ID: 960022735

View in Genome Browser
Species Human (GRCh38)
Location 3:112973863-112973885
Sequence AAACCAGGACACCCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 176}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960022726_960022735 13 Left 960022726 3:112973827-112973849 CCCTCCCACACCAACTCCTACCA 0: 1
1: 0
2: 3
3: 51
4: 430
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
960022727_960022735 12 Left 960022727 3:112973828-112973850 CCTCCCACACCAACTCCTACCAA 0: 1
1: 0
2: 1
3: 35
4: 390
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
960022729_960022735 8 Left 960022729 3:112973832-112973854 CCACACCAACTCCTACCAACCTT 0: 1
1: 0
2: 0
3: 31
4: 262
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
960022732_960022735 -7 Left 960022732 3:112973847-112973869 CCAACCTTCTACAGTGAAACCAG 0: 1
1: 0
2: 0
3: 15
4: 142
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
960022728_960022735 9 Left 960022728 3:112973831-112973853 CCCACACCAACTCCTACCAACCT 0: 1
1: 0
2: 0
3: 26
4: 263
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
960022725_960022735 23 Left 960022725 3:112973817-112973839 CCTGAAAACTCCCTCCCACACCA 0: 1
1: 0
2: 1
3: 26
4: 277
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
960022730_960022735 3 Left 960022730 3:112973837-112973859 CCAACTCCTACCAACCTTCTACA 0: 1
1: 0
2: 0
3: 14
4: 178
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
960022731_960022735 -3 Left 960022731 3:112973843-112973865 CCTACCAACCTTCTACAGTGAAA 0: 1
1: 0
2: 1
3: 12
4: 148
Right 960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960022735 Original CRISPR AAACCAGGACACCCCCACAG TGG Intronic
900684010 1:3935661-3935683 AGACAAGGACACACTCACAGAGG - Intergenic
905065278 1:35175743-35175765 ATTCCAAGACCCCCCCACAGTGG + Intergenic
905547840 1:38813992-38814014 AAACACAGACACCCCCAAAGAGG + Intergenic
906562918 1:46772527-46772549 AAAACAGAACACCCCAAAAGGGG - Intronic
907461165 1:54606440-54606462 ACACAAGGACACCCACACAGAGG - Intronic
909563969 1:77034540-77034562 AAGCCAGGACATCCCCTTAGAGG - Intronic
911159186 1:94667465-94667487 AAAGCAGGACACCCCGAAAAAGG + Intergenic
915488223 1:156236565-156236587 AACACAGGGGACCCCCACAGGGG + Intronic
916888306 1:169091827-169091849 AAAGGAGGACACCACCACTGGGG + Intergenic
917748822 1:178036549-178036571 AAACCAACACATCCCAACAGGGG + Intergenic
919309871 1:195894013-195894035 CATCCAGGCCACCCCAACAGAGG - Intergenic
920081995 1:203381670-203381692 AGACCAGGACATGCCCAAAGGGG - Intergenic
920672532 1:208015520-208015542 AAACCAAGACACAGGCACAGGGG + Intergenic
923544314 1:234913202-234913224 AAGCCATCACCCCCCCACAGAGG + Intergenic
1063061076 10:2553250-2553272 ACACCTGGACAGGCCCACAGTGG + Intergenic
1066266836 10:33784073-33784095 ACACCAAGACACTCCCTCAGAGG - Intergenic
1067405456 10:46019203-46019225 AACCCTGGACACACCAACAGTGG + Intronic
1067473507 10:46552023-46552045 ATACAAGAACACACCCACAGAGG + Intronic
