ID: 960029499

View in Genome Browser
Species Human (GRCh38)
Location 3:113043036-113043058
Sequence GCTTCTTCCCTTGAACCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960029499_960029500 -5 Left 960029499 3:113043036-113043058 CCACATGGTTCAAGGGAAGAAGC No data
Right 960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG No data
960029499_960029501 -1 Left 960029499 3:113043036-113043058 CCACATGGTTCAAGGGAAGAAGC No data
Right 960029501 3:113043058-113043080 CTGCTTACAGAGATATAGGCAGG No data
960029499_960029504 28 Left 960029499 3:113043036-113043058 CCACATGGTTCAAGGGAAGAAGC No data
Right 960029504 3:113043087-113043109 GCATCAAAAATGGAATCGTGAGG No data
960029499_960029503 18 Left 960029499 3:113043036-113043058 CCACATGGTTCAAGGGAAGAAGC No data
Right 960029503 3:113043077-113043099 CAGGATGAAGGCATCAAAAATGG No data
960029499_960029502 6 Left 960029499 3:113043036-113043058 CCACATGGTTCAAGGGAAGAAGC No data
Right 960029502 3:113043065-113043087 CAGAGATATAGGCAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960029499 Original CRISPR GCTTCTTCCCTTGAACCATG TGG (reversed) Intergenic
No off target data available for this crispr