ID: 960022535

View in Genome Browser
Species Human (GRCh38)
Location 3:112971394-112971416
Sequence CTGTATTTCCAAGTATCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960022534_960022535 2 Left 960022534 3:112971369-112971391 CCAGGGATGCAATACAGAGGGCT 0: 1
1: 0
2: 2
3: 16
4: 85
Right 960022535 3:112971394-112971416 CTGTATTTCCAAGTATCTGTAGG 0: 1
1: 0
2: 2
3: 38
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960022535 Original CRISPR CTGTATTTCCAAGTATCTGT AGG Intronic
903046605 1:20568953-20568975 GCGTATTTTCATGTATCTGTTGG - Intergenic
903412348 1:23155876-23155898 CTGTTTTCCCAATTATCTGCGGG - Intronic
904020407 1:27460082-27460104 GGTTATTTCCAAGTATCTATAGG + Intronic
904862202 1:33546968-33546990 GTATATTTCCAAGTAGCTGTAGG + Intronic
905333616 1:37227559-37227581 CTGTATTTCTGAGTATCTCATGG + Intergenic
907059734 1:51409311-51409333 CTGTTTTTCCAAATTTTTGTTGG - Intronic
907157798 1:52350466-52350488 CTTGTTTTCCAAGTATTTGTGGG - Intronic
909378053 1:74962673-74962695 CTGTATTCCCAAGTATTGGGAGG - Intergenic
909998947 1:82318295-82318317 CTTAATTTCCAAATATCTGAGGG + Intergenic
910754811 1:90677273-90677295 TTTCATTTCCAAGTATCTGGAGG - Intergenic
911199367 1:95029058-95029080 CTGTTTTTCACAGTTTCTGTGGG + Intronic
912307606 1:108585893-108585915 CTGTATTTCCAAGTATGTCTTGG + Intronic
914326736 1:146624795-146624817 CTGTATTTTTAAGTTTCTTTAGG - Intergenic
915511741 1:156390425-156390447 CTGGATTTCCAGGGATCTCTGGG + Intergenic
917256110 1:173118041-173118063 CTGTGTTCCCAAGGAGCTGTAGG - Intergenic
917465598 1:175273168-175273190 ATGTATTTCCAAATAAATGTGGG - Intergenic
917965652 1:180176921-180176943 TTGTGTTTCCAAGTGTCAGTTGG + Intronic
918188252 1:182146599-182146621 CAGTATTACCAGGTGTCTGTGGG - Intergenic
918894024 1:190316482-190316504 GTGTATTTCAAAGTAGCAGTGGG + Intronic
921335890 1:214085733-214085755 CTGTATTTCCAACTTCCTCTAGG + Intergenic
922019549 1:221689590-221689612 CTGTTTTTCCAGGTATTTGGAGG + Intergenic
922628583 1:227080237-227080259 CTGTATTTCCAAGTAAAAATAGG - Intronic
923323582 1:232860284-232860306 CTGTATTTCCAAGTTTCTTAAGG - Intergenic
923508439 1:234627353-234627375 TTGTACTTCTAAGTACCTGTTGG + Intergenic
924461365 1:244262212-244262234 CTTAATTTCCAAATATATGTAGG - Intergenic
1063486142 10:6422984-6423006 CTCCATTTCCAAATATCTCTGGG + Intergenic
1065250892 10:23812150-23812172 CTGTATTTCCAATTGTCTTATGG - Intronic
1065350263 10:24789321-24789343 CTGTATTTGTAAGTATTTCTAGG + Intergenic
1066478304 10:35769986-35770008 CTGTATTTCCCAGAATTTTTTGG + Intergenic
1066823816 10:39535294-39535316 TTGAATTTGCAAGTATATGTTGG + Intergenic
1068242277 10:54318183-54318205 CCGTATTTCCCAGTTTCTGTGGG + Intronic
1068341469 10:55709785-55709807 CTGTGTTTCAAAGTCTTTGTAGG + Intergenic
1069236386 10:66080851-66080873 CTCTATTTCCTACTCTCTGTAGG - Intronic
1071939614 10:90574512-90574534 CTGTATTTCCTTGTATATGACGG + Intergenic
1072923231 10:99594252-99594274 CGGTATTTCCTATCATCTGTGGG + Intergenic
1074604533 10:114947952-114947974 ATGTATTTCCAGCTTTCTGTAGG - Intronic
1077990807 11:7410127-7410149 TTTAATTTCCATGTATCTGTAGG + Intronic
1078664226 11:13311187-13311209 CTGCATTTCCAATTCTCTGCTGG - Intronic
1080173534 11:29335056-29335078 CTGTATCTGCCAGTCTCTGTGGG - Intergenic
1080914803 11:36645911-36645933 TTCTATCTCCAAGTATTTGTTGG + Intronic
1083225668 11:61282942-61282964 ATATATTTCCAAGGTTCTGTTGG - Intronic
1083307484 11:61768895-61768917 CTGTGTTTCCAGGAAGCTGTGGG + Intronic
1086423819 11:86664623-86664645 CTGTATTTCCACTGTTCTGTAGG - Intronic
1090098577 11:123769400-123769422 CTTTATTTCCCAGTTTCTATGGG + Intergenic
1090230177 11:125096907-125096929 TTGTCTTGCCATGTATCTGTAGG - Exonic
1090637190 11:128696812-128696834 CTATATTTCAAAATACCTGTGGG + Intronic
1091393688 12:141015-141037 CTGGATTTCCAAGAACCTCTGGG + Intronic
1092581857 12:9850553-9850575 CTCTATTTCCCAGTCTCTGTGGG + Intergenic
1092704780 12:11270362-11270384 GTGTATTTTAAAGTATCTTTAGG + Intergenic
1094585762 12:31776013-31776035 CTGTATCTTCAAGTACCTGAGGG - Intergenic
1096031561 12:48420578-48420600 CTCTATCTCCCAGTCTCTGTGGG + Intergenic
1097809046 12:63998648-63998670 CTGGATTTCCAAATATCTCAAGG - Intronic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1098566902 12:71947101-71947123 CTGCATTTCAAGGTATCTGCAGG + Intronic
1099198263 12:79645508-79645530 CTCTATTTACAAATATCTGAGGG + Intronic
1100458265 12:94773950-94773972 CTTTATCTCAAAGTTTCTGTGGG + Intergenic
1100948229 12:99812853-99812875 CTCTTATTCCAATTATCTGTAGG - Intronic
1102584227 12:113912020-113912042 CTGCATTTCCATGTTTCTGTGGG - Intronic
1104530899 12:129570317-129570339 CTGTAGTTCCAAGCATCTCATGG + Intronic
1105728250 13:23186716-23186738 CTGTATTTCCCAGCAGCTGCTGG - Intronic
1106290021 13:28352263-28352285 CTGTACTTCCTTGTACCTGTAGG + Intronic
1106522908 13:30513610-30513632 CTGTATGTCCAAGTTTCTACTGG + Intronic
1108159853 13:47627848-47627870 CTCTTTTTCCATGTAACTGTGGG - Intergenic
1108172739 13:47759930-47759952 CAATATTTCCAAGCATCTTTAGG + Intergenic
1108479067 13:50848925-50848947 CTGTATTTTCAAGTTTCAGTAGG + Intergenic
1109073203 13:57796199-57796221 TTGTCTTGCCAAGTATCTATTGG + Intergenic
1109154123 13:58883528-58883550 CTCTATCTCCCAGTTTCTGTGGG - Intergenic
1109264218 13:60177954-60177976 CTGTACTTCCAACTACCCGTGGG + Intergenic
1109848003 13:68022598-68022620 CTCTATTTCCTAGTCTCTGTGGG - Intergenic
1109897615 13:68713615-68713637 CTCTATCTCCCAGTCTCTGTGGG + Intergenic
1110432813 13:75444766-75444788 CTGTATTTCAAATTCTGTGTTGG + Intronic
1111044941 13:82802735-82802757 CCTTATCTCCAAGTTTCTGTGGG - Intergenic
1111052653 13:82905443-82905465 CTCTATTTCCCAGTCTCTGTGGG - Intergenic
1111262444 13:85759858-85759880 CAGTCTGTCCATGTATCTGTGGG + Intergenic