1067972440 10:50988121-50988143 AATCCAGGACAGCGTCACAGGGG - Intergenic
1070257019 10:74821719-74821741 AAACCAGGAAAACTTCACAGAGG + Intergenic
1070655677 10:78269608-78269630 AAACTAGGACATCACCACAGTGG + Intergenic
1070972947 10:80582490-80582512 GAACCAGGACCCCCGCACTGGGG + Intronic
1076742440 10:132493391-132493413 AAACCAGCCCACGCCCAGAGTGG - Intergenic
1077532317 11:3103097-3103119 GATCCTGGTCACCCCCACAGAGG - Intronic
1077786457 11:5389673-5389695 AAACCAGAAGATCCCCATAGTGG - Exonic
1078247517 11:9588853-9588875 TAAGCAGCACACCACCACAGTGG - Exonic
1079097181 11:17518528-17518550 AGGCCAGGACACCACCACAGAGG - Intronic
1080419362 11:32096272-32096294 AAACCAGGACAGCATCCCAGTGG - Intronic
1084673738 11:70622417-70622439 AGCCCAGGACACTCGCACAGAGG - Intronic
1086698229 11:89868698-89868720 AACACTGGACACCCCGACAGTGG + Intergenic
1086707935 11:89975790-89975812 AACACTGGACACCCCGACAGTGG - Intergenic
1087934546 11:104017183-104017205 AAATCAGGACACCAGCACATTGG - Intronic
1088367397 11:109054009-109054031 CAACCAGGACTCCCCCACCCAGG - Intergenic
1089111916 11:116063906-116063928 AAACATGGAGACCCACACAGAGG - Intergenic
1089183374 11:116598151-116598173 AAAGAAGGACACACACACAGAGG - Intergenic
1089333354 11:117705543-117705565 ATTCCAGGCCACTCCCACAGTGG - Intronic
1092054237 12:5495880-5495902 AAACCTGGACAAGCTCACAGGGG - Intronic
1092101781 12:5889534-5889556 AAATCAGGACAACTCCACAAAGG + Intronic
1093095234 12:14964352-14964374 AAACCAGGACACCCAAAGTGTGG + Intergenic
1093755752 12:22850403-22850425 CAACCGGGACACTGCCACAGGGG - Intergenic
1098740870 12:74171668-74171690 CAACAAGGCCACCACCACAGTGG + Intergenic
1099576513 12:84390532-84390554 CAAACAGGACACCCCAACTGTGG + Intergenic
1101434974 12:104656740-104656762 AAACCAGCAACCCCCCACTGTGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1102145959 12:110655363-110655385 AGATCATGAGACCCCCACAGAGG + Intronic
1102355128 12:112227552-112227574 AAACTAGGACATGCACACAGGGG - Intronic
1102509081 12:113402223-113402245 AAAACAGGACATCCCCAAATCGG + Intronic
1104917974 12:132275909-132275931 ATCCCAGGCCACCCGCACAGTGG + Intronic
1106527976 13:30560167-30560189 AAAAGAGGACACCCCCAAAGAGG + Intronic
1108471019 13:50766934-50766956 AAACCAGGACACAGACCCAGGGG - Intronic
1112840638 13:103573342-103573364 AGCCCAGGACTCCCCCACACTGG + Intergenic
1113619013 13:111700577-111700599 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113624542 13:111785838-111785860 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113965941 13:114154168-114154190 AAATCAAGACACACCCACAGTGG - Intergenic
1118647110 14:67851094-67851116 AAACCAACACACCCCTGCAGAGG - Intronic
1122949487 14:105033825-105033847 AAAACAGAACACCCCAAAAGGGG - Intergenic
1124034850 15:26045719-26045741 AAACCTGGAGCCCACCACAGGGG - Intergenic
1125081492 15:35678590-35678612 AAAACATGACAACCCCAGAGAGG - Intergenic
1125301000 15:38252994-38253016 AACCCCGGCCACCCCCGCAGGGG - Exonic
1125921803 15:43529426-43529448 AAGCCAGGTCACCCCAGCAGAGG + Exonic
