ID: 960049478

View in Genome Browser
Species Human (GRCh38)
Location 3:113226320-113226342
Sequence TGGGGTGCTTCAGCCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960049478 Original CRISPR TGGGGTGCTTCAGCCAGTGC TGG Intronic
900488516 1:2934949-2934971 TGGGGTGCTTCCCCCAGAGCAGG - Intergenic
903018199 1:20375494-20375516 GGAGGTGGTTCAGCCTGTGCCGG - Intergenic
903714822 1:25357464-25357486 TGGGGTTTTTCGGCCAGTGATGG - Intronic
906546688 1:46624396-46624418 TGGAGAGCTTCAGTCTGTGCAGG + Intergenic
907331512 1:53674871-53674893 TGAGGTCATTCAGGCAGTGCGGG + Intronic
908320572 1:62974192-62974214 TTGGCTGCTTGAGCCAGTGGCGG + Intergenic
909581662 1:77242992-77243014 CGTGGTTCTTCAGCCTGTGCAGG + Intergenic
910427103 1:87129184-87129206 TGGGGTGGTTAAGCCTTTGCTGG + Intronic
912625144 1:111200109-111200131 TCGGGTGCTTCTGGCAGTCCTGG + Intronic
914847753 1:151292292-151292314 TGGGGAACCTCAGCAAGTGCAGG + Exonic
916813340 1:168325878-168325900 TGGGGAGCTTCAGCCAGTGAAGG - Intergenic
918708307 1:187696203-187696225 TGGGCTGCTGCAGCCTCTGCAGG + Intergenic
920204716 1:204283061-204283083 TGGGCTGCCTCAGCCACTGAAGG - Intronic
921861449 1:220046293-220046315 TGGGTTGCATCAGCCAGGGAGGG - Intronic
923657927 1:235934490-235934512 TGGGGTGGCTCAGCCAGAGGTGG + Intergenic
1063029414 10:2217763-2217785 TGGGCTGCTTCAGGCACTGATGG - Intergenic
1065186096 10:23172526-23172548 TGGGGTGCTCATGCCGGTGCCGG + Intergenic
1066052102 10:31645413-31645435 TGGGCTGACTCAGTCAGTGCTGG + Intergenic
1066258384 10:33704176-33704198 TGGGCTTCTGCAGCCAGAGCTGG - Intergenic
1066365053 10:34768793-34768815 TGCAGGGCTTCAGCCAGGGCTGG - Intronic
1067820118 10:49520984-49521006 TGGGGAAGTTCATCCAGTGCAGG - Intronic
1072753445 10:98000504-98000526 AGGGGTGTGTGAGCCAGTGCAGG - Intronic
1075592091 10:123699247-123699269 TGGGATGCTTCAGTCTGTGGGGG + Intergenic
1077443341 11:2578791-2578813 GAGGCTGCTTCAGCCATTGCAGG - Intronic
1079801271 11:24872425-24872447 TGAGCTGCTACAGCCAGGGCAGG - Intronic
1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG + Intronic
1083644898 11:64166355-64166377 CCGGGGGCTTCAGCCCGTGCCGG - Intergenic
1083882088 11:65553775-65553797 TGGGGTGCGGCAGCAGGTGCTGG + Exonic
1084021009 11:66418275-66418297 TGGGGTGACTCAGCCAGGCCAGG + Intergenic
1084154981 11:67308301-67308323 TGGTGAGCTTCAGCCAGGCCTGG + Exonic
1085783870 11:79434528-79434550 TGGAGTGCTTCAGCCAGCAATGG - Intronic
1088738329 11:112746734-112746756 TCGAGTGCTTCCGGCAGTGCTGG + Intergenic
1091289627 11:134430597-134430619 GGGGGTGCTTCTGCATGTGCCGG + Intergenic
1092165472 12:6339991-6340013 TGGGGTGCTTCAGCCCAGGTGGG - Intronic
