ID: 960023821

View in Genome Browser
Species Human (GRCh38)
Location 3:112986750-112986772
Sequence TTGTAGGCCTAGATAGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960023821_960023828 29 Left 960023821 3:112986750-112986772 CCCCTACCTATCTAGGCCTACAA No data
Right 960023828 3:112986802-112986824 TCCATAAGCTTGAAACCTATAGG No data
960023821_960023826 4 Left 960023821 3:112986750-112986772 CCCCTACCTATCTAGGCCTACAA No data
Right 960023826 3:112986777-112986799 TACCTTCTTCATGTCTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960023821 Original CRISPR TTGTAGGCCTAGATAGGTAG GGG (reversed) Intergenic
No off target data available for this crispr