ID: 960047537

View in Genome Browser
Species Human (GRCh38)
Location 3:113212159-113212181
Sequence CCGGGTCCCAGCGCTCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960047529_960047537 2 Left 960047529 3:113212134-113212156 CCGGGGGACGTGCCGGCGGCGGG 0: 1
1: 0
2: 2
3: 14
4: 228
Right 960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 213
960047533_960047537 -10 Left 960047533 3:113212146-113212168 CCGGCGGCGGGAGCCGGGTCCCA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 213
960047525_960047537 16 Left 960047525 3:113212120-113212142 CCAGCGAGTGGCTGCCGGGGGAC 0: 1
1: 0
2: 2
3: 10
4: 118
Right 960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 213
960047520_960047537 27 Left 960047520 3:113212109-113212131 CCGAGGCAGCGCCAGCGAGTGGC 0: 1
1: 0
2: 2
3: 22
4: 158
Right 960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960047537 Original CRISPR CCGGGTCCCAGCGCTCGGCC GGG Intronic
900092185 1:925318-925340 CCGGGTGCGAGCGCGCGGCGGGG + Intronic
900110183 1:1001965-1001987 CCCGGGCCCAGCGCTCAGGCCGG - Intergenic
900113649 1:1019875-1019897 CCGGGACGCAGCGCCCGGCGCGG - Intergenic
900421436 1:2557544-2557566 CCGGGCTCCAGCGGTCGGCAAGG + Intronic
900589810 1:3454590-3454612 CCGGGTCCGAGGGCCCGGGCGGG - Exonic
900634848 1:3657949-3657971 CCGGGCCCCAGCCCTGGACCTGG + Intronic
901063774 1:6485528-6485550 CGGGGTCCCCGCGCTCGGCGGGG - Intronic
901084681 1:6603153-6603175 CCCGGTCCCGGCGCGCGGCGAGG - Intronic
903182344 1:21611352-21611374 CCAGGGCCCAGCGCTGAGCCTGG + Intronic
903187045 1:21634636-21634658 CCGGATCCCGGAGCTGGGCCAGG + Intronic
903366776 1:22810279-22810301 CAGGGGCCCTGGGCTCGGCCAGG + Intronic
903628228 1:24745980-24746002 CCGGGCCCCGGCGCCCGGGCGGG - Intronic
904847448 1:33430841-33430863 TCGGGCCGGAGCGCTCGGCCGGG - Intronic
905446073 1:38029216-38029238 CAGGTCCCCAGAGCTCGGCCTGG + Intergenic
906524515 1:46486359-46486381 CAGGGTCCCAGCTGTCTGCCCGG - Intergenic
906805564 1:48776552-48776574 CGGGGTCCCAGCCCCCGCCCGGG + Intronic
907239211 1:53071368-53071390 CCCGGTGCCAGCTCTGGGCCAGG - Intronic
907305723 1:53511931-53511953 CCGGTGCCCAGCGCTGGGCATGG + Intronic
907364371 1:53946568-53946590 CCGGGGCCCCGCGAGCGGCCCGG - Intronic
909001412 1:70221673-70221695 CCGGGCCCCAGCGGCGGGCCCGG + Exonic
910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG + Intergenic
913578124 1:120197407-120197429 CCGGGCCCCAGCCCTCCGCGCGG - Intergenic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
916963199 1:169909755-169909777 CCCGGTCCCGGTGCACGGCCGGG + Intergenic
919878751 1:201888895-201888917 GCGGGGCCCAGCCCGCGGCCAGG - Exonic
920674603 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG + Intronic
921315023 1:213882247-213882269 CCGAGTCCCAGCCCTCTGCTTGG - Intergenic
922811201 1:228416574-228416596 CCGGCAGCGAGCGCTCGGCCAGG - Intronic
924602151 1:245500686-245500708 CCGGGGCCCAGCCCTCGCCCTGG - Intronic
1065968081 10:30784953-30784975 GCGGGTCCCCGAGCTCGCCCGGG + Intergenic