1127137058 15:55935300-55935322 AAGGCAGGACACCCCATCAGTGG - Intronic
1129285813 15:74523770-74523792 AAACCATATCACCCCCACTGCGG + Intergenic
1129674300 15:77624242-77624264 CAACCAGCACACACACACAGAGG - Intronic
1132055665 15:98648947-98648969 AATCCAGGACACACACAAAGCGG - Intergenic
1132425098 15:101709458-101709480 ACACCAGGACAGTCCCACAGAGG + Intronic
1137367538 16:47873701-47873723 ACACCAGTGCACCCCCACATTGG + Intergenic
1138552237 16:57754219-57754241 AAACATGGACACCACCACACTGG + Intronic
1141689985 16:85591230-85591252 AAACCAGGAGGGCCCGACAGAGG - Intergenic
1143491772 17:7289337-7289359 CCACCAGGAAGCCCCCACAGAGG - Intronic
1144824381 17:18097676-18097698 ATCCCAGGACACCCCGGCAGAGG + Intronic
1145414825 17:22705934-22705956 TAAGCAGCACACCACCACAGTGG - Intergenic
1146441923 17:32904609-32904631 AAAACAGAACACCCCAAAAGGGG + Intergenic
1147758086 17:42781285-42781307 ACACCAGGCCACCTCCACTGTGG - Exonic
1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG + Intronic
1151951611 17:77357249-77357271 GAACAAGGACACATCCACAGGGG + Intronic
1152043887 17:77923554-77923576 AAACCAGCACAGACCCCCAGTGG + Intergenic
1153571203 18:6475256-6475278 AAGCCAGAAGACCCCCCCAGAGG - Intergenic
1158750055 18:60248212-60248234 AACCCAGGGCACTCCCATAGGGG - Intergenic
1160710070 19:547371-547393 GCACCAGGACACCCCCGCACAGG - Exonic
1161753353 19:6113661-6113683 AAACCGGGAAATCCCCAAAGCGG + Intronic
1165979096 19:39704746-39704768 ACACCACCACACCCTCACAGAGG - Intronic
1167696260 19:51017150-51017172 CCACCAGGACACCCGCGCAGTGG + Exonic
925406488 2:3608795-3608817 AAACCAGGGCAGCCCCGCCGTGG + Intronic
925700002 2:6627231-6627253 AAGCCAGGACACCCTCACCCCGG - Intergenic
926510831 2:13775577-13775599 AAACCTGGACACCGTAACAGTGG + Intergenic
929056044 2:37876728-37876750 ACACAAGGACACTCCTACAGAGG + Intergenic
930194788 2:48498390-48498412 AAACCAAAACTACCCCACAGAGG - Intronic
930744761 2:54870810-54870832 AATCCAGGCCACTCCTACAGAGG - Intronic
931287196 2:60842467-60842489 AAACCAGAATATCTCCACAGAGG + Intergenic
933740624 2:85531149-85531171 ACACCAGGCCACGCCCACAAGGG + Intergenic
934108802 2:88722789-88722811 AAAACAGAACACCCCAACTGCGG + Intronic
935550349 2:104446432-104446454 AAACCAGGCCACACATACAGTGG + Intergenic
936125860 2:109788757-109788779 ATACCTGTCCACCCCCACAGGGG + Intergenic
936218833 2:110582711-110582733 ATACCTGTCCACCCCCACAGGGG - Intergenic
936248261 2:110847170-110847192 AAAACAAAACACCCACACAGTGG - Intronic
938442992 2:131352653-131352675 CAACAAGGCCACCCCCACATGGG - Intronic
939254448 2:139724247-139724269 AAAGCAGAACACCCCAAAAGGGG - Intergenic
940737360 2:157468420-157468442 AACCCAGGACTACTCCACAGAGG - Intronic
943455381 2:188100697-188100719 AAACTAGGACATACCGACAGTGG - Intergenic
944962472 2:204890647-204890669 AAACCAGGACACATGCACAACGG + Intronic
947454719 2:230243525-230243547 AAAGGAAGACTCCCCCACAGTGG + Intronic
948264537 2:236627332-236627354 AATCCAGGACTCACCCACTGTGG - Intergenic
948591612 2:239054115-239054137 AAGCCAGGACTCCCTCACACAGG + Intronic
1172023133 20:31929620-31929642 AAACCAGGAAACCTACTCAGTGG - Intronic
1172096586 20:32463482-32463504 AAACCAGGCCCTCCCCACTGTGG + Intronic
1172175702 20:32970682-32970704 AGACCAGGACAAGCCCACCGTGG - Intergenic
1173450604 20:43160177-43160199 ATGCCAGGAAACCCCCACAACGG + Intronic
1176881321 21:14197874-14197896 AAACCAGGTCACCTACAAAGGGG + Intronic
1180099014 21:45575635-45575657 AATCCAGGAGCCCCCCACCGTGG - Intergenic
1180844379 22:18973321-18973343 TATGGAGGACACCCCCACAGGGG + Intergenic
1182181064 22:28348592-28348614 AAAACAGGACAGACCCACAAAGG + Intronic
1185405557 22:50646632-50646654 AAAACAGGACACCCCAAAAGGGG - Intergenic
950303897 3:11903882-11903904 AAAGCATGACACCCTCATAGTGG - Intergenic
952365797 3:32673871-32673893 AAAGCAGGCCACCTGCACAGGGG - Intergenic
952821204 3:37487386-37487408 AAACCTGGAAAGCCCCAGAGAGG - Intronic
953971983 3:47355162-47355184 ATATCCGGACACCCCCAAAGGGG - Intergenic
954237719 3:49269717-49269739 GAACCAGGGCACGCCCACTGGGG + Exonic
955574179 3:60341182-60341204 AAAACAACACACCCCCACGGTGG - Intronic
955700217 3:61674814-61674836 TAACCATGACACTCACACAGAGG - Intronic
956540705 3:70335579-70335601 ATAGCAGGACAATCCCACAGTGG - Intergenic
959281557 3:104348037-104348059 AAAACAGAACACCTCCAAAGGGG - Intergenic
960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG + Intronic
960912491 3:122663244-122663266 AAACCAGGACACACAAACATTGG - Intergenic
962375940 3:134858808-134858830 CAGCCAGGACAGCCCCACAGTGG + Intronic
964539799 3:157767388-157767410 AAACCATTATACCCCCAAAGAGG + Intergenic
968634264 4:1669797-1669819 ACACCAGGACACCCTCAAAAAGG + Intronic
968874754 4:3260373-3260395 CAACCAAAACACCCCCAAAGTGG - Intronic
969626655 4:8309080-8309102 AGAGCTGGAGACCCCCACAGAGG - Intergenic
970584316 4:17500542-17500564 AAACGAGGACAGACACACAGAGG + Intronic
971068586 4:23063821-23063843 AAAACAGGGCACCAACACAGAGG - Intergenic
974948158 4:68553468-68553490 AAAACAGAGCACCCCCAAAGGGG - Intronic
975807875 4:78132174-78132196 AAACCAGGGCCCCCCTGCAGAGG + Intronic
976363013 4:84202617-84202639 AGACCAGGAGACTCCCTCAGGGG + Intergenic
978986471 4:115019637-115019659 AAACCAGGGCACTAACACAGTGG - Intronic
980134504 4:128846758-128846780 AAAGCAGCACCTCCCCACAGTGG - Intronic
980270141 4:130573849-130573871 AAAACAGAACACCCCAAAAGGGG + Intergenic
980285459 4:130773268-130773290 AAACCAGGACATCCACACCATGG + Intergenic
982000048 4:151014515-151014537 AAACCAGGGCTCCCCATCAGGGG - Exonic
983061908 4:163170033-163170055 AAAACAGGAGACCTTCACAGGGG + Intergenic
986000872 5:3629636-3629658 AAACCAGGAGATTCCCAGAGAGG + Intergenic
986026087 5:3852763-3852785 AAAGCAGGACACCCGCACGGTGG - Intergenic
986753310 5:10810498-10810520 AAACCAGGGCACCAGCAAAGTGG + Intergenic
996770729 5:127082660-127082682 AGACCAGGACACACGAACAGTGG - Intergenic
997878026 5:137566260-137566282 CCTCCAGGACACCCACACAGAGG + Intronic
1004015390 6:11727588-11727610 AAATAAGGACATCCCCCCAGAGG + Intronic
1004920095 6:20368134-20368156 GAACTATTACACCCCCACAGTGG - Intergenic
