ID: 960036190

View in Genome Browser
Species Human (GRCh38)
Location 3:113105174-113105196
Sequence CAGCTTCAGCCCAGGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960036190_960036197 4 Left 960036190 3:113105174-113105196 CCAGAGCCCCTGGGCTGAAGCTG No data
Right 960036197 3:113105201-113105223 GATATCATTCAAAAACCACTGGG No data
960036190_960036198 11 Left 960036190 3:113105174-113105196 CCAGAGCCCCTGGGCTGAAGCTG No data
Right 960036198 3:113105208-113105230 TTCAAAAACCACTGGGTTGCAGG No data
960036190_960036196 3 Left 960036190 3:113105174-113105196 CCAGAGCCCCTGGGCTGAAGCTG No data
Right 960036196 3:113105200-113105222 GGATATCATTCAAAAACCACTGG No data
960036190_960036201 21 Left 960036190 3:113105174-113105196 CCAGAGCCCCTGGGCTGAAGCTG No data
Right 960036201 3:113105218-113105240 ACTGGGTTGCAGGGTTTGTGTGG No data
960036190_960036199 12 Left 960036190 3:113105174-113105196 CCAGAGCCCCTGGGCTGAAGCTG No data
Right 960036199 3:113105209-113105231 TCAAAAACCACTGGGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960036190 Original CRISPR CAGCTTCAGCCCAGGGGCTC TGG (reversed) Intergenic
No off target data available for this crispr