1067077883 10:43198352-43198374 CCTGGCCCCAGGGCTCAGCCAGG - Intronic
1067343558 10:45422404-45422426 CCAGGACCCAGTGCTCTGCCTGG - Intronic
1070819729 10:79347786-79347808 CCGGGGCCCAGGGCTCTCCCCGG - Intronic
1071500865 10:86203509-86203531 CCGGTGCCCAGTGCTCGTCCTGG - Intronic
1073240758 10:102056203-102056225 CCGTGTCCCCGCGCCCCGCCGGG + Intergenic
1075087693 10:119424408-119424430 CAGCATCCCAGGGCTCGGCCTGG + Intronic
1076673264 10:132134652-132134674 CCAGCTCCCAGCCCTCTGCCTGG - Intronic
1077194591 11:1272771-1272793 CCGGATCCCTGGGCCCGGCCTGG - Intergenic
1080457684 11:32430886-32430908 CCTGGGCCCAGCGCTTGGCCTGG + Intronic
1082001256 11:47394796-47394818 CAGGGTCACAGCGCCCAGCCTGG + Intergenic
1083717129 11:64583894-64583916 CCGTGTCCCAGCTCTCCACCTGG + Intergenic
1083777745 11:64902471-64902493 CAGGCTACCAGAGCTCGGCCAGG - Intronic
1083940092 11:65891101-65891123 CCAGGTCCTCGCGCACGGCCCGG - Exonic
1084072237 11:66744301-66744323 CTGGGACCCAGGGCTTGGCCTGG + Intergenic
1085056098 11:73404943-73404965 CCGGCACCCAGCGCTTGGCTGGG - Intronic
1086337082 11:85811004-85811026 CTGGCCCCCAGCCCTCGGCCTGG + Exonic
1087138152 11:94740634-94740656 CCGCGGCCCAGCGCCCGGCCGGG + Intronic
1089451321 11:118599371-118599393 GCGAGTCACCGCGCTCGGCCCGG + Intronic
1090780507 11:130002586-130002608 CCGCGTCTCAGAGCCCGGCCGGG - Intronic
1095094362 12:38137899-38137921 CCGGTTCCCGGCGCACGGCGAGG - Intergenic
1095752887 12:45729989-45730011 CCGGGACCCCGTGCCCGGCCCGG - Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096389631 12:51218194-51218216 CCGGGACCTCCCGCTCGGCCAGG - Intergenic
1099973593 12:89524921-89524943 CCGGCCCCCAGCCCCCGGCCCGG - Intronic
1100385566 12:94102052-94102074 GCGGGTCCCGGCTCTCGGCCTGG - Intergenic
1101592944 12:106139340-106139362 CCGGGGCCGGTCGCTCGGCCTGG + Exonic
1102913850 12:116738222-116738244 CCGGGTCCTAGCGCCGGACCCGG + Intronic
1103012025 12:117465181-117465203 CTGTGTCCCAGCCCTGGGCCTGG - Exonic
1103929383 12:124441191-124441213 GCTGATTCCAGCGCTCGGCCAGG + Intronic
1104259050 12:127166115-127166137 CCTGGTCCCAGCGCGGGGCGGGG + Intergenic
1104847105 12:131852170-131852192 CCAGGTCCCGGTGCTCGGCCGGG - Intergenic
1106735932 13:32587179-32587201 CCGGGTCCCCGCGCGCCGCCTGG + Intronic
1111396195 13:87672314-87672336 GCGGGTGCGAGCGCTCGGCGGGG + Intergenic
1111951427 13:94712085-94712107 CCGGGCCCTCGCCCTCGGCCCGG + Exonic
1113473149 13:110561248-110561270 CCGGGACCCTGTGCGCGGCCGGG + Intronic
1113837527 13:113338153-113338175 CCGGGACCCATCGCCCGCCCGGG + Intronic
1118752345 14:68816419-68816441 CCCGGGCCCCGCGCCCGGCCCGG - Intergenic
1120263302 14:82216235-82216257 CCAGATCCCAGAGCTCAGCCTGG + Intergenic
1121049625 14:90812003-90812025 CCAGGTCCCAGCTGTCAGCCTGG - Intronic
1121452752 14:94019895-94019917 CCGGGTCTCCGAGCTCTGCCAGG - Intergenic
1121775095 14:96585084-96585106 CAGCGTCCCAGCCCTGGGCCAGG + Intergenic
1122569361 14:102684071-102684093 CCTGTTCCTAGCGCTCAGCCGGG - Intronic
