ID: 960025020

View in Genome Browser
Species Human (GRCh38)
Location 3:112998864-112998886
Sequence CAGGAATATCTGGTGGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960025015_960025020 6 Left 960025015 3:112998835-112998857 CCAGGAAATTTAATTTTACAGAA 0: 1
1: 1
2: 9
3: 61
4: 568
Right 960025020 3:112998864-112998886 CAGGAATATCTGGTGGATTAAGG 0: 1
1: 0
2: 1
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960025020 Original CRISPR CAGGAATATCTGGTGGATTA AGG Intronic
900387353 1:2416668-2416690 CAGGAAGTGCTGGTGGATGAAGG + Intergenic
901430409 1:9210711-9210733 CAGTAATATCTGCTGGATATGGG + Intergenic
902838401 1:19060600-19060622 CAGGAATCTGTGGTGGAGTGGGG - Intergenic
902895572 1:19477488-19477510 CAGAAGGATGTGGTGGATTAAGG + Intronic
907869199 1:58427578-58427600 CAGCAGTATCTGCTGGATTTTGG + Intronic
907961149 1:59283163-59283185 CAGGCATATGTGGTGGAATGTGG - Intergenic
908489732 1:64631560-64631582 CAGGAAAATCTAGTGTTTTAAGG + Intronic
910442268 1:87265182-87265204 CTGAAACATCTGGTGGATAAAGG - Intergenic
911153169 1:94614773-94614795 CAGAAATAGATGGTGGGTTAAGG - Intergenic
915937128 1:160096152-160096174 CAGGAGTATCTGCTGGGGTAGGG - Intronic
916605291 1:166336297-166336319 CAGGAAGAGCTGGAGAATTATGG - Intergenic
916739023 1:167632011-167632033 CAGGAAGCTCTGGCAGATTAGGG + Intronic
919562086 1:199134292-199134314 CAGGAATGTCTTGTGATTTAAGG - Intergenic
923070623 1:230561397-230561419 CAGGAATGTTTGGTGAATTGGGG + Intergenic
924120363 1:240791217-240791239 CAGGAATAAGTGGTGTATTTAGG + Intronic
924821039 1:247491109-247491131 CTGTAATAGCTGGTGGATTATGG + Intergenic
1065664110 10:28039790-28039812 AAGGAAGATCTGGTGGAGTTGGG - Intergenic
1067519321 10:46984195-46984217 CAGAAACATCTGGTAGATAAAGG - Intronic
1067642926 10:48067644-48067666 CAGAAACATCTGGTAGATAAAGG + Intergenic
1068028369 10:51677520-51677542 CAGGAATATCTGGTTCAGAATGG + Intronic
1069458602 10:68573514-68573536 CAGGAATCTCTGGTAGATCTGGG - Exonic
1072621792 10:97084509-97084531 CAGTCATAGCTGGTGGTTTAAGG + Intronic
1072847804 10:98851645-98851667 GAGAAATATGTGTTGGATTAGGG - Intronic
1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG + Intergenic
1074965141 10:118484057-118484079 CATGCATTTCTGGTGGATCAAGG + Intergenic
1081253541 11:40864637-40864659 CAGACATACCTAGTGGATTAAGG + Intronic
1084515832 11:69637582-69637604 AGGGAATCTCTGGTGGATTTGGG + Intergenic
1087280120 11:96200634-96200656 CAGGAAGACATGGTGGATTGAGG - Intronic
1094394965 12:29995809-29995831 CAGGAAAATCAGGTGGGTTGGGG - Intergenic
1096621996 12:52870889-52870911 CAGGAATATCTGGGGGCTCCAGG + Intergenic
1096893701 12:54798117-54798139 CAGGAATAACGGGTGGGGTAAGG - Intergenic
1097066382 12:56323690-56323712 CAGGGATCTCTGGTGGAGTGAGG - Intronic
1097838741 12:64300655-64300677 CAGGAAGATCTGCTTGTTTAGGG - Intronic
1102767179 12:115443562-115443584 CAGGACTATTTGGTGGATTAAGG + Intergenic
1103649873 12:122423551-122423573 CAGGATTTTGTGGTGGATAAGGG + Intergenic
1106323988 13:28670252-28670274 AAGGAGTATGTGGGGGATTATGG - Intronic
1107846537 13:44519866-44519888 CAGGACTAGATGATGGATTATGG + Intronic