1111642183 13:90982461-90982483 TTTTTTTTCCAAATATCTGTTGG - Intergenic
1112846341 13:103647800-103647822 CTGTGTTTGGAAGTAACTGTTGG + Intergenic
1116383966 14:44308261-44308283 CTGGGTTTCCAAATATCTGGTGG + Intergenic
1116688347 14:48072396-48072418 CTCTATTTCCCAGTGTCTGGAGG - Intergenic
1116689774 14:48090718-48090740 CTCTATCTCCAAACATCTGTTGG + Intergenic
1117131566 14:52692553-52692575 TTGTATTTCCAAACATCTGGTGG + Intronic
1118131122 14:62964769-62964791 CTCTATTTCCTAATGTCTGTAGG + Intronic
1119990847 14:79195484-79195506 ATGTTTTTCCAAGTGTCTGGAGG + Intronic
1120121073 14:80680653-80680675 ATGTATCTCCAAGAATCTGAAGG + Intronic
1120836017 14:89039017-89039039 CTGTAGTTCCAGCTATCTGTAGG + Intergenic
1120981888 14:90297571-90297593 GTATTTTTCAAAGTATCTGTTGG + Intronic
1122168704 14:99852749-99852771 CTGCATTTCCACACATCTGTGGG + Intronic
1125098580 15:35883348-35883370 CTGTATTTCCAACTCTCTGCTGG + Intergenic
1127136058 15:55924743-55924765 ATTTATTTCTGAGTATCTGTGGG - Intronic
1127254062 15:57273426-57273448 CTGTATCACCCAATATCTGTGGG + Intronic
1131758050 15:95587188-95587210 CATTATTTCCCAGTTTCTGTGGG - Intergenic
1131960535 15:97785926-97785948 CTGTATTTCAAAATATATGGAGG + Intergenic
1132768723 16:1548870-1548892 CTGCATTTCCGTGTATTTGTTGG + Intronic
1134403665 16:13936285-13936307 CTGGCTTTCCAATTATCTGAGGG + Intronic
1136072243 16:27794711-27794733 ATGTATTTTCAACAATCTGTGGG + Intronic
1138716779 16:59032771-59032793 CAGAATTTCCAATTTTCTGTTGG - Intergenic
1139168866 16:64605885-64605907 CTCTATTTCCAAGGATGTCTTGG + Intergenic
1139449208 16:67016697-67016719 CTGTTTTTCCAAGGAACTTTAGG + Intergenic
1139903916 16:70349573-70349595 CTGTATTTCCAAATGTCTGATGG - Intronic
1140006828 16:71086150-71086172 CTGTATTTTTAAGTTTCTTTAGG + Intronic
1140590213 16:76342800-76342822 TTATATTCCTAAGTATCTGTGGG + Intronic
1140955720 16:79863243-79863265 CTGTGTTTCCATGTAATTGTTGG + Intergenic
1143443450 17:6993408-6993430 CTTCATTTCCCAGTTTCTGTGGG + Intronic
1144435583 17:15237004-15237026 CTGAATTTTCAGTTATCTGTTGG - Intronic
1144611049 17:16715967-16715989 CTGTATTTACAACTGGCTGTGGG + Intronic
1144901686 17:18599396-18599418 CTGTATTTACAACTGGCTGTGGG - Intergenic
1144929386 17:18846664-18846686 CTGTATTTACAACTGGCTGTGGG + Intronic
1145130817 17:20346671-20346693 CTGTATTTACAACTGGCTGTGGG + Intergenic
1146302321 17:31699025-31699047 CTGTAGTCCCAACTATGTGTGGG + Intergenic
1146307113 17:31738786-31738808 CTTTACTTCCAGGTCTCTGTGGG + Intergenic
1147643391 17:42018826-42018848 CTGTATATCCAACTATCTACTGG + Intronic
1148018008 17:44536265-44536287 CTGTATTTCTAAAGATTTGTGGG + Intergenic
1149190692 17:54057953-54057975 CCCTATCTCCCAGTATCTGTGGG + Intergenic
1149544043 17:57489843-57489865 CTCTAAGTCCAAGTATCTCTTGG + Intronic
1149963224 17:61135505-61135527 CAGTACTTCCAAAGATCTGTAGG + Intronic