1122902420 14:104787329-104787351 CGGGGCCCCAGCGCTGGGCTGGG + Intronic
1122929310 14:104926119-104926141 CTGGGTCCCAGCGCCCAGCCTGG + Intronic
1125534605 15:40436120-40436142 CCGGCTCCGAGCCCGCGGCCTGG - Intergenic
1125999319 15:44194761-44194783 CCGGGTGCCAGGGCTCCGGCAGG + Intronic
1126668589 15:51095341-51095363 GCGGGACCGAGCGCTGGGCCTGG + Intronic
1128982536 15:72197793-72197815 CTGGGTCCCGGCGCGCGGTCGGG - Intergenic
1129116628 15:73368491-73368513 CGGGGTCCCCGCGCCCAGCCGGG - Exonic
1130115419 15:81001393-81001415 CCGGTTCACAGAGCGCGGCCCGG - Exonic
1132275387 15:100559078-100559100 TCGCCTCCCAGCGCGCGGCCCGG + Intergenic
1132588334 16:715693-715715 CCCGATCCCAGAGCGCGGCCCGG + Exonic
1132756344 16:1487283-1487305 CAGGCTCCCAGCTCACGGCCAGG - Intronic
1132809724 16:1791748-1791770 CCAGCTCCCGGAGCTCGGCCAGG + Exonic
1132868078 16:2103686-2103708 GCGGGTCCGAGCGCTTGCCCTGG + Exonic
1132889071 16:2195542-2195564 CCTGGTCCCAGCACTCATCCTGG - Intronic
1134286013 16:12862635-12862657 TCAGTTCCCAGCCCTCGGCCCGG + Intergenic
1134523695 16:14929438-14929460 GCGGGTCCGAGCGCTTGCCCTGG - Intronic
1134549205 16:15131498-15131520 GCGGGTCCGAGCGCTTGCCCTGG + Intronic
1134711286 16:16327923-16327945 GCGGGTCCGAGCGCTTGCCCTGG - Intergenic
1134719138 16:16371225-16371247 GCGGGTCCGAGCGCTTGCCCTGG - Intergenic
1134948289 16:18340660-18340682 GCGGGTCCGAGCGCTTGCCCTGG + Intergenic
1134955543 16:18380770-18380792 GCGGGTCCGAGCGCTTGCCCTGG + Intergenic
1135691292 16:24539837-24539859 CCGGGCCCCAGCCGGCGGCCGGG - Intronic
1135995442 16:27244447-27244469 CCAGGTCCCAGCACTCAGCCTGG + Intronic
1136110817 16:28062947-28062969 CCAGCTCCCAGCGCTCCGCCTGG - Intronic
1136154658 16:28374751-28374773 CTGGGTCCCAGCCCTCTGCAGGG + Intergenic
1136208433 16:28740507-28740529 CTGGGTCCCAGCCCTCTGCAGGG - Intergenic
1136264522 16:29107183-29107205 CTGGGTCCCAGCCCTCTGCAGGG - Intergenic
1138591317 16:58000926-58000948 CCGGGTGACCGCCCTCGGCCCGG + Intronic
1139528486 16:67530259-67530281 CTGGCTCCCAGCGCGCGGCCAGG + Intronic
1140221663 16:73048333-73048355 CCGGGTCCCTGCGGGCGGGCGGG - Exonic
1141833534 16:86523258-86523280 CAGGGTCCCAGACCTAGGCCAGG - Intergenic
1142272646 16:89098607-89098629 CCGGGTTCCAGCGCCAGGCCTGG + Exonic
1142620944 17:1165418-1165440 CCAGGTCCCAGCGCCAGGCAGGG - Intronic
1142638285 17:1270977-1270999 CGGTGTCCCCGCGCGCGGCCGGG - Exonic
1144672187 17:17139078-17139100 CCTGGTCCCTGCCCTAGGCCCGG - Intronic
1144708307 17:17384392-17384414 CCGGGTTCCAGCACTCCTCCTGG + Intergenic
1144847009 17:18225435-18225457 CTGGGCCCCCGGGCTCGGCCGGG - Intergenic
1145935272 17:28711432-28711454 GCGGGGCCCAGTGCTGGGCCGGG - Intronic
1146896651 17:36545884-36545906 CCAGTGCGCAGCGCTCGGCCTGG - Intronic
1147990699 17:44331071-44331093 CTGGGTCCCAGAGCTCTGCTGGG + Intergenic
1148864803 17:50622934-50622956 CCAGGTCCCAGCACAGGGCCTGG - Intronic
1150003623 17:61456538-61456560 CCCGGGCCCAGCGCTCGGAGAGG + Exonic
1151242090 17:72766124-72766146 CAGGGTCCCAGCTCTAGACCAGG + Intronic