1111601243 13:90477746-90477768 CAGGAATATGAGGTGTGTTATGG + Intergenic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1113099877 13:106705683-106705705 CAGGAACATGTAGTGGATTCAGG + Intergenic
1115525502 14:34276190-34276212 CATGACTCTCTAGTGGATTAAGG - Intronic
1116893452 14:50292387-50292409 CCTGAATATCTGGTAGAGTAAGG - Intronic
1117084971 14:52190839-52190861 CAGGAATATCTGAGATATTATGG - Intergenic
1117743473 14:58843502-58843524 CAGAAATCTCTGGTGGTTTCTGG - Intergenic
1117771170 14:59135970-59135992 CATGAAGAGCTGGTGGATGAAGG - Intergenic
1129327162 15:74806708-74806730 CAGGAGGATGTGGTGGATTTAGG + Intergenic
1131325032 15:91434764-91434786 CAGGAATACCTGGAGGAATCAGG + Intergenic
1141802510 16:86320767-86320789 CAGGAATATCAGAGGAATTATGG - Intergenic
1143948395 17:10614286-10614308 CAGAAATATCTGCTGAATGACGG + Intergenic
1144102247 17:11952041-11952063 CAGGAAGCTCTGGTGGATGATGG + Intronic
1148550608 17:48548462-48548484 CAAGAAAATCTGGCCGATTACGG - Intergenic
1150737521 17:67753158-67753180 CAGGAATTGCTGATGGATGAGGG - Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151632695 17:75321683-75321705 CAGGAATATCTGCTGGTTTCTGG + Exonic
1151636335 17:75351081-75351103 CAGGAAGATCAGGTGGAGAAGGG + Intronic
1155758185 18:29528804-29528826 CAGATATATCTGGTGTATTTGGG + Intergenic
1159412818 18:68104119-68104141 CAGGAATTTCTGGTGTAAAATGG - Intergenic
1159745105 18:72223736-72223758 CAGAAATAACTTGTGGAGTAAGG - Intergenic
1159878169 18:73833169-73833191 GAGGCATCTCTGGTGGATAAGGG - Intergenic
1160548288 18:79676625-79676647 CAGGAATATCAGTTTGATGAGGG + Intergenic
1160763012 19:795299-795321 CAGGAATGTCCGGTGGATCTGGG - Intergenic
927002467 2:18812429-18812451 CAGGAATAGATGGAGGATTTGGG + Intergenic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
937053458 2:118911201-118911223 CTGGAACATCTGCTGGAATAAGG + Intergenic
938805402 2:134802525-134802547 CAGGCATATCTGTAGGATGAGGG - Intergenic
939268022 2:139900732-139900754 CAGGAATATTGTGAGGATTAAGG - Intergenic
941655731 2:168143150-168143172 CAGGAATAACTGGAGGATATGGG + Intronic
942381671 2:175398291-175398313 CAGTGAAATCTGGTGGTTTATGG - Intergenic
945257683 2:207815789-207815811 CAGGACTACGTGGTGGAATAAGG + Intergenic
947904039 2:233746692-233746714 CATAAATATTTGGTGGATAAGGG + Intronic
1169575578 20:6956447-6956469 CAAGAATATCTGGGGTATTTGGG + Intergenic
1173242259 20:41307538-41307560 AAGGAATATTTGGTGGAGAAGGG - Intronic
1173704452 20:45099720-45099742 CAGGGATGACTGGAGGATTAAGG + Intronic
1175529765 20:59666410-59666432 CTGGAATGTCAGGTGGATTCAGG + Intronic
1178129535 21:29555973-29555995 AAGGTATATCTGGTGGAACAGGG - Intronic
1182030149 22:27152611-27152633 CAGGAAAATTTGGTTGATGATGG - Intergenic
1183360658 22:37381497-37381519 CAGAGATCTCAGGTGGATTATGG - Intronic
949153521 3:799741-799763 CAGGACTATCAGGATGATTAAGG + Intergenic
952998619 3:38909339-38909361 CAGGAATCCCTGGAGTATTAGGG - Intronic
954941355 3:54375920-54375942 CAGGAATTGCTCATGGATTAAGG + Intronic
959157251 3:102681993-102682015 AAGGAATATCTGGTAGCCTATGG - Intergenic
960025020 3:112998864-112998886 CAGGAATATCTGGTGGATTAAGG + Intronic
962989111 3:140562583-140562605 CAGAAACATCTGGAAGATTAAGG + Intronic
963453394 3:145514490-145514512 CAGAAATATATGGTGAATAAAGG - Intergenic
965485908 3:169278227-169278249 CAGGAATGTCAGGAGGCTTAAGG - Intronic
965998105 3:174911700-174911722 CAGGAATATAAGGTGTACTAGGG - Intronic
966068452 3:175845004-175845026 CAGGAATATCTGATTGACTGAGG + Intergenic
967272478 3:187742880-187742902 CAGGAATAGCGTGTGGACTAGGG + Intronic
975093212 4:70426948-70426970 TAGGAATGTCTGTGGGATTAAGG - Intergenic
980582433 4:134772365-134772387 CATGAATCTCTGGTTGATTCAGG + Intergenic
980689725 4:136279825-136279847 AAGGAATATATGGTCTATTATGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984749324 4:183256730-183256752 CAGGAATATGTTGGGGAATACGG - Intronic
987196677 5:15533789-15533811 AAGGAATATAGGGAGGATTAGGG + Intronic
989986929 5:50711703-50711725 CAGAAATGTATGTTGGATTATGG - Intronic
990746934 5:58968056-58968078 CAGGAATATATGCTGGTTTGGGG - Intergenic
999527350 5:152422024-152422046 CAGAAAAATGTGGTGGATTATGG + Intronic
999627353 5:153534762-153534784 TAAGAATGGCTGGTGGATTAGGG - Intronic
1001694192 5:173657794-173657816 CATGAATATCTGTTGAATAAGGG + Intergenic
1002328226 5:178423917-178423939 CTGGATTATCTGCTGGATTAGGG - Intronic
1003233604 6:4276284-4276306 CAGGAATGGCTTGTGGATTCAGG - Intergenic
1005094602 6:22100814-22100836 AAAGAATATCTGATGGAATATGG - Intergenic
1010185937 6:73143213-73143235 CAGGAATTTCTGGAAGCTTAAGG + Intronic
1019614138 7:1951269-1951291 CAGGACCAGCTGGTGGATGAAGG + Intronic
1021739516 7:23671782-23671804 CATGAATCTCTGATGGTTTATGG - Intergenic
1023092087 7:36626676-36626698 CAGGGATAGCAGGTGGGTTATGG + Intronic
1030284171 7:107808618-107808640 CCAGACTATCTAGTGGATTAAGG - Intergenic
1030779402 7:113580544-113580566 CAGAAATTTTTGGTGGCTTAAGG - Intergenic
1030964449 7:115972065-115972087 CAAGAATAGCTGGTAGAATAGGG - Intronic
1031924224 7:127622769-127622791 AAGTAATAGATGGTGGATTATGG - Intergenic
1031957142 7:127954166-127954188 CAGAAATATTTGCTGGAGTAAGG - Intronic
1032140105 7:129321366-129321388 CAGGAATGGATGGTGGATTTTGG + Intronic
1032847910 7:135767716-135767738 CAGGTAAATTTGGTGGATTTGGG + Intergenic
1032877603 7:136054226-136054248 CTAAAATATCTGGTGGTTTAAGG + Intergenic
1033546842 7:142409008-142409030 CAGGAATATCTAATGCACTAAGG - Intergenic
1034297104 7:149983792-149983814 CAGGATTTTCTGCTGTATTAAGG - Intergenic
1034808923 7:154113046-154113068 CAGGATTTTCTGCTGTATTAAGG + Intronic
1037772346 8:21809945-21809967 AAGCAACATCTGGTGGCTTAAGG - Intronic
1038243734 8:25834470-25834492 CAAGGGTATCTGGTGGATTTTGG - Intergenic
1040859822 8:51987471-51987493 CAGGAATAACTGTTGCAATAGGG - Intergenic
1042813149 8:72847778-72847800 CTGGAATATCTGGGATATTATGG - Intronic
1055106019 9:72513917-72513939 CAGGTTTGTCTGGTGGATTTGGG + Intergenic
1055172609 9:73277799-73277821 CAGAAATAAGTGGTGGATCATGG - Intergenic
1056692131 9:88816637-88816659 CAGGTATATCAGGTGTACTAGGG + Intergenic
1061474526 9:130855353-130855375 GAGGAATATCTGTTGGGTTTTGG + Intronic
1188926940 X:36055282-36055304 CAGGAATAGCTAATGGATAATGG - Intronic
1199533536 X:148876697-148876719 CAGGGATGTCTGGTGGTGTAGGG + Intronic
1199949615 X:152697960-152697982 CAGGAAAATTTGGTTGGTTAAGG + Intergenic
1199960060 X:152770501-152770523 CAGGAAAATTTGGTTGGTTAAGG - Intergenic