ID: 960048998

View in Genome Browser
Species Human (GRCh38)
Location 3:113222962-113222984
Sequence GCCTGTGGCTCTCCAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 288}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960048998_960049001 -10 Left 960048998 3:113222962-113222984 CCTGCCATTGGAGAGCCACAGGC 0: 1
1: 0
2: 2
3: 13
4: 288
Right 960049001 3:113222975-113222997 AGCCACAGGCCGTGGAAGTAAGG 0: 1
1: 0
2: 1
3: 14
4: 122
960048998_960049004 3 Left 960048998 3:113222962-113222984 CCTGCCATTGGAGAGCCACAGGC 0: 1
1: 0
2: 2
3: 13
4: 288
Right 960049004 3:113222988-113223010 GGAAGTAAGGAACTGCACATTGG 0: 1
1: 0
2: 1
3: 14
4: 147
960048998_960049007 20 Left 960048998 3:113222962-113222984 CCTGCCATTGGAGAGCCACAGGC 0: 1
1: 0
2: 2
3: 13
4: 288
Right 960049007 3:113223005-113223027 CATTGGGATGTTCACCCAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 98
960048998_960049008 21 Left 960048998 3:113222962-113222984 CCTGCCATTGGAGAGCCACAGGC 0: 1
1: 0
2: 2
3: 13
4: 288
Right 960049008 3:113223006-113223028 ATTGGGATGTTCACCCAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 87
960048998_960049005 4 Left 960048998 3:113222962-113222984 CCTGCCATTGGAGAGCCACAGGC 0: 1
1: 0
2: 2
3: 13
4: 288
Right 960049005 3:113222989-113223011 GAAGTAAGGAACTGCACATTGGG 0: 1
1: 0
2: 3
3: 26
4: 233
960048998_960049009 22 Left 960048998 3:113222962-113222984 CCTGCCATTGGAGAGCCACAGGC 0: 1
1: 0
2: 2
3: 13
4: 288
Right 960049009 3:113223007-113223029 TTGGGATGTTCACCCAGAGGGGG 0: 1
1: 0
2: 2
3: 13
4: 263
960048998_960049006 19 Left 960048998 3:113222962-113222984 CCTGCCATTGGAGAGCCACAGGC 0: 1
1: 0
2: 2
3: 13
4: 288
Right 960049006 3:113223004-113223026 ACATTGGGATGTTCACCCAGAGG 0: 1
1: 1
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960048998 Original CRISPR GCCTGTGGCTCTCCAATGGC AGG (reversed) Intronic
900400458 1:2470903-2470925 GCCTGGGGCTCTCTGAAGGCAGG - Intronic
900611845 1:3547589-3547611 GCCTGGGGCTGTCCGAAGGCGGG - Intronic
900762318 1:4481647-4481669 TCCAGGGTCTCTCCAATGGCTGG + Intergenic
901275575 1:7988355-7988377 GCCTGTGACTTTCAAATAGCAGG - Intergenic
901337434 1:8463267-8463289 TCCTGAGGCTCTACAAGGGCTGG + Intronic
901373950 1:8824117-8824139 GCCTTTGGCTCTCAAAGTGCTGG - Intergenic
901683371 1:10929264-10929286 CCCTGTTCCTCTCCAATGCCTGG - Intergenic
901686949 1:10948349-10948371 GCCAGGGCCTCGCCAATGGCTGG + Exonic
902801969 1:18836106-18836128 TCCTGTGGCTCCCCAGTGCCTGG - Intergenic
903489150 1:23714770-23714792 GCCTGGGCCTCTCCAGTGGCTGG + Intergenic
904829658 1:33298683-33298705 ACCTGTGGCTCTCCAGGGCCAGG - Intronic
905284509 1:36870553-36870575 GGCTGTGACTCTTCAAAGGCGGG - Intronic
905343134 1:37292961-37292983 GCCTGAGGCTCCCCAAGGACTGG - Intergenic
906799089 1:48720446-48720468 GCCTGTGTGACTCCAATGTCTGG - Intronic
908880354 1:68724806-68724828 GCCTGTGCCTCCCAAGTGGCTGG - Intergenic
912359260 1:109081425-109081447 GCCTCAGGCTCCCGAATGGCTGG + Intergenic
912774538 1:112497146-112497168 ACCTGTGGCTTTCCCAAGGCTGG + Intronic
913435596 1:118844435-118844457 GCCTGTGAATCTCTAAAGGCTGG + Intergenic
913598036 1:120396331-120396353 GCCTGTGGCTCTCCCTGGCCAGG - Intergenic
914089293 1:144482989-144483011 GCCTGTGGCTCTCCCTGGCCAGG + Intergenic
914309318 1:146451226-146451248 GCCTGTGGCTCTCCCTGGCCAGG - Intergenic
914592793 1:149121911-149121933 GCCTGTGGCTCTCCCTGGCCAGG + Intergenic
914870331 1:151468338-151468360 GCCTCAGCCTCTCCAGTGGCTGG - Intergenic
915397054 1:155593024-155593046 GCCTCAGGCTCCCCAATAGCTGG + Intergenic
916123803 1:161551438-161551460 GTCTGTGGCTCTCCAATGGAGGG + Intergenic
916133686 1:161632801-161632823 GTCTGTGACTCTCCAATGGAGGG + Intronic
916427928 1:164699537-164699559 GACTGTGCCTCTACAGTGGCAGG + Intronic
916543079 1:165776145-165776167 GCCTCTGGCTCTCAAGTAGCTGG - Intronic
919225005 1:194686502-194686524 GCCTCAGCCTCTCGAATGGCTGG + Intergenic
921672152 1:217937582-217937604 GCCTCAGCCTCTCCAATAGCTGG + Intergenic
1063878991 10:10511294-10511316 GCCTCAGTCTCTCCAGTGGCTGG - Intergenic
1065681525 10:28238649-28238671 CCCTGTGGCTGTCCGAAGGCAGG - Exonic
1067437557 10:46288756-46288778 GCCTGTGGCTCTGCCTTGCCTGG - Intronic
1069287049 10:66728700-66728722 GCCTCTGGCTCTCGAATAGCTGG + Intronic
1069503740 10:68977856-68977878 GCCTGTGCCTCCCAAAGGGCTGG - Intronic
1069717388 10:70529867-70529889 TCCTGTGGCTCTCCCCTGCCAGG + Exonic
1075099329 10:119495091-119495113 GCCAATTGCTCTCCAAGGGCAGG + Intergenic
1075099466 10:119496020-119496042 GCCTGAGGCTCCCCAGTAGCTGG + Intergenic
1075273145 10:121070415-121070437 ACCTGTAGCTCTACAAGGGCAGG + Intergenic
1076302319 10:129437564-129437586 GCCTGTGGCTCTGCAGTGCTGGG - Intergenic
1077309183 11:1880932-1880954 GCCTGTGGCTCCCTAACAGCAGG - Intronic
1077309207 11:1881013-1881035 GCCTGTGGCTCCCTAAGAGCAGG - Intronic
1078428647 11:11270614-11270636 CCCTCTGCCTCTCCCATGGCAGG - Intergenic
1079109076 11:17593989-17594011 GCCCGTGGCTCACCTCTGGCAGG + Intronic
1079338188 11:19589679-19589701 GGCTGTGGCTCTCTCTTGGCTGG - Intronic
1080857641 11:36126117-36126139 GCCTTTGGTTCTCCTTTGGCAGG + Intronic
1083864664 11:65446944-65446966 GCCTGTTGGTCCCCAGTGGCAGG - Intergenic
1084122401 11:67077398-67077420 GCCTGGGGCTCTCCAGTATCTGG + Intergenic
1084185003 11:67466870-67466892 CCCTGCGGCTCTGCACTGGCTGG + Intronic
1084669976 11:70600167-70600189 GCCTCAGCCTCTCAAATGGCTGG - Intronic
1084704151 11:70806219-70806241 GCATGCTGCCCTCCAATGGCGGG + Intronic
1085349146 11:75787419-75787441 GCCTGTGGATGCTCAATGGCAGG - Intronic
1085483856 11:76845270-76845292 GCCTGGGCCTCCCCAAGGGCTGG - Intergenic
1085812818 11:79700782-79700804 TCCTGTGGCTCTTCAATGTTAGG - Intergenic
1087661193 11:100990197-100990219 GACTGTGGCACTCAAAGGGCAGG - Exonic
1091370747 11:135056175-135056197 GCCTGTGGCTTTTGCATGGCAGG - Intergenic
1092254282 12:6917730-6917752 GCCTGCGGCTCTCCCAGGGGCGG + Intronic
1096271781 12:50171325-50171347 GCCTGGGCCTCGCAAATGGCTGG + Intergenic
1096300009 12:50418532-50418554 GCCTCAGGCTCTCAAATAGCTGG + Intronic
1097109193 12:56645698-56645720 GCGTCTTGCTCTCTAATGGCTGG - Intronic
1098139794 12:67439863-67439885 GCCTTTGGCTCTCCAGAGGCAGG - Intergenic
1101047732 12:100827781-100827803 GCCTCTGCATCTGCAATGGCTGG - Intronic
1101514098 12:105418655-105418677 GCCTGTGGCTGTCCTCTGCCTGG + Intergenic
1101706340 12:107224659-107224681 GCCTCAGCCTCTCAAATGGCTGG + Intergenic
1103293592 12:119867301-119867323 GCCTCTGCCTCCCAAATGGCTGG + Intronic
1103993847 12:124816570-124816592 GACTGTGGGTCTCCAACAGCGGG + Intronic
1104083938 12:125457676-125457698 GCCTGGGGCTCTGCAAGGGAAGG + Intronic
1104553098 12:129775401-129775423 GCTGGTGGCTCTCCCATGCCTGG - Intronic
1106465441 13:30009965-30009987 GCCTTTGGCTCTTCAATGTTAGG + Intergenic
1106559217 13:30834044-30834066 GCCTGGGGCTCCTCAATGCCAGG - Intergenic
1106675961 13:31958190-31958212 GCCTCTGCCTCTCAAGTGGCTGG - Intergenic
1106729109 13:32520542-32520564 GCCTCAGCCTCTCCAATGGGTGG - Intronic
1108973045 13:56401498-56401520 GACTGTGGCTCTTGGATGGCTGG + Intergenic
1109764906 13:66882332-66882354 GCCTCTTCCTCTCCAATGCCAGG + Intronic
1110106172 13:71678907-71678929 GCCTCAGGCTCTCCAAGTGCTGG + Intronic
1110957667 13:81576244-81576266 GCCTGAGGCCCTCCAAATGCTGG - Intergenic
1113374592 13:109752612-109752634 GCCTGTGGCTATCCCATCACAGG + Intergenic
1113539187 13:111093397-111093419 GCCTCTGGCTCCCCCATGGAGGG + Intergenic
1114035523 14:18623386-18623408 GACTGTGGCACTCAAAGGGCAGG + Intergenic
1114123115 14:19691636-19691658 GACTGTGGCACTCAAAGGGCAGG - Intergenic
1115144255 14:30208023-30208045 GCCTGTGGCACTCCAGTGTTAGG + Intergenic
1116000860 14:39241567-39241589 GCCTCTGCCTCACCAATGGCTGG + Intronic
1117450159 14:55842216-55842238 GCCTCAGGCTCCCCAATAGCTGG + Intergenic
1117661751 14:58013788-58013810 GCCTCTGCCTCTCCAAGTGCTGG - Intronic
1118118931 14:62814301-62814323 GCCACTGGCTTTCCAAAGGCAGG + Intronic
1119271019 14:73304873-73304895 GCCTCAGCCTCTCAAATGGCTGG + Intronic
1119750845 14:77076311-77076333 CCTTGTGGCTCTGCCATGGCGGG - Intergenic
1121636377 14:95456595-95456617 GCTGGTGGGTCTCCAATGGGGGG - Intronic
1122839815 14:104451716-104451738 GTGTGTGGCCCTCCAACGGCTGG + Intergenic
1202854751 14_GL000225v1_random:43395-43417 GCCTGTGGCTCTCCCACAGGGGG + Intergenic
1124925034 15:34062774-34062796 ACCTGTGGCGTTCCAAAGGCTGG - Exonic
1126027263 15:44459276-44459298 GCCTGGGGCTCTCAAAGTGCTGG - Intronic
1126153606 15:45545214-45545236 GCCTCAGCCTCTCCAATAGCTGG + Intergenic
1128233919 15:66054219-66054241 GCCAGCTGCTCTCCACTGGCTGG + Intronic
1128869458 15:71141986-71142008 GCCTCAGCCTCTCCAATAGCTGG - Intronic
1131756344 15:95566928-95566950 GCCTGTGCCTCTGCAATGCCCGG - Intergenic
1132119907 15:99167750-99167772 TCCTGTGGCTGTCCTAAGGCAGG + Intronic
1132133217 15:99304694-99304716 GCCTGTGCCTCTCAAAGTGCTGG + Intronic
1132413902 15:101606729-101606751 GCCTGTGGCTGCCCTATGCCGGG - Intergenic
1132879297 16:2154533-2154555 GCCTGAGCCTCCCAAATGGCTGG - Intergenic
1135106643 16:19655534-19655556 GGCTGTGGCTTTCCCAAGGCTGG + Intronic
1135309432 16:21393847-21393869 GCCTCAGCCTCTCCAATAGCTGG + Intergenic
1135547254 16:23374677-23374699 GTCTGTGGCTCTCTGAGGGCAGG - Intronic
1135560251 16:23470646-23470668 GCCTCAGCCTCTCAAATGGCTGG - Intronic
1135633975 16:24058290-24058312 GCCTGTTTCTCTCCACTGGATGG + Intronic
1136149009 16:28334160-28334182 GCCTCAGCCTCTCCAATAGCTGG + Intergenic
1136161355 16:28421206-28421228 GCCTGAGCCTCTCCAGTAGCTGG - Intergenic
1136201609 16:28693785-28693807 GCCTGAGCCTCTCCAGTAGCTGG + Intronic
1136217954 16:28807977-28807999 GCCTGAGCCTCTCCAGTAGCTGG + Intergenic
1136306175 16:29372971-29372993 GCCTCAGCCTCTCCAATAGCTGG + Intergenic
1136458027 16:30393323-30393345 GCCTCTGGCTCCCAAAGGGCTGG + Intronic
1139743402 16:69054824-69054846 GCCTCAGGCTCCCGAATGGCTGG - Intronic
1141132885 16:81447066-81447088 GCATTTGGCTTTCCAATGGATGG + Intronic
1143714314 17:8756102-8756124 GCCTCGGCCTCTCCAATAGCTGG - Intronic
1144538248 17:16113023-16113045 GCCTCAGCCTCCCCAATGGCTGG + Intronic
1146430817 17:32792755-32792777 GCCTCAGGCTCCCCAATAGCTGG + Intronic
1147677407 17:42217817-42217839 GCCTCAGGCTCTCTAGTGGCTGG + Intronic
1148342544 17:46882039-46882061 GCCTCGGCCTCTCCAATCGCTGG - Intronic
1148678815 17:49461102-49461124 GCATGTGAATCTCCAAGGGCTGG + Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151793695 17:76327536-76327558 GCCTCAGCCTCTCCAGTGGCTGG - Intronic
1152020659 17:77778748-77778770 GCCTCAGGCTCCCCAAGGGCAGG - Intergenic
1152380291 17:79938835-79938857 GCCTTTGGCTGTGCCATGGCTGG + Exonic
1152741401 17:82020022-82020044 GCCTGAGCCTCTCCCAGGGCAGG + Intronic
1153263250 18:3244502-3244524 GTCTGTGCCTCCCAAATGGCTGG - Intergenic
1154994350 18:21625723-21625745 GCCTCTGCCTCTCCAGTAGCTGG + Intronic
1155295691 18:24382460-24382482 ACCTCAGCCTCTCCAATGGCTGG - Intronic
1157574774 18:48736285-48736307 GCCTGTGCCTCTCCAAGTTCTGG + Intronic
1157793889 18:50558130-50558152 GTCTGGGGCTCTCCACTGTCAGG - Intergenic
1159583896 18:70264372-70264394 ACCTGTGTCTCTCAAATTGCTGG + Intergenic
1160096500 18:75878175-75878197 CCCTGTGGCTTTCCATGGGCTGG - Intergenic
1160153651 18:76415081-76415103 GCCTCAGCCTCTCCAGTGGCTGG - Intronic
1160513123 18:79463537-79463559 GTCTGTGGCTCCCCGCTGGCCGG + Intronic
1160659846 19:292747-292769 ACCTGTGGCCCTCCAAGGGCAGG + Intergenic
1163368947 19:16891306-16891328 GCCTGTGCCTCTTGAGTGGCTGG - Exonic
1163377505 19:16942565-16942587 GCCTCTGGCTGACCATTGGCTGG + Intronic
1163402582 19:17103105-17103127 GCCTTAGCCTCTCCAATAGCTGG - Intronic
1164051525 19:21588241-21588263 CCATGTGGCTCCCCCATGGCAGG - Intergenic
1164280861 19:23767326-23767348 GCCTGGGGCTCTCAAAGTGCAGG + Intronic
1165053356 19:33157381-33157403 GCCTGAGGCTCCCGAATAGCTGG - Intronic
1165751281 19:38261872-38261894 GCCTCAGCCTCTCCAGTGGCTGG + Intronic
1166038219 19:40185272-40185294 GCCTGAGGCTCTCAAAGTGCTGG - Intergenic
1166666931 19:44685742-44685764 GCCTCTGCCTCTCCAGTAGCTGG - Intergenic
1166674001 19:44728144-44728166 GTCTGTGGCTCCCCAAGGGCAGG + Intergenic
1167309076 19:48726339-48726361 GCCTCAGCCTCTCCAATAGCTGG + Intronic
925295866 2:2776818-2776840 GCCTGTGTCTATCACATGGCAGG + Intergenic
926016721 2:9459515-9459537 GCCTTTTGCTTTCCAGTGGCTGG + Exonic
926026021 2:9545317-9545339 GCCTCTGCCTCTCCAAGTGCTGG - Intronic
927277273 2:21272644-21272666 GCCTGGGCCTCCCAAATGGCTGG - Intergenic
927957943 2:27221279-27221301 GCGGGTGGCACTCCAGTGGCTGG - Exonic
929578559 2:43067902-43067924 CCCTGGGCCTCTCCCATGGCGGG - Intergenic
930398322 2:50850107-50850129 GCCTCAGCCTCTCCAGTGGCTGG - Intronic
932725268 2:74174344-74174366 GCCTTGGTCTCTCAAATGGCTGG - Intronic
934014379 2:87863329-87863351 GACTGTGACTCTACAATGGTGGG + Intergenic
936090876 2:109500697-109500719 GCCTCAGGCTCTCCAAGTGCTGG - Intronic
937356887 2:121203277-121203299 GCTGGTGGCACTCCAAGGGCAGG + Intergenic
937973738 2:127568436-127568458 GCCCCTGTCTCTACAATGGCAGG + Intronic
938173806 2:129105855-129105877 ACCTGTGGCTCTGCACTTGCGGG - Intergenic
938274876 2:130009563-130009585 GACTGTGGCACTCAAAGGGCAGG - Intergenic
938440495 2:131327710-131327732 GACTGTGGCACTCAAAGGGCAGG + Intronic
939065831 2:137482437-137482459 CCCTGTGGGTCTCCAATGGGTGG + Intronic
940961198 2:159787990-159788012 GCCTCAGGCTCCCCAATAGCTGG - Intronic
942233080 2:173877952-173877974 GCCTGGGCCTCTCAAATTGCTGG - Intergenic
944241747 2:197492437-197492459 GCCTGTGCCTCCCCAAGTGCTGG + Intronic
946098727 2:217300546-217300568 GCCTCAGGCTCTCAAATTGCTGG - Intronic
947636284 2:231682141-231682163 GCCTGAGCCTCTCCAGTAGCTGG - Intergenic
1171268936 20:23798545-23798567 GCCTGTGTCTGTGCAGTGGCTGG + Intergenic
1171841737 20:30221818-30221840 GCCTCTGGCTCTCGAGTAGCTGG - Intergenic
1174292576 20:49519513-49519535 CCCTGGGGCTCTCCAGTGGTGGG - Intronic
1174417453 20:50376934-50376956 GGCTGTGGCTCACCAAGGCCCGG + Intergenic
1174816148 20:53688855-53688877 GCCTCTGCCTCCCCAATAGCTGG - Intergenic
1175341496 20:58233602-58233624 TCCTGTGGCTCTTCTATGCCCGG + Intergenic
1175697984 20:61116897-61116919 CCCTGTGGGGCTCCAAGGGCAGG - Intergenic
1175861988 20:62155490-62155512 GCCTTTGTCTTTCAAATGGCAGG + Intronic
1176070716 20:63224870-63224892 GCCTGTGGCTCTCTAGGCGCTGG + Intergenic
1176155851 20:63620060-63620082 GCCTCAGCCTCTCCAATTGCTGG + Intronic
1180459644 22:15550440-15550462 GACTGTGGCACTCAAAGGGCAGG + Intergenic
1180681493 22:17630101-17630123 GCCTCAGCCTCTCCAGTGGCTGG - Intronic
1180930063 22:19583912-19583934 GCCTGAGGCTCCCAAATAGCTGG + Intergenic
1181961335 22:26623924-26623946 GCCAGTGGCTCTGAAATGGATGG - Intronic
1182855194 22:33510922-33510944 GCCCCAGGCTCTCCAATGACTGG + Intronic
1183688581 22:39375781-39375803 GCCCGTGGCTCTCCTCTGACTGG + Intronic
1184009510 22:41736500-41736522 GCCTCTGCCTCTCAAAGGGCTGG + Intronic
1184744132 22:46446258-46446280 GCATGTGGCTTTCCAGTGCCTGG + Intronic
949521756 3:4862035-4862057 GCCTTGGGCTCTCAAAAGGCTGG + Intronic
950049005 3:9971888-9971910 GCCTGTGGCTTCCCAAAGACTGG - Intronic
950560237 3:13717059-13717081 CCCTGTGTCTCTCCCAGGGCAGG - Intergenic
951105093 3:18732999-18733021 GCCTATGCCTCTCCAGTAGCTGG + Intergenic
952383829 3:32824596-32824618 GCCTGTGTCTCTCAAGTAGCTGG + Intronic
954215436 3:49121860-49121882 ACCTTTGGCTCACCCATGGCAGG - Exonic
954677958 3:52325994-52326016 GCCTGTGGCTGGGCAGTGGCTGG - Intronic
954887800 3:53891860-53891882 GCCTGTGACGCTCGAAGGGCGGG - Exonic
955171682 3:56571831-56571853 GCCTCTGCCTCCCAAATGGCTGG + Intronic
955618469 3:60834748-60834770 GCCTGAGGCTCTGGAATAGCTGG - Intronic
956505017 3:69928880-69928902 CCCTGTGGGTCTCAAATGACCGG - Intronic
960048998 3:113222962-113222984 GCCTGTGGCTCTCCAATGGCAGG - Intronic
960811000 3:121627471-121627493 GCCAGGGGCTCTCCTATGTCAGG - Exonic
964787889 3:160419853-160419875 GCCTCTGCCTCTCCAACAGCTGG - Intronic
968872662 4:3249653-3249675 GCCTGTCGGTCTCCTCTGGCCGG + Intronic
969343849 4:6559024-6559046 CTCTGTGGCTCTGCAATGCCAGG + Intronic
969376778 4:6768351-6768373 GGCTGGGTCTCTCCAAGGGCAGG - Intergenic
969440163 4:7212239-7212261 GCATGTGGTTGTGCAATGGCTGG + Intronic
969575448 4:8033744-8033766 GGCTGCGCCTCTCAAATGGCAGG - Intronic
971423950 4:26498315-26498337 GCCTGAGCCTCCCCAATAGCTGG + Intergenic
971494406 4:27248752-27248774 CCCTGGGGCTCTCCAATAGTAGG - Intergenic
972244704 4:37233464-37233486 GCCTGTGCCTCCCGAATAGCTGG - Intergenic
972536670 4:40005723-40005745 GCCTCTGTCTCTCAAATTGCTGG + Intergenic
972605142 4:40606626-40606648 GTCTCTGGCTCTCCACTTGCTGG + Intronic
973686141 4:53371745-53371767 CTCTCTGGCTCACCAATGGCTGG + Intergenic
974186502 4:58454311-58454333 CCCTGTGGCTTTTCAAGGGCAGG + Intergenic
974582277 4:63818117-63818139 GCCTCGGCCTCTCAAATGGCTGG - Intergenic
974826396 4:67136307-67136329 GCATGTGGCTCTCCAATTTGGGG - Intergenic
977366529 4:96075828-96075850 TCCTGTGCCTCTCCTATGCCTGG + Intergenic
977381513 4:96280039-96280061 GCCTCTGACTCCCCATTGGCTGG + Intergenic
977808521 4:101332462-101332484 GGCAGTGGCTGTCCAATGGCTGG - Intronic
980248191 4:130275329-130275351 GCCTGTGGCTCCACAGTGGGTGG + Intergenic
981135986 4:141212200-141212222 GGCTGTGGATCTCCAACAGCCGG + Intronic
982133942 4:152256316-152256338 CCTTATGGCACTCCAATGGCAGG - Intergenic
983653047 4:170052662-170052684 GCCTCAGGCTCCCGAATGGCTGG - Intergenic
984598708 4:181701925-181701947 GCTTGTGGTTCTCCTATAGCTGG + Intergenic
986411443 5:7484688-7484710 GCCTGTGGCTCTCCGATCTTGGG + Intronic
988747528 5:34156183-34156205 GCCTCTGCCTCCCCAGTGGCTGG + Intergenic
991294859 5:65070087-65070109 GACTTTGGCTCTCAAATGGCAGG + Intergenic
993190078 5:84670287-84670309 GCCTCTGGGCTTCCAATGGCAGG - Intergenic
994166759 5:96616916-96616938 GCCTCTGGTTCTCTCATGGCAGG + Intronic
994677554 5:102844413-102844435 GCCTCGGCCTCTCAAATGGCTGG - Intronic
995568544 5:113456569-113456591 GCCTCAGCCTCTCCAATAGCTGG + Intronic
996461020 5:123743143-123743165 GCCTCTGCCTCTCAAAGGGCTGG - Intergenic
996983011 5:129522939-129522961 GCCTCTGCCTCTCAAGTGGCTGG - Intronic
997363288 5:133309183-133309205 GCCTGGGTCTCTGCCATGGCAGG + Intronic
998386257 5:141758711-141758733 GCCTGCGGCTCTGCACTTGCGGG + Intergenic
999245885 5:150154567-150154589 GCCTATGGCTCCCCAGTGCCTGG - Intronic
999308814 5:150538268-150538290 GCCCATGGCCATCCAATGGCTGG - Intronic
1001848183 5:174940008-174940030 GCCAGGGGCTCTTCAAAGGCTGG - Intergenic
1002184743 5:177448937-177448959 GCATGTGGGTTTCCAATGCCTGG - Intronic
1002554106 5:180020823-180020845 GTCTGTGGCTCTCCACTGATTGG - Intronic
1002564434 5:180101837-180101859 GCCTGTGACTCCCCCACGGCTGG - Intronic
1003291994 6:4787884-4787906 GCCTCTGCCTCTCCAGTGGCTGG + Intronic
1006047069 6:31307590-31307612 TCCTGAGGCTCTCCCATGGGTGG - Intronic
1006813182 6:36833969-36833991 GCCTGTGCCTCTCAAAGTGCTGG - Intronic
1007457251 6:41988811-41988833 GCCTGAGGCTCCCGAATAGCTGG + Intronic
1007951181 6:45873713-45873735 TTCTGTAGCTCTCCAAGGGCGGG + Intergenic
1016972946 6:149781603-149781625 GCCTGTGCCTCTCAAAGTGCTGG + Intronic
1019402378 7:863185-863207 GCCTGTGGTTCACCAGTGCCAGG + Intronic
1019609106 7:1928005-1928027 GCTGGTGGCTCTCCACTGTCTGG - Intronic
1019873679 7:3790356-3790378 TCCTGTGGCTGCTCAATGGCAGG + Intronic
1020132193 7:5565027-5565049 GCCTCAGCCTCTCCAGTGGCTGG - Intergenic
1020177804 7:5897074-5897096 GCCTTGGGCTCTCCAAGTGCTGG - Intergenic
1020305113 7:6827900-6827922 GCCTTGGGCTCTCCAAGTGCTGG + Intergenic
1022145435 7:27533992-27534014 GCATGTGGCTTTACAATTGCTGG + Intronic
1022152469 7:27622128-27622150 GCCTCAGGCTCTCGAATAGCTGG - Intronic
1023058128 7:36305773-36305795 GCCTCTGCCTCTCGAATAGCTGG - Intergenic
1024627666 7:51222072-51222094 GCCTGAGGCTCCCAACTGGCTGG - Intronic
1025195123 7:56926672-56926694 GCCTCTGCCTCTCCAAGTGCTGG - Intergenic
1025676829 7:63650271-63650293 GCCTCTGCCTCTCCAAGTGCTGG + Intergenic
1026221735 7:68404440-68404462 GCCTTGGCCTCTCCAATCGCTGG - Intergenic
1026239094 7:68556294-68556316 GCCTCAGGCTCCCCAGTGGCTGG + Intergenic
1026620694 7:71947689-71947711 GCCTGGGGCTCTCAAAGTGCTGG - Intronic
1026771758 7:73206313-73206335 GACTGTGGGTCTGGAATGGCTGG + Intergenic
1026908520 7:74078551-74078573 GCCTTGGCCTCTCAAATGGCTGG + Intergenic
1027012626 7:74759709-74759731 GACTGTGGGTCTGGAATGGCTGG + Intronic
1027075414 7:75186344-75186366 GACTGTGGGTCTGGAATGGCTGG - Intergenic
1029081042 7:97973987-97974009 GCCTTGGGCTCTCCAAGTGCTGG + Intergenic
1030463986 7:109876451-109876473 GCCTCTGCCTCCCCAAGGGCTGG + Intergenic
1032075838 7:128835718-128835740 AGCTGTGGCTCTCCGCTGGCTGG + Intronic
1034431431 7:151043215-151043237 GCCTGAGGCACTGCCATGGCTGG + Intronic
1034998043 7:155590802-155590824 GCCCGTGGCTCGCCTCTGGCGGG + Intergenic
1035263509 7:157676047-157676069 GTCTGTGGCGCTCCAAGGGACGG - Intronic
1036464597 8:8984789-8984811 GCCTGTGCCTCCCCAGTAGCTGG - Intergenic
1037848336 8:22304817-22304839 GCCTGTGAATCAGCAATGGCTGG - Exonic
1038036500 8:23691011-23691033 GCCTGGGGCTCTCCAGAAGCCGG - Intergenic
1038466301 8:27767249-27767271 GCCTGAGCCTCTCCAGTAGCTGG - Intronic
1039619841 8:38986516-38986538 GCCTGTGGCTCCCAAAGTGCTGG + Intronic
1039790094 8:40868770-40868792 GCCCGTGCCTCTCCACTGCCTGG + Intronic
1040861978 8:52008496-52008518 GCCTGGGGCTGTGCAATTGCAGG - Intergenic
1042144472 8:65713796-65713818 GCCTCTGCCTCTCCAGTAGCTGG + Intronic
1042708528 8:71688398-71688420 CCCTGTGGTTCCCCAATAGCTGG - Intergenic
1044569228 8:93699580-93699602 GCCTCAGGCTCTCAAATAGCTGG - Intronic
1044968763 8:97599364-97599386 GCCTTAGGCTCCCCAGTGGCTGG - Intergenic
1045726978 8:105185779-105185801 CCCTGTGCTTCTCCAGTGGCAGG + Intronic
1047965504 8:130043324-130043346 GCCTGGGCCTCTCCAAGTGCTGG - Intergenic
1048000457 8:130375443-130375465 GCCTCAGCCTCTCCAATTGCTGG - Intronic
1049171126 8:141161301-141161323 TCCTGTGGCTCTCCCATAGATGG - Intronic
1049356214 8:142189777-142189799 GCCTGTGAGTCTCCAGCGGCTGG - Intergenic
1053205901 9:36186446-36186468 GCCTCAGCCTCTCCAATAGCCGG + Intergenic
1056160154 9:83882245-83882267 GCCTCAGGCTCTCAAATAGCTGG - Intronic
1057079547 9:92162483-92162505 GCCTGTGCCTCTCAAAGTGCTGG - Intergenic
1057759401 9:97860483-97860505 GCCAGGGGCTCTGCAAAGGCTGG - Intergenic
1058427623 9:104889060-104889082 GCCTGAGACTCACCAATGGCAGG - Intronic
1060710165 9:125854382-125854404 GCCTCTGCCTCTCGAATTGCTGG + Intronic
1062496006 9:136832008-136832030 GCCTGGGTCTCCCCGATGGCAGG + Intronic
1186421607 X:9431436-9431458 GCCTGGGCCTCTCAAATTGCTGG + Intergenic
1187420527 X:19129978-19130000 ACCGGTGGTTCTCCAATGTCAGG + Intergenic
1189170091 X:38900821-38900843 GCCTGTGGCTCTCCCAAGGCTGG - Intergenic
1190571185 X:51783594-51783616 GCCTTAGGCTCTCAAATAGCTGG - Intergenic
1191864416 X:65692198-65692220 GCCTGTTGCTCTCTAAGGTCAGG + Intronic
1192549444 X:72042332-72042354 GAATGTGGCTCTGCAGTGGCCGG + Intergenic
1193263333 X:79437198-79437220 GCCTCGGGCTCTCCAAGTGCTGG - Intergenic
1196833844 X:119797221-119797243 GCCTCAGCCTCTCAAATGGCTGG + Intergenic
1196846832 X:119902938-119902960 GCCTCGGGCTCTCAAAGGGCTGG + Intronic
1198962905 X:142201754-142201776 GGCTCTGGCTCTCCCATGCCAGG + Intergenic
1199130095 X:144175144-144175166 GACTGTGACTCTACAATGGTGGG - Intergenic
1201178120 Y:11322151-11322173 ACCTGTGGCTCTCCAACAGGGGG + Intergenic
1201903903 Y:19069931-19069953 GCCAGTGCTTCTCCAACGGCTGG + Intergenic