1092167181 12:6349338-6349360 TGGGCTGTTTCACCAAGTGCCGG - Exonic
1092596445 12:10010461-10010483 AGGGGTGCTTGAGGCAGAGCAGG - Intronic
1093926295 12:24911668-24911690 TCAGGTGATTCAGCAAGTGCAGG - Intronic
1101226601 12:102694056-102694078 TGGGGTGGTTAAGGAAGTGCTGG + Intergenic
1101353666 12:103956811-103956833 TGAGGCGCTCCAGCCAGCGCTGG + Intronic
1102500469 12:113348842-113348864 TGGGGAGCTTCTAGCAGTGCAGG + Intronic
1108572937 13:51768494-51768516 TGGGAGGCTGCAGCCAGGGCTGG + Intronic
1114049683 14:18913029-18913051 CCTGGTGCTTCAGCCAGTCCTGG - Intergenic
1114112877 14:19488901-19488923 CCTGGTGCTTCAGCCAGTCCTGG + Intergenic
1122870344 14:104635448-104635470 TGGGGTGTGGCAGCCAGTGGGGG + Intergenic
1124381685 15:29172809-29172831 GGGGGAGGTTCAGCCAGGGCAGG - Intronic
1129193848 15:73952859-73952881 TGGGATGCCACAGCCAGGGCAGG - Intergenic
1131417531 15:92273563-92273585 TGGGGTGCTCCAGCCAGAGCAGG - Intergenic
1132556730 16:575899-575921 TGAGGTGCTCCAGCCGGTGCCGG - Exonic
1132591980 16:730070-730092 TGAGGGGCTTCAGCCTGTCCCGG - Exonic
1134533080 16:15000313-15000335 TGGGAGGCTTCAGACAGTGAAGG - Intronic
1135644421 16:24149044-24149066 CCAGGTGCTCCAGCCAGTGCAGG - Intronic
1135879481 16:26240332-26240354 TGGGGTGGTTAAGGGAGTGCTGG + Intergenic
1136278419 16:29192769-29192791 TGGGGGGCACCAGGCAGTGCAGG + Intergenic
1139426676 16:66884842-66884864 CTGGGTGCTTGAGCCAATGCAGG - Exonic
1139483159 16:67241814-67241836 TGTGCTGCTTCAGCCTGTGTTGG - Intronic
1139862953 16:70040415-70040437 TGGGAGGCTTCAGACAGTGAAGG + Intergenic
1141553356 16:84820795-84820817 TGGGTTTCTTTAGCCAGAGCGGG + Intronic
1141700854 16:85641408-85641430 GGGGGGGCGTCAGCCAGTGGCGG - Intronic
1141836294 16:86541973-86541995 TGGTGTGGATCAGCCAGGGCTGG - Intronic
1141878850 16:86844962-86844984 TGGGCTGCTTCAGGCTTTGCTGG + Intergenic
1142050734 16:87956579-87956601 TGGGGCCCTTCAGCCCCTGCAGG + Intronic
1142211658 16:88811433-88811455 TGGGGTGCTTCAGGGGGCGCCGG - Intronic
1143083253 17:4396972-4396994 TGGGGTCCTGCAGGCAGAGCTGG - Intergenic
1143598737 17:7930597-7930619 TAGGTTGCTTCAGCCAGCCCGGG + Exonic
1143782669 17:9237594-9237616 TGGGCTGCTCCAGCCCATGCTGG + Intronic
1145266461 17:21381900-21381922 TGGGCTGCTTCAGCCAGGCCTGG + Intronic
1146295296 17:31645364-31645386 TGGGGTGCTAGAGGCAGAGCAGG + Intergenic
1152122010 17:78424679-78424701 TGGGGTGCCTGAGCCGTTGCTGG + Intronic
1152132774 17:78486958-78486980 AGGGGTGCTTCAGGCATGGCTGG - Intronic
1152147151 17:78575237-78575259 GGGGGTGCTTTAGCAGGTGCTGG + Intronic
1152234016 17:79129191-79129213 TTCAGTGCTTCACCCAGTGCTGG - Intronic
1152776227 17:82203823-82203845 CGGGGTGCTGCTGCCAGAGCAGG + Intronic
