ID: 960029498

View in Genome Browser
Species Human (GRCh38)
Location 3:113043035-113043057
Sequence CTTCTTCCCTTGAACCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960029498_960029503 19 Left 960029498 3:113043035-113043057 CCCACATGGTTCAAGGGAAGAAG No data
Right 960029503 3:113043077-113043099 CAGGATGAAGGCATCAAAAATGG No data
960029498_960029500 -4 Left 960029498 3:113043035-113043057 CCCACATGGTTCAAGGGAAGAAG No data
Right 960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG No data
960029498_960029504 29 Left 960029498 3:113043035-113043057 CCCACATGGTTCAAGGGAAGAAG No data
Right 960029504 3:113043087-113043109 GCATCAAAAATGGAATCGTGAGG No data
960029498_960029502 7 Left 960029498 3:113043035-113043057 CCCACATGGTTCAAGGGAAGAAG No data
Right 960029502 3:113043065-113043087 CAGAGATATAGGCAGGATGAAGG No data
960029498_960029501 0 Left 960029498 3:113043035-113043057 CCCACATGGTTCAAGGGAAGAAG No data
Right 960029501 3:113043058-113043080 CTGCTTACAGAGATATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960029498 Original CRISPR CTTCTTCCCTTGAACCATGT GGG (reversed) Intergenic
No off target data available for this crispr