ID: 960045765

View in Genome Browser
Species Human (GRCh38)
Location 3:113196355-113196377
Sequence CAGAGTTGCCTCTATAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960045765_960045771 26 Left 960045765 3:113196355-113196377 CCAAGCTTATAGAGGCAACTCTG No data
Right 960045771 3:113196404-113196426 CTGTGAGGCCTCTGACATACAGG No data
960045765_960045770 11 Left 960045765 3:113196355-113196377 CCAAGCTTATAGAGGCAACTCTG No data
Right 960045770 3:113196389-113196411 CTCTATTTAGGATGTCTGTGAGG No data
960045765_960045768 -1 Left 960045765 3:113196355-113196377 CCAAGCTTATAGAGGCAACTCTG No data
Right 960045768 3:113196377-113196399 GGAACTGGACCTCTCTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960045765 Original CRISPR CAGAGTTGCCTCTATAAGCT TGG (reversed) Intergenic
No off target data available for this crispr