1150521310 17:65869200-65869222 CTGTATTTCTAAATAGCTCTTGG - Intronic
1153528647 18:6021341-6021363 GGGTATTTCCATGTAGCTGTGGG + Intronic
1153621437 18:6982180-6982202 CTGTTCTTCCTAGTGTCTGTTGG - Intronic
1153843846 18:9030953-9030975 CTGTATTCCCAGCTATTTGTGGG + Intergenic
1155750074 18:29411996-29412018 CTATTTATACAAGTATCTGTAGG + Intergenic
1156510117 18:37629180-37629202 TATTATTTCCAAGTTTCTGTGGG - Intergenic
1157494617 18:48147417-48147439 CTGGATTTCCAAATCTCTGGTGG + Intronic
1158846388 18:61447258-61447280 CTGTATGTCCAACTATCTCCTGG - Intronic
1159133105 18:64303771-64303793 CTGCACATCCAAGTATCTGAAGG + Intergenic
1159378856 18:67630498-67630520 CAGTGTTTTCATGTATCTGTTGG + Intergenic
1161686277 19:5704209-5704231 CTGCCTTTCCCAGTATCTGGAGG - Intronic
1162244934 19:9392035-9392057 TTGTATTTCCTAGTATTTTTTGG - Intergenic
1164293614 19:23889364-23889386 ATGTATTTCAACATATCTGTGGG + Intergenic
1165351004 19:35275683-35275705 CTTAATTTCCAAATATTTGTGGG + Intronic
926136734 2:10341855-10341877 CTTTATTTCAAAGTTTCTCTGGG + Intronic
927734786 2:25510151-25510173 CTGGAATTCCAATTATCTGTAGG + Intronic
928096044 2:28405579-28405601 CTGTAATTCCAAGTATCCTGGGG - Intronic
928387224 2:30880863-30880885 CTTTATTTCCAAGTGGCTGCGGG - Intergenic
929337331 2:40765022-40765044 CTGAATTTCCAAGGGCCTGTGGG + Intergenic
930381648 2:50637344-50637366 CTGTTTTCTCAAGTATCTGAAGG + Intronic
930591423 2:53331198-53331220 CTTTATTTTCCAGTATCTTTGGG - Intergenic
930591497 2:53332892-53332914 CTTTATTTTCCAGTATCTTTGGG - Intergenic
932474705 2:71995662-71995684 CGTTATCTCCAAGTATCTGAAGG + Intergenic
933080023 2:77974503-77974525 CTATATTTCCAGGTTTCTTTGGG - Intergenic
933404010 2:81834878-81834900 CTGTTTTTTCATTTATCTGTTGG - Intergenic
933785748 2:85840043-85840065 CTGCACTTCAAAGTATCTGCAGG + Exonic
937451907 2:122009283-122009305 CTGCATTTCCATATTTCTGTCGG - Intergenic
937515449 2:122649878-122649900 CTTTATTTCCAAATATCTTGGGG - Intergenic
937759776 2:125587343-125587365 CTGTAATTCCAAGTAGCTCAAGG - Intergenic
937823515 2:126339088-126339110 ATGTATTTCTAAGTATTTTTGGG - Intergenic
937937094 2:127255036-127255058 CTAAATTTCCAAATGTCTGTTGG - Intergenic
938173008 2:129099009-129099031 CTGTGTTTCCAGGAATATGTAGG + Intergenic
939267129 2:139888708-139888730 CTTTGTTTCCACGTATCTGATGG - Intergenic
939269615 2:139920976-139920998 CAGAATATCCAAGGATCTGTTGG - Intergenic
942637514 2:178023907-178023929 ATGTATGTCTAAGTGTCTGTAGG - Intronic
942648699 2:178144238-178144260 CTGTATTCCCAACTACTTGTGGG + Intergenic
945055473 2:205865140-205865162 CTATGTTTCCAAATATCAGTTGG - Intergenic
945571674 2:211475462-211475484 ATGTATTTCCTAGTACATGTAGG + Intronic
946128092 2:217581972-217581994 TTGTGTGTCCAAGTATCTCTAGG - Intronic
946804468 2:223457401-223457423 CTGTACTTCTGAGTATATGTGGG + Intergenic
947497140 2:230646091-230646113 CTGTGTTTTCAAGGATCTGTGGG + Intergenic
948068866 2:235103693-235103715 CCGTATTTCCAACTAGCTGTGGG - Intergenic
948166115 2:235863944-235863966 CTGTATTTAAAAGTGTGTGTTGG + Intronic
948533963 2:238632478-238632500 GTGTATTTAGAAGTGTCTGTAGG + Intergenic
1170883517 20:20318209-20318231 CTCTTTTTCCAATTATGTGTTGG + Intronic
1171166232 20:22974464-22974486 CTGTTCTTCCAATTACCTGTAGG - Intergenic
1173000230 20:39100219-39100241 TTGTATTTCCATGTGTCTTTGGG - Intergenic
1174951418 20:55045308-55045330 CTATATCTCAAAGTTTCTGTGGG + Intergenic
1176264403 20:64201555-64201577 CTGTATTCTCAAACATCTGTTGG + Intronic
1178819390 21:35961644-35961666 CTGTTTTTCCAGGTACCTGCTGG + Intronic
1179175797 21:39007053-39007075 CTGTATTTCCCAGCAGCTGATGG + Intergenic
1179282884 21:39950228-39950250 GTGCATTCCAAAGTATCTGTGGG + Intergenic
1182012086 22:27009566-27009588 ATATATTTCCCAGTATCTGTGGG + Intergenic
951453697 3:22867494-22867516 CTGTGTTTTCAAGTTTCTTTTGG - Intergenic
951589518 3:24248360-24248382 CTAAATTTCCAAATATCTCTTGG - Intronic
952164567 3:30733063-30733085 GTGTTTTTCAAACTATCTGTGGG + Intronic
953640778 3:44705552-44705574 TTGTATTTCCTATAATCTGTTGG + Intergenic
956739688 3:72266049-72266071 CTGTTTTTCCTAGTATTTATTGG + Intergenic
957214573 3:77302678-77302700 CTGTAATTTCAGGTATCTATTGG + Intronic
959090846 3:101900974-101900996 CCCTATTTCCCAGTCTCTGTGGG + Intergenic
959208780 3:103348102-103348124 CTGTAGTTGCATGTATATGTAGG + Intergenic
959317986 3:104833640-104833662 CTTTATTTTCAAGTATCTGTTGG + Intergenic
960022535 3:112971394-112971416 CTGTATTTCCAAGTATCTGTAGG + Intronic
960462213 3:117950397-117950419 ATGTATTTCCATATATTTGTTGG - Intergenic
962669243 3:137688340-137688362 CTGTATTTGCAAATAAATGTAGG + Intergenic
963380077 3:144518200-144518222 GTGTATTTACGGGTATCTGTTGG + Intergenic
963426913 3:145141498-145141520 CTGACTTTCCAAGTAGCTGCTGG + Intergenic
963518716 3:146338546-146338568 GTGTATTTTCAAGTATCTTATGG - Intergenic
963771315 3:149389060-149389082 ATTTATTTCCTAGTATTTGTAGG + Intergenic
964204533 3:154158005-154158027 ATGCATTTCCAAGTATCCTTAGG - Intronic
967660573 3:192103631-192103653 CTCTATTTCCCAATCTCTGTGGG + Intergenic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
969233323 4:5847245-5847267 CTGTATTTCCCATAATCTGTAGG - Intronic
969978372 4:11127974-11127996 CTGTTTTTCCCAGTACCTGGTGG + Intergenic
970639346 4:18046753-18046775 CTGTTCTTCCAATTATCTGTAGG + Intergenic
971296897 4:25401874-25401896 CTGTATTTCGAAGTATTTTTTGG + Intronic
972493131 4:39606758-39606780 CTCTAGTTCCAAGTATGTGGTGG + Intronic
972837673 4:42893397-42893419 CTGAATGTGCCAGTATCTGTGGG + Exonic
973093293 4:46164899-46164921 CTCTGTTTCCAAGTCTCTGCTGG + Intergenic
974708237 4:65551917-65551939 CTGTATTTGCAAGTATATTTTGG + Intronic
974731953 4:65878319-65878341 CTCTATTTCCCAGTCTCTGTAGG + Intergenic