1152864931 17:82716820-82716842 GCGGGTGCATCAGCCAGGGCCGG + Exonic
1153812851 18:8766909-8766931 TGAGGTGGGTCAGCCAGTGAGGG - Intronic
1154126175 18:11694381-11694403 TGGGGTGCTACGTCCTGTGCAGG - Intronic
1156392049 18:36659913-36659935 AGGGGCACTTCAGCCAGTCCAGG - Intronic
1156907047 18:42365707-42365729 TGGGTTGCTTCAACCACTTCAGG + Intergenic
1157287977 18:46390241-46390263 TGGGGTGATTTAGACAGTGATGG - Intronic
1157463162 18:47919989-47920011 TGGTGTGCTTTAGTCAGTTCAGG + Intronic
1158597031 18:58825590-58825612 TGGGGTGGTTGACCCAGTGAAGG - Intergenic
1160443797 18:78912341-78912363 TGGGGTTTTTCAACCAGTGATGG + Intergenic
1160813618 19:1025404-1025426 TGGGGGGGTTCCGCCTGTGCTGG + Intergenic
1162116141 19:8430651-8430673 CCGGGTCCTTCAGCCACTGCAGG - Exonic
1162547445 19:11339252-11339274 TGGGGCGCCCCAGCCAATGCAGG + Intronic
1163276969 19:16290971-16290993 AGGGGTAAGTCAGCCAGTGCAGG + Intergenic
1167271260 19:48507903-48507925 TGGGGTGCTTCACCCCGTCATGG - Intronic
1168108917 19:54181086-54181108 AGGGCTGCTCCAGCCAGTCCAGG + Exonic
925384703 2:3454106-3454128 TGAGGTGCTTCAGCCCGAGAAGG - Intronic
925693693 2:6551801-6551823 TGGCCTGCTTGAGCCAGAGCTGG - Intergenic
929000774 2:37345025-37345047 CGGGGTGCCTCGGCCAGTCCGGG + Intronic
931923458 2:67045263-67045285 TGGAGTGCTTCTTCCAGTGCAGG - Intergenic
932220139 2:69993024-69993046 AGGGGTGCTTCAATCAGTGAGGG - Intergenic
932976855 2:76613116-76613138 TGGGGTGTTTCTGGCAATGCTGG + Intergenic
934151725 2:89153971-89153993 TGGGGTGGTGCAACCATTGCTGG - Intergenic
934215535 2:90027935-90027957 TGGGGTGGTGCAACCATTGCTGG + Intergenic
934810969 2:97276210-97276232 TGGGGTGTTTCACCCAGTTGAGG - Intergenic
934826723 2:97431729-97431751 TGGGGTGTTTCACCCAGTTGAGG + Intergenic
934973844 2:98786491-98786513 TCAGGTGCTTCCGCCAGTGCGGG - Intergenic
935085135 2:99837716-99837738 TGTGGTGCTCCAGCCAGAGAAGG - Intronic
938288548 2:130137527-130137549 CCTGGTGCTTCAGCCAGTCCTGG + Intergenic
938427040 2:131201364-131201386 CCTGGTGCTTCAGCCAGTCCTGG - Intronic
938467984 2:131535407-131535429 CCTGGTGCTTCAGCCAGTCCTGG - Intergenic
939256253 2:139747899-139747921 TGGGGTGCTTGAGGCAATGCAGG - Intergenic
944093372 2:195939407-195939429 TTGAGTGCTTCAGCAAATGCAGG + Intronic
1168986483 20:2053330-2053352 TGTGCTGCTTCAGGCAGAGCAGG - Intergenic
1170154931 20:13260876-13260898 TGGGGAGGCTCAGCCAGGGCTGG + Intronic
1173766029 20:45610115-45610137 TGTGATGCTTCTGCCTGTGCTGG - Exonic
1175014784 20:55777921-55777943 TGTGTAGCTTCAGCCAGTACAGG + Intergenic
1175610266 20:60345384-60345406 TGAGGTGCTGCAGTCTGTGCTGG + Intergenic
1176088691 20:63309514-63309536 GGGGGGGCTGCAGCCTGTGCGGG - Intronic
1179532892 21:42032211-42032233 TGTTGAGCCTCAGCCAGTGCAGG - Intergenic
1180118192 21:45725885-45725907 TGGGGTGAGGAAGCCAGTGCAGG + Intronic
1180468163 22:15635405-15635427 CCTGGTGCTTCAGCCAGTCCTGG - Intergenic
1180898881 22:19356846-19356868 GGGTGGGCTTCAGCCAGGGCAGG - Intronic
1181038642 22:20181739-20181761 TGGGGAGCTGCTGACAGTGCTGG + Intergenic
1182361390 22:29748451-29748473 TGAGGTGCTGCAGCCCGTTCAGG + Exonic
1182365128 22:29773505-29773527 TGATGTGATTCAGCCAGAGCTGG + Intergenic
1184331900 22:43832824-43832846 TGGGGAGGGTGAGCCAGTGCTGG - Intronic
1185313601 22:50169822-50169844 TGGGGTGCTGCGGCCACTGGCGG - Intergenic
1185324726 22:50220081-50220103 GGGGCTGCTTGAGCCAGGGCCGG - Intronic
950380682 3:12612089-12612111 AGGGGTGCTGCAGCCTGTGTTGG - Intronic
950437203 3:12987082-12987104 TCTGGTGCTGCGGCCAGTGCGGG + Intronic
960049478 3:113226320-113226342 TGGGGTGCTTCAGCCAGTGCTGG + Intronic
961374863 3:126457419-126457441 CCAGGTGCCTCAGCCAGTGCAGG - Intronic
962341693 3:134591034-134591056 TGGAGTGCTCCACCCAGTGAGGG - Intergenic
963008669 3:140749736-140749758 TGGGCTGCTTCAGCAAGGGTGGG - Intergenic
963707409 3:148704671-148704693 TGAGCTGTTTCACCCAGTGCAGG + Intronic
966805355 3:183803513-183803535 AGGGATGTTTCTGCCAGTGCAGG - Intronic
969355084 4:6620499-6620521 TGGGGAGCTTGAGCAGGTGCTGG - Intronic
969533028 4:7740059-7740081 TGGCTTCCTTCAGCCCGTGCAGG - Intronic
969650997 4:8468052-8468074 TGGGTTGCTGCTGGCAGTGCTGG + Exonic
972892010 4:43568652-43568674 GGGGGTGCTGCTGCAAGTGCTGG + Intergenic
973853513 4:54986587-54986609 TGGGCTGCAGCTGCCAGTGCTGG + Intergenic
974911374 4:68124611-68124633 TGGGGTCCTTCTGCCTGTTCAGG + Intronic
977994553 4:103485581-103485603 TGCTGTTCTGCAGCCAGTGCTGG + Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
985667156 5:1187199-1187221 TGGGGCGCTTGACCCTGTGCTGG + Intergenic
987081726 5:14431269-14431291 TGAGGTGTTCCAGCCACTGCTGG - Intronic
989419144 5:41215538-41215560 TGAGTTGCTTCAGCAACTGCAGG + Intronic
992957567 5:81925844-81925866 TGAGCAGTTTCAGCCAGTGCTGG + Intergenic
999049751 5:148509716-148509738 TGGGTTGCTTCTGCCTCTGCTGG - Exonic
999238833 5:150115725-150115747 GGGGGAGCTTCAGGCAGGGCAGG + Exonic
999443554 5:151621132-151621154 TGGGCTCCTGCAGCCAGTGAGGG + Intergenic
1002818122 6:697638-697660 TGGGATGATTCAGCTAGGGCAGG + Intergenic
1004895873 6:20147270-20147292 TGGATTACTTCTGCCAGTGCTGG - Intronic
1005269992 6:24153480-24153502 TGGGCTGCTTCAGCTAGGACAGG - Intronic
1006516934 6:34550425-34550447 TGGGGTGCTTGAGAGAGGGCAGG - Intronic
1006887093 6:37390937-37390959 GGTGGTGCTTCAGCCAATGATGG - Exonic
1007368370 6:41409869-41409891 TGGGGTGCTTGGGCCCGTGGAGG + Intergenic
1007658296 6:43466277-43466299 TGGGCTGCTCCAGCCCCTGCTGG + Intergenic
1019163174 6:170082319-170082341 TGGGGTGGTGCAGCGAATGCAGG + Intergenic
1019701588 7:2476981-2477003 TGGGGTGGCTGAGCCAGTGGGGG - Intergenic
1022992989 7:35726627-35726649 TGCTGTGCTTCCCCCAGTGCCGG - Intergenic
1026127716 7:67594200-67594222 TGGGGTGCCTCTGCCAGTCGGGG + Intergenic
1029047457 7:97645264-97645286 TGGCTTGCTTCAGCCATGGCTGG - Intergenic
1029212924 7:98923392-98923414 AGGTGTGCTGCAGCCAGTGCCGG - Intronic
1029350954 7:100012528-100012550 TGGGGTGCTGCTGCCAAGGCGGG - Intergenic
1030116069 7:106063200-106063222 TGGTGTGCAGCGGCCAGTGCAGG + Intergenic
1030116590 7:106066249-106066271 TGGTGTGCAGCGGCCAGTGCAGG + Intergenic
1035093928 7:156336900-156336922 TGAGGTGGTTAAGCCAGTGATGG - Intergenic
1037835021 8:22210633-22210655 GGGGGAGGTTCAGCCAATGCTGG - Intronic
1041699397 8:60771755-60771777 TGGGGGGCTTCAGTAATTGCTGG + Intronic
1041930980 8:63285933-63285955 TGGGGTCCTTCAGACAGTTTAGG + Intergenic
1042802276 8:72732627-72732649 TGAGATGTTTCAGCCATTGCTGG + Intronic
1043296160 8:78666074-78666096 TGGGTTGCTACAGCCAGAGCTGG + Exonic
1043485148 8:80691871-80691893 TGGTGTGCTTCAGCAAGGGGAGG - Intronic
1048463652 8:134643700-134643722 AGGGCTGATGCAGCCAGTGCCGG - Intronic
1048474893 8:134734154-134734176 TGGGCTGCTTCTGCCACTTCAGG + Intergenic
1049357218 8:142194939-142194961 TGGGGTGCTCCAGCCCGTCAGGG + Intergenic
1049693280 8:143972038-143972060 TGGGGTGCCCCAGCCTGTTCTGG - Intronic
1049797846 8:144504702-144504724 GGGGGTGCTCCGGGCAGTGCAGG - Intronic
1052405733 9:28058228-28058250 TGGGGTGCTGCCACCAGTGGTGG + Intronic
1057220956 9:93257461-93257483 TGGGGTCCTTCAGGGAGGGCGGG + Intronic
1057593295 9:96392486-96392508 AGGGGTGCTTCGGACAGTGGCGG + Exonic
1058464788 9:105216452-105216474 TGGTGTGCCTGACCCAGTGCTGG - Intergenic
1059749195 9:117231972-117231994 TGGGCTGCTTCCCCGAGTGCAGG - Intronic
1060557614 9:124517082-124517104 TTGGGCACTTCAGTCAGTGCTGG + Intergenic
1062016091 9:134292079-134292101 TGGGGTTCCTCTGCCAGGGCTGG + Intergenic
1062057073 9:134474320-134474342 TGGGCTGCTCCAGCCAGGGGAGG - Intergenic
1062283886 9:135764578-135764600 TGGGGAGCATGAGCCAGGGCAGG + Intronic
1187770135 X:22686417-22686439 AGGCTTGCGTCAGCCAGTGCAGG - Intergenic
1189719827 X:43904918-43904940 TGGGGTGCATTAGCCAGGGATGG + Intergenic
1193984796 X:88227734-88227756 TGGGGTGGTTAAGGGAGTGCTGG + Intergenic
1195343564 X:103926939-103926961 GGGGGTGCAGCAGCCAGAGCTGG - Intronic
1199210660 X:145206232-145206254 TGGGGTGGCTAAGGCAGTGCTGG + Intergenic
1200083757 X:153592685-153592707 TGTGGCGGTTCAGCCAGTTCTGG + Exonic