ID: 960036123

View in Genome Browser
Species Human (GRCh38)
Location 3:113104805-113104827
Sequence GCTGGGCTACAGATGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960036112_960036123 21 Left 960036112 3:113104761-113104783 CCTCTGTCGGTTTAGGTTATTCA No data
Right 960036123 3:113104805-113104827 GCTGGGCTACAGATGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960036123 Original CRISPR GCTGGGCTACAGATGGAGAG GGG Intergenic
No off target data available for this crispr