975366875 4:73539792-73539814 CCCTATCTCCAAGTTTCTGTGGG - Intergenic
975479310 4:74859982-74860004 CTGTAGTTCCAAGCATCTCTAGG - Intergenic
975742654 4:77444772-77444794 ATGTATTTGCAAGTACCTGGTGG - Intergenic
976170188 4:82295383-82295405 CTGTATTTCCAGCTACCTGGGGG - Intergenic
978127767 4:105154900-105154922 CTGTAGTTCCAGGTACTTGTGGG + Intronic
979093507 4:116517155-116517177 CTGTTTTTTCAAGCATCTGAGGG - Intergenic
979437750 4:120714195-120714217 CTGATTTTCCAAGGATCTGTTGG + Intronic
979696429 4:123618154-123618176 CTGTATTTCCAACTGCCTGCTGG + Intergenic
980224948 4:129970746-129970768 CTGAACTTCTAAGTAGCTGTTGG - Intergenic
981587445 4:146319503-146319525 CTATATTTCTACTTATCTGTTGG + Intronic
981968678 4:150637935-150637957 TTGTATTTCCATTTATCTTTTGG + Intronic
982321007 4:154077710-154077732 CTGTATTTCCAGGGATCAGGTGG - Intergenic
982649520 4:158069500-158069522 ATGTATTTCCAAGGAACTGTGGG + Intergenic
982987347 4:162227246-162227268 CTATATTTCCAAGAATCTCTTGG - Intergenic
986162605 5:5244061-5244083 CTGTATTTCCCACATTCTGTAGG + Intronic
987842431 5:23238142-23238164 CCCTATCTCCAAGTTTCTGTAGG + Intergenic
987968192 5:24904847-24904869 CTGAATTTCCAAATATCGGTGGG + Intergenic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
988472659 5:31555094-31555116 GTGTATTTCCTAGTATCTACGGG + Intergenic
989593868 5:43137471-43137493 CTTTTTTTTCATGTATCTGTTGG - Intronic
990073051 5:51808662-51808684 CTGTATTTTCAGGTATCTGGTGG + Intergenic
991203222 5:64018645-64018667 CTGTAGTTCCAAATTTGTGTGGG - Intergenic
993056792 5:82990480-82990502 CTGTATTTCCAAACTTATGTGGG - Intergenic
993423739 5:87735838-87735860 CTGTATTTACAATTATGTGGAGG - Intergenic
993539446 5:89130431-89130453 TTTTGTTTCCAAGTAACTGTTGG - Intergenic
994656202 5:102595984-102596006 CAGTCTTTCCAATTATTTGTAGG - Intergenic
995741078 5:115356259-115356281 CTATATTTCTAGGTATCTGTTGG - Intergenic
996020410 5:118585233-118585255 TTATATATCCAGGTATCTGTTGG + Intergenic
997013052 5:129902852-129902874 CTGTATTCCCAAGTGTCTCTGGG + Intergenic
997695368 5:135857057-135857079 ATCTGTTTGCAAGTATCTGTTGG + Intronic
998189128 5:140007630-140007652 CTTCACTTCCAAGTATCTTTAGG + Intronic
998615261 5:143733554-143733576 CTGTATTTCCAGGCATATGGTGG - Intergenic
999050530 5:148519490-148519512 CTGTACTTGCATGTATGTGTAGG + Intronic
999608192 5:153339394-153339416 CTGTATTTATATGTATGTGTAGG - Intergenic
999948127 5:156619424-156619446 GTGTGTTTTCAAGCATCTGTTGG + Intronic
1001147472 5:169197329-169197351 CTGTATTTCCAGGTAACTCCAGG + Intronic
1001148284 5:169203938-169203960 GTGTATATCCAATCATCTGTTGG - Intronic
1005285438 6:24321719-24321741 TGGTATTTCCCAGTCTCTGTGGG + Intronic
1005589060 6:27305804-27305826 CTGTATGTCTACCTATCTGTGGG - Intronic
1005675878 6:28154208-28154230 CTGTCTTTGAAAGTATCTGATGG + Exonic
1006055759 6:31383492-31383514 CAGTATTTCCATGTATCAATAGG - Intergenic
1009570151 6:65374521-65374543 CTGGAGTTCCAGGTATCAGTGGG - Intronic
1010661816 6:78580301-78580323 CTTTATCTCCCAGTCTCTGTGGG - Intergenic
1012229111 6:96739732-96739754 TCTTATTTCCCAGTATCTGTGGG - Intergenic
1012595970 6:101040193-101040215 CTGTCTTTCCATTGATCTGTAGG + Intergenic
1013491987 6:110656508-110656530 ATGTATTTACAACTATATGTAGG + Intronic
1013639374 6:112058319-112058341 CTACATTTAGAAGTATCTGTAGG - Intronic
1013927109 6:115486583-115486605 CTCTATCTCCTAGTCTCTGTGGG - Intergenic
1014779250 6:125544248-125544270 CTGCTTATCCAAGTATATGTTGG - Intergenic
1015370365 6:132444067-132444089 CTTTATTTCTTTGTATCTGTGGG + Intergenic
1016673015 6:146730608-146730630 CAGTATTTCCAAGTTTCTTTGGG - Intronic
1016698408 6:147025649-147025671 CTGTGTTTCCAAGTATCACCTGG + Intergenic
1016823334 6:148366159-148366181 CTGTATTTCCAACTACTTGGAGG + Intronic
1017788910 6:157778350-157778372 CCTTATTTCCAAGTATCTTTTGG + Intronic
1018111811 6:160543909-160543931 CAGGATTTCCAAGTGTCTGATGG + Intronic
1018131448 6:160735567-160735589 CAGGATTTCCAAGTGTCTGATGG - Intronic
1018459372 6:163983033-163983055 CTGCGTTTTCAAGTAACTGTAGG - Intergenic
1018786636 6:167113496-167113518 CTGTAGTTCCAAGTATTGGAAGG + Intergenic
1021096042 7:16537269-16537291 CTGTACTTTCAAGTAAATGTGGG - Intronic
1021381202 7:19968636-19968658 CTGTATTTCTTAGTCTCTGTGGG - Intergenic
1021447673 7:20750841-20750863 CTGTATTTCCAAATGCCTGTGGG - Intronic
1021982259 7:26066189-26066211 CTGCCTTTCCAAGCATCTGAGGG - Intergenic
1022218720 7:28290945-28290967 CTTTATTTCCAAGTATAAGAGGG + Intergenic
1022864451 7:34402954-34402976 CTCTTTTTCCAACCATCTGTTGG + Intergenic
1023072454 7:36449826-36449848 CTGTGTTACCAAGTATGTATTGG + Exonic
1025752305 7:64304380-64304402 CTGTATTTCCCAGGGTCTTTAGG - Intergenic
1025779296 7:64585473-64585495 CTGTAGTCCCAAGTACCTGGGGG - Intergenic
1027519753 7:79190974-79190996 CTATATTTCCACATATATGTGGG + Intronic
1027914868 7:84303884-84303906 CTATATTTTCAATTATGTGTGGG + Intronic
1028037768 7:86006164-86006186 CTATATTTTCAAATATCTGGAGG + Intergenic
1028093429 7:86731144-86731166 CTGTATTTCCATCTATCTTTTGG + Intronic
1029441945 7:100591678-100591700 CTGTATTTCCAGGCATTTGGAGG + Exonic
1030278124 7:107742123-107742145 CTGGATTTCCATGAATCTGAAGG + Intergenic
1030768978 7:113449878-113449900 CTGTAATACCCAATATCTGTTGG + Intergenic
1030938892 7:115620177-115620199 CCCTATTTCCCAGTCTCTGTGGG - Intergenic
1032796156 7:135277635-135277657 CTGTATTTCCAACTGCGTGTTGG + Intergenic
1036082394 8:5571748-5571770 CTGTTTTTCAAATTATCTGATGG + Intergenic
1036962512 8:13260564-13260586 CTATATTTCCAACTGTCTATTGG - Intronic
1037085457 8:14843617-14843639 ATGTGTCTCCATGTATCTGTGGG - Intronic
1039085000 8:33771187-33771209 CTGCATTTCAAAGGATCTCTTGG - Intergenic
1040631053 8:49210987-49211009 TTATCTTTCCAAATATCTGTAGG + Intergenic
1040767471 8:50930837-50930859 GTGGTTTTCCAAATATCTGTTGG - Intergenic
1041014397 8:53577570-53577592 CTGTAGTTCCAAATTTCAGTTGG + Intergenic
1042828785 8:73004944-73004966 GTGTTTTTCAAAGTATCTCTAGG - Intergenic
1045432785 8:102128808-102128830 CTGAAGTTCCAAACATCTGTCGG + Intergenic
1046089910 8:109489466-109489488 ATGTATTGCCAATTATCTGCTGG - Intronic
1046964261 8:120145774-120145796 CTGTATTTCCAAATAAAAGTAGG + Intronic
1048263852 8:132967998-132968020 CTGTATTTCCAATGTTCTGCTGG + Intronic
1048485172 8:134841164-134841186 TTGGATTTCCAACTTTCTGTGGG + Intergenic
1048653786 8:136512216-136512238 CTGCATTTCAAAGTAACTCTAGG - Intergenic
1051076308 9:13241470-13241492 CTGTCTTTCCAAGAATGTCTAGG - Intronic
1051338121 9:16085420-16085442 CTGTAATTTCAAGAGTCTGTAGG + Intergenic
1051940421 9:22499237-22499259 TTGTATTTGCAATTATCTGTAGG - Intergenic
1052233832 9:26187407-26187429 CTCTATTTCCCAGTCTCTGTAGG - Intergenic
1052692160 9:31828600-31828622 CCCTATTTCCCAGTTTCTGTGGG + Intergenic
1055516427 9:77038197-77038219 CTGTTTTTCCAAGTAATTATAGG + Intergenic
1055770632 9:79713531-79713553 CTGTATTTCTAGTTATTTGTTGG + Intronic
1056033080 9:82573736-82573758 CTCTTGTTCCAGGTATCTGTAGG - Intergenic
1058094013 9:100838413-100838435 CTGTATTTTAAAGGATCTATTGG + Intergenic
1058706799 9:107644224-107644246 CTGTAAATCAAAGTATCAGTTGG - Intergenic
1059702945 9:116793713-116793735 CTGTATTTCAAATTAGCTGCTGG - Intronic
1059984528 9:119809184-119809206 CTGTTTTTCCATTTATCTGATGG + Intergenic
1061535108 9:131242934-131242956 CTGTATTTCCAAGAAGCTAGAGG + Intergenic
1186444098 X:9611493-9611515 CTGTTTGCCCAAGCATCTGTAGG + Intronic
1188127967 X:26394287-26394309 ATGTATTTTCAAGTATCTTTTGG + Intergenic
1188140093 X:26539485-26539507 CTGTGCTTCCAAGCATCTGTTGG - Intergenic
1191894805 X:65981029-65981051 CTCTATTTCCAAATATCTATTGG - Intergenic
1192612349 X:72579804-72579826 CTGTATATCATGGTATCTGTGGG - Exonic
1192680922 X:73253334-73253356 CTGTATTTTCAGGTTTCTTTGGG + Intergenic
1192743650 X:73917371-73917393 CTGAATTTTCAAGTACATGTTGG - Intergenic
1193202343 X:78706440-78706462 CTATATTTCAAAATATTTGTAGG - Intergenic
1193585394 X:83315443-83315465 CTTAATTTCCAAATAGCTGTGGG + Intergenic
1193874034 X:86838229-86838251 ATATATTTCCAAGTGTCTGCTGG + Intergenic
1194076183 X:89397384-89397406 CTTCATTTCCATGTATTTGTAGG + Intergenic
1195612472 X:106883988-106884010 GCATATTTCCATGTATCTGTTGG - Intronic
1196981764 X:121222052-121222074 CTGTATTTTTAGATATCTGTGGG - Intergenic
1197215740 X:123865327-123865349 CTTTGTTTCCAATTAGCTGTGGG + Intronic
1197568895 X:128124276-128124298 CTTAATTTCCAAATATCTATGGG - Intergenic
1200428821 Y:3052906-3052928 CTTCATTTCCATGTATTTGTAGG + Intergenic
1200757106 Y:7000423-7000445 CTGTTTGCCCAAGCATCTGTAGG + Intronic
1201363451 Y:13178639-13178661 CTGCATTTAAAAGCATCTGTTGG - Intergenic