ID: 960046951

View in Genome Browser
Species Human (GRCh38)
Location 3:113208391-113208413
Sequence CAAAACAGTTAGGTGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960046951_960046958 6 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046958 3:113208420-113208442 CTAGAGATGCTGGAATGGGTTGG No data
960046951_960046960 8 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046960 3:113208422-113208444 AGAGATGCTGGAATGGGTTGGGG No data
960046951_960046962 12 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046962 3:113208426-113208448 ATGCTGGAATGGGTTGGGGTGGG No data
960046951_960046961 11 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046961 3:113208425-113208447 GATGCTGGAATGGGTTGGGGTGG No data
960046951_960046957 2 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046957 3:113208416-113208438 ATGGCTAGAGATGCTGGAATGGG No data
960046951_960046955 -4 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046955 3:113208410-113208432 TTTGAAATGGCTAGAGATGCTGG No data
960046951_960046956 1 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046956 3:113208415-113208437 AATGGCTAGAGATGCTGGAATGG No data
960046951_960046959 7 Left 960046951 3:113208391-113208413 CCAGACTCCACCTAACTGTTTTG No data
Right 960046959 3:113208421-113208443 TAGAGATGCTGGAATGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960046951 Original CRISPR CAAAACAGTTAGGTGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr