ID: 960049920

View in Genome Browser
Species Human (GRCh38)
Location 3:113229327-113229349
Sequence CACCAATGACTGCTTTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960049920_960049924 24 Left 960049920 3:113229327-113229349 CCTTGTTAAAGCAGTCATTGGTG 0: 1
1: 0
2: 2
3: 9
4: 114
Right 960049924 3:113229374-113229396 CGCTTAAATTTGCGCATGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960049920 Original CRISPR CACCAATGACTGCTTTAACA AGG (reversed) Intronic
903768470 1:25749512-25749534 GAGCAATGACTGATTAAACAGGG - Intronic
905651028 1:39657109-39657131 CCACAGTGACTGCTTTATCAGGG - Intergenic
908290106 1:62657158-62657180 CACCAATGCCTAGTGTAACAAGG + Intronic
915684622 1:157618888-157618910 CACCCATGACTGCATCAACTAGG - Intergenic
916864619 1:168842880-168842902 TACCAATGTCTGTTTAAACATGG - Intergenic
917273942 1:173310296-173310318 CTCCAAACACTGCTTTAGCAGGG + Intergenic
918691982 1:187492298-187492320 CTTCAATGACAGCTTTAACAAGG - Intergenic
919516968 1:198537707-198537729 CACAAATGACTATTTTAAAAAGG - Intronic
923082248 1:230669375-230669397 TTCCAGTGACTGCTGTAACATGG - Exonic
923160876 1:231313608-231313630 CAATAATGAGTCCTTTAACAAGG + Intergenic
1063433945 10:6015540-6015562 CAGCAATCTGTGCTTTAACAAGG + Intronic
1063851862 10:10201217-10201239 CACCTATGACTGCATTCCCATGG - Intergenic
1069762200 10:70819137-70819159 GAACAATGACTGCTTTTACTCGG + Intronic
1069