ID: 960029500

View in Genome Browser
Species Human (GRCh38)
Location 3:113043054-113043076
Sequence GAAGCTGCTTACAGAGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960029498_960029500 -4 Left 960029498 3:113043035-113043057 CCCACATGGTTCAAGGGAAGAAG No data
Right 960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG No data
960029494_960029500 17 Left 960029494 3:113043014-113043036 CCAGCAAAAAGCAGAATTCATCC No data
Right 960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG No data
960029499_960029500 -5 Left 960029499 3:113043036-113043058 CCACATGGTTCAAGGGAAGAAGC No data
Right 960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960029500 Original CRISPR GAAGCTGCTTACAGAGATAT AGG Intergenic
No off target data available for this crispr