1151379786 17:73717739-73717761 CAGCCTCCCAGCGCTGGGCCTGG + Intergenic
1151903817 17:77035003-77035025 CCTGATCCCAGGGCTGGGCCTGG - Intergenic
1152194608 17:78909821-78909843 CTGGGTCACAGTGCCCGGCCTGG - Intronic
1152786090 17:82248838-82248860 CCGAGGCCCAGCGCCCGCCCGGG + Intronic
1154202231 18:12307892-12307914 CGGGGTCCCAGCGCCGCGCCCGG - Intronic
1155154425 18:23146395-23146417 CCGGGTTCAAGCGATTGGCCAGG + Intronic
1157610102 18:48950613-48950635 CCGGGCCCCCGCGCGCGCCCCGG - Exonic
1158435866 18:57435455-57435477 CCGGGCCCCGCCGCTCGGGCCGG - Intergenic
1160453551 18:78980498-78980520 CCGGGGCCCCGCGGCCGGCCTGG - Intronic
1160528252 18:79549497-79549519 CCGGGACCCAGAGCCTGGCCGGG - Intergenic
1160769089 19:822246-822268 CCGGGTGGCTGCGGTCGGCCCGG + Intergenic
1160872982 19:1285595-1285617 CCGGGACCCAGGGCCGGGCCGGG + Intergenic
1161091603 19:2363016-2363038 CAGGGTCCCAGCGCTCAGGCTGG + Intergenic
1161222232 19:3123042-3123064 CCGGGCCCCAGCACTCGCCATGG - Exonic
1161266456 19:3366797-3366819 CCGGACCCCAGCCCTCGGCGCGG - Intronic
1161394558 19:4038263-4038285 CCGGGTCCCCGCGCACTGGCTGG - Exonic
1162778672 19:12995688-12995710 CCGCGGCCCCGCGCTCGGCCCGG - Exonic
1163086022 19:14979983-14980005 CCTGTTCCCCGCGCTCCGCCAGG - Intronic
1163113803 19:15177730-15177752 GCTGGTCCCCGCGCTTGGCCTGG + Exonic
1165455478 19:35908117-35908139 CCGGGTCCCTGGGCTCAGCTTGG - Intronic
1166315701 19:41988289-41988311 CAGGGTCCCAGCCCACAGCCTGG + Intronic
1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG + Intronic
1167456107 19:49597318-49597340 CCGGCTCCCGACGCCCGGCCAGG - Exonic
1167741666 19:51327686-51327708 CCGGGCCGCAGCGCCCAGCCAGG - Intronic
1168103719 19:54154227-54154249 CCAGGTCCCAGCACTCAGCAGGG + Intronic
925401252 2:3575047-3575069 CCTCGTCCCAGCCCTGGGCCTGG - Intergenic
926284987 2:11481964-11481986 CCCGGTCACCGCGCTCGGTCGGG + Intergenic
927824459 2:26298546-26298568 CCGCGTCCCAGTGCCCTGCCCGG + Intergenic
928126530 2:28620431-28620453 CCAGGTCCCAGCGCTGAGACAGG + Intronic
929789831 2:45014203-45014225 CCGGGCCCCATGGCTCCGCCGGG + Intergenic
932398939 2:71466523-71466545 GCGGGTCCCAGCTCCCGGCCAGG - Intronic
934762474 2:96864242-96864264 CCTGTACCCAGCCCTCGGCCTGG - Exonic
936083923 2:109453651-109453673 CCGTGTGCCTGCGCTCTGCCAGG - Intronic
936104764 2:109614552-109614574 CCCGGCCCCCGCGCTCCGCCAGG - Exonic
937121731 2:119445179-119445201 CCGGGTCCAAGCTCTCAGCATGG + Intronic
937221500 2:120345295-120345317 CCGGCGCCCCGCGCCCGGCCGGG + Intergenic
942046044 2:172100197-172100219 CCGGGACCCAGCTCTCAGCCCGG + Exonic
942503105 2:176612862-176612884 CCGTGTGCCAGCACTGGGCCAGG + Intergenic
943247328 2:185472957-185472979 CTGGCTCCCAGCACCCGGCCTGG + Intergenic
946702086 2:222424430-222424452 CCGGGTCCTAGCGCCCGCCCAGG - Intergenic
948843599 2:240672420-240672442 GCGGGACCCAGCCCTCGTCCTGG + Intergenic
1172974417 20:38895513-38895535 CCGGGGCCCAGTGCCCTGCCTGG + Intronic
1173737942 20:45374967-45374989 CTGGGGCCCAGCTCTGGGCCTGG + Intronic
1174156818 20:48521167-48521189 CCGGGTCCCAGGGCTTCTCCTGG - Intergenic
1174585455 20:51604713-51604735 GGGGTTCCCAGCGCTCGGCCTGG - Intronic
1174736892 20:52973232-52973254 GCGGGCCCCAGCGCGCGGCTCGG + Exonic
1175764261 20:61581956-61581978 GAGGGTCCCAGCGTTCGGCATGG + Intronic
1176135351 20:63520049-63520071 CCGGGCCCCAGGGCCCTGCCGGG + Intergenic
1176190803 20:63808638-63808660 CCTCGGTCCAGCGCTCGGCCAGG + Intronic
1176550443 21:8218711-8218733 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1176569372 21:8401750-8401772 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1176577285 21:8445981-8446003 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1179265172 21:39796633-39796655 CTGGGCCCCAGCTCTGGGCCTGG - Intronic
1179511850 21:41878898-41878920 CCGCGGCCCCGCGCTGGGCCTGG + Intronic
1180857688 22:19058741-19058763 CTGGGTCCCAGGACTCTGCCCGG - Intronic
1181094319 22:20495515-20495537 CCGGGATCTGGCGCTCGGCCAGG - Intronic
1181265412 22:21628328-21628350 CCAGGTCCCAGCTCTGGGCTGGG + Exonic
1182318973 22:29466097-29466119 CTGGGCCCCAGGGCTCTGCCTGG - Intergenic
1183348085 22:37318936-37318958 CCAGAGCCCAGCGCCCGGCCTGG - Intergenic
1183481365 22:38067263-38067285 CCATGTCACAGCGCTCAGCCTGG + Intronic
1183525084 22:38317787-38317809 CAGGGGCCCAGTGCTCTGCCTGG - Intronic
1184467759 22:44678832-44678854 CTGGGTCCCAGGGCTCAGCTGGG + Intronic
1184729335 22:46364361-46364383 CCGGGTCCCAGGGCTAGGCCAGG + Intronic
1184733132 22:46381862-46381884 CGGGGTCGTAGCGCTCGGGCAGG + Exonic
1184773120 22:46609618-46609640 CTGGGGCCCAGCACACGGCCTGG - Intronic
1185297486 22:50061544-50061566 CCGGGTGGCAGCGCCCAGCCTGG - Exonic
1203255339 22_KI270733v1_random:135050-135072 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
950433907 3:12967473-12967495 CTGGGTCCCGGCTCCCGGCCCGG - Exonic
954803205 3:53199326-53199348 CCGGGTCCCCACCCTCGGCTGGG - Intergenic
956678132 3:71754017-71754039 CCGGGGCGGAGCGCACGGCCTGG + Intronic
960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG + Intronic
960747758 3:120908604-120908626 CCGCGCCTCAGCGCTGGGCCTGG + Intronic
962676764 3:137763681-137763703 CAGGGTCCCAGCGCTACGCCCGG + Intergenic
968819979 4:2843426-2843448 CCGGGCCCCAAAACTCGGCCTGG + Intergenic
969264932 4:6058052-6058074 CCAGGTACCAGCACTGGGCCTGG + Intronic
969455751 4:7298791-7298813 CAGGGGCCCAGCACCCGGCCTGG - Intronic
969580330 4:8061106-8061128 CTGGGTCCCAGCGCCCGGCATGG + Intronic
969778925 4:9381128-9381150 CCGGGTGCCCCCGCTGGGCCCGG - Intergenic
971257891 4:25030734-25030756 CCGGGTCCGAGCGCGCGGCGCGG - Exonic
977607409 4:98996171-98996193 CCGGTTCCCCGCGCTGGGGCGGG + Intronic
980920773 4:139083852-139083874 CCCGCTGCCAGCGCTCAGCCCGG + Intronic
992828154 5:80569742-80569764 CCGGTTCCCGCCGCTCGGCGAGG + Intronic
1002466347 5:179410742-179410764 CCAGGGCCCAGTGCTTGGCCGGG + Intergenic
1003661206 6:8064170-8064192 CCGGGACCCGGGGGTCGGCCCGG + Intronic
1003985180 6:11428049-11428071 CCGGGTCCCTGTGCTCAGTCCGG + Intergenic
1007509550 6:42364712-42364734 CCGGGTCCCTGCTCTGGACCAGG + Intronic
1013556230 6:111259651-111259673 CCCGGTCCCACCGCTCTGCCAGG - Exonic
1017174956 6:151494095-151494117 CCGGGTCCGAGCGCGCCCCCGGG + Exonic
1018016062 6:159713356-159713378 CCAGGTCCCAGTGATAGGCCAGG - Intronic
1019331852 7:464179-464201 CTGGGTCCCAGCGCTGGGGAAGG + Intergenic
1022363411 7:29685208-29685230 TCGGGGCACAGCGCGCGGCCCGG - Intergenic
1022697965 7:32728530-32728552 TCGGGGCACAGCGCGCGGCCCGG + Intergenic
1029745059 7:102512145-102512167 ACGGGTCCCCGCCCTCAGCCCGG + Intronic
1029763051 7:102611306-102611328 ACGGGTCCCCGCCCTCAGCCCGG + Intronic
1034223074 7:149460414-149460436 CCGGGGCCCAGCTCGCCGCCGGG - Intronic
1049329720 8:142043741-142043763 CCGGCTCCCGGGGCTTGGCCTGG - Intergenic
1049396378 8:142403015-142403037 CCGGGGACCAGCGCGGGGCCCGG - Intronic
1049399703 8:142419459-142419481 CTGAGTCCCAGAGCTAGGCCTGG + Intergenic
1050546777 9:6716161-6716183 CCGAGTCCCAGCGCGCATCCGGG - Intergenic
1053620533 9:39809803-39809825 CCGGGTCCCAGCGGAGCGCCCGG - Intergenic
1053626171 9:39874131-39874153 CCGGGTCCCAGCGGAGCGCCCGG + Intergenic
1054217717 9:62376570-62376592 CCGGGTCCCAGCGGAGCGCCCGG - Intergenic
1054263627 9:62897640-62897662 CCGGGTCCCAGCGGAGCGCCCGG + Intergenic
1055466512 9:76571805-76571827 CCCGGTCCCGGCGCACGGCGGGG - Intergenic
1057410277 9:94811615-94811637 CTGGGTCCCAGAGCTCAGCAGGG + Intronic
1057883112 9:98808046-98808068 GCGGGTTCCAGCGCTCGGGCAGG - Exonic
1058058705 9:100473797-100473819 CGTGGTCCCTGCGGTCGGCCGGG + Intronic
1059061432 9:111038329-111038351 CCGGGGTCCCGTGCTCGGCCGGG + Intronic
1059208423 9:112487290-112487312 CCGGGTCCCTGCCCTCGCTCCGG - Intronic
1060479975 9:124012184-124012206 CCGGGGCCCGGAGCCCGGCCTGG + Exonic
1060480824 9:124015960-124015982 CCGGGGCGCCGAGCTCGGCCTGG + Intronic
1060718026 9:125952694-125952716 CTGGGTCCCAGCACAAGGCCTGG + Intronic
1060827181 9:126693917-126693939 CCCGGTCCCAGCCCTGGCCCAGG - Intronic
1061108971 9:128553099-128553121 CCCGGTCCCTTCCCTCGGCCGGG + Intronic
1061299293 9:129695552-129695574 CCGGCTCCCAGCTCTGTGCCAGG - Intronic
1061309363 9:129752319-129752341 ACGAGTCCCAGAGCTGGGCCGGG - Intronic
1061620853 9:131810435-131810457 CTGGGTCTCAGTGCTTGGCCAGG + Intergenic
1062024036 9:134332297-134332319 CCGGGTCCCAGGGCAGGGCAGGG + Intronic
1062432392 9:136531969-136531991 CCCAGTCCCAGCGCCCAGCCCGG + Intronic
1062566723 9:137166968-137166990 CTGGGTCCCAGGGCCCTGCCTGG + Intronic
1203788063 EBV:138875-138897 CCGGGCCTCAGCCATCGGCCCGG - Intergenic
1203792884 EBV:161010-161032 CCGCGTCGCAGGCCTCGGCCGGG - Intergenic
1203471737 Un_GL000220v1:118187-118209 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1192180313 X:68912110-68912132 CCGGGCCCCAGCCCTGGCCCAGG + Intergenic
1200239504 X:154486421-154486443 CCGGCTCCCGGCCCTCGGCCCGG + Intronic
1202358834 Y:24082803-24082825 ACAGGTCACCGCGCTCGGCCAGG - Intergenic
1202511944 Y:25587311-25587333 ACAGGTCACCGCGCTCGGCCAGG + Intergenic