ID: 960029494

View in Genome Browser
Species Human (GRCh38)
Location 3:113043014-113043036
Sequence GGATGAATTCTGCTTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960029494_960029497 -8 Left 960029494 3:113043014-113043036 CCAGCAAAAAGCAGAATTCATCC No data
Right 960029497 3:113043029-113043051 ATTCATCCCACATGGTTCAAGGG No data
960029494_960029496 -9 Left 960029494 3:113043014-113043036 CCAGCAAAAAGCAGAATTCATCC No data
Right 960029496 3:113043028-113043050 AATTCATCCCACATGGTTCAAGG No data
960029494_960029502 28 Left 960029494 3:113043014-113043036 CCAGCAAAAAGCAGAATTCATCC No data
Right 960029502 3:113043065-113043087 CAGAGATATAGGCAGGATGAAGG No data
960029494_960029500 17 Left 960029494 3:113043014-113043036 CCAGCAAAAAGCAGAATTCATCC No data
Right 960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG No data
960029494_960029501 21 Left 960029494 3:113043014-113043036 CCAGCAAAAAGCAGAATTCATCC No data
Right 960029501 3:113043058-113043080 CTGCTTACAGAGATATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960029494 Original CRISPR GGATGAATTCTGCTTTTTGC TGG (reversed) Intergenic
No off target data available for this crispr