1005051898 6:21692429-21692451 AAACCTTGACCCCCACACAGCGG + Intergenic
1008646616 6:53520889-53520911 ACACCAGGACAGCCCTACGGAGG - Exonic
1013404433 6:109830532-109830554 AAACCATGTCACCCCCAAATAGG - Intergenic
1015264403 6:131276091-131276113 ACAAAAGGACATCCCCACAGGGG - Intronic
1015814223 6:137191591-137191613 AAAACAGAACACCCCAAAAGGGG + Intergenic
1017582521 6:155881974-155881996 GAAACCGGACACTCCCACAGAGG + Intergenic
1017599956 6:156069680-156069702 CAACCAGGACAGCTCCAGAGTGG + Intergenic
1019482957 7:1274754-1274776 AAACCAGGACCCCTCCCCACAGG - Intergenic
1019978702 7:4605232-4605254 AAAGCAGGACACCCTAGCAGAGG - Intergenic
1020746988 7:12090945-12090967 AGCCCAGGGCCCCCCCACAGTGG + Intergenic
1022677803 7:32516056-32516078 AAAACAGAACACCCCCAAATGGG - Intronic
1023523620 7:41074178-41074200 AAGCCAGGAAATCCCCGCAGTGG + Intergenic
1026334404 7:69381416-69381438 ACACAAGCAGACCCCCACAGAGG + Intergenic
1026346801 7:69481577-69481599 AAACCCGGACCCCCACACAATGG + Intergenic
1026895492 7:74007880-74007902 AAACCAGCTCACACCCTCAGAGG - Intergenic
1029356898 7:100058697-100058719 ACACAAAAACACCCCCACAGGGG - Intronic
1030782872 7:113623676-113623698 AAAACAGAACACCCCCAAAGTGG + Intergenic
1032800808 7:135316142-135316164 AAACCTGGACAAACCCACTGGGG - Intergenic
1033989507 7:147265889-147265911 AAACCACAGCACCCCTACAGAGG + Intronic
1034698230 7:153073995-153074017 AAACCAGGGCACGGCCACTGAGG - Intergenic
1037723479 8:21464608-21464630 CAACCAGCACACCACCAGAGGGG + Intergenic
1037897570 8:22668480-22668502 AAACCAGTCCAATCCCACAGTGG + Intronic
1038477721 8:27879805-27879827 ACACCAGGACCCGCCCCCAGGGG + Intronic
1039079652 8:33722421-33722443 ATAGCAGGAAACCCCCGCAGAGG + Intergenic
1046150533 8:110218609-110218631 CAAGCAGAACACCCACACAGGGG - Intergenic
1046222019 8:111228792-111228814 AAAACATAACACCCCCAAAGAGG - Intergenic
1049307927 8:141917165-141917187 AAATCAGAACACGCCCACATTGG + Intergenic
1050144410 9:2550774-2550796 ACCCCAGGCCACCTCCACAGTGG - Intergenic
1054932825 9:70653843-70653865 AAAACAGAACACCCCAACAGGGG - Intronic
1055597911 9:77884250-77884272 AAGCCTTCACACCCCCACAGGGG - Intronic
1057826163 9:98373567-98373589 GGACCAGGACACACCCAGAGGGG + Intronic
1061595262 9:131624755-131624777 AAACCAGGGCTCCCGCAGAGGGG - Intronic
1062259074 9:135649204-135649226 AAAGCAGAACACCCCCGCACAGG - Intergenic
1189103501 X:38214375-38214397 AGACCAAGACACCCACCCAGAGG + Intronic
1189551079 X:42094504-42094526 AAAGCAGAACTCCCCCAAAGGGG + Intergenic
1189691796 X:43624505-43624527 AAAACAGAACACCCCAAAAGGGG + Intergenic
1194412270 X:93571749-93571771 AAAACAGAACACCCCAAAAGGGG + Intergenic
1195688467 X:107605267-107605289 ACACAAGGACACCCACAAAGAGG - Intergenic
1196161919 X:112494649-112494671 AAACCAGAAGACCCCAACAAAGG - Intergenic
1199321791 X:146448087-146448109 AAAACAGGACACCCCAAAAGGGG + Intergenic
1199356383 X:146867919-146867941 AAAACAGAACACCCCAAAAGGGG + Intergenic
1200960821 Y:8994284-8994306 CCACCAGCGCACCCCCACAGAGG - Intergenic