGGAGAAAATCCAGCATGG + Intergenic
1044127340 8:88474491-88474513 GCTCAGGAGAAGCTACAGTATGG - Intergenic
1044421616 8:92002604-92002626 CCTGAGGAGAAAACACATTTTGG - Intronic
1045770262 8:105729410-105729432 TCTTAGAAAAAAATACATAAAGG - Intronic
1046101037 8:109614458-109614480 GATTAGAAGAAAATAAATGAAGG - Intronic
1046258894 8:111740103-111740125 GCTTGGGGGAAAATAAAATATGG + Intergenic
1046336300 8:112792600-112792622 GCTTAGGAAAAATTATCTTAGGG - Intronic
1050760622 9:9065616-9065638 CCATGGGAGAAAATACATTATGG + Intronic
1051559385 9:18423192-18423214 GCTTCGGAGAAATTACTTTCTGG + Intergenic
1056160765 9:83890171-83890193 TTTTAGGAGAGAATACATGACGG - Intronic
1056316523 9:85395620-85395642 GTATAGAAGAAAATATATTATGG - Intergenic
1056359372 9:85839151-85839173 TTTTAGGAGAGAATACATGACGG + Intergenic
1058611938 9:106787103-106787125 GTTTAGGAGTAGATACATTATGG - Intergenic
1060315808 9:122509514-122509536 GGCTATGAGAAAATACTTTAGGG - Intergenic
1060684976 9:125601873-125601895 CCTCAGCAGAAAATATATTATGG + Intronic
1061471753 9:130832362-130832384 TCTTAGGAGAAAATAATTCAGGG - Intronic
1062512503 9:136914558-136914580 TTTTAAGAGAAAATACATTGTGG + Intronic
1186276783 X:7948124-7948146 GCTTAGGAAAAAAGTGATTATGG - Intergenic
1187044909 X:15637882-15637904 GCTTAGGAGAATATAATTTGTGG - Intronic
1188810415 X:34647607-34647629 ACTTAGGAGTAAAAACATTAAGG + Intronic
1190490070 X:50973012-50973034 GATTAAGAGAAAGTACATGAGGG + Intergenic
1191754209 X:64576804-64576826 GCTAAAGAGAAAATACAGAAGGG + Intergenic
1195355807 X:104039047-104039069 GCTTCCGAGAAAATAAAGTAAGG - Intergenic
1198969208 X:142262343-142262365 ACTTATCAGAAAATACGTTAAGG + Intergenic
1199106544 X:143875603-143875625 GCCTAGGAGAAAATGGTTTATGG + Intergenic
1199898496 X:152149644-152149666 GTTTAGGAGAAATTAACTTAGGG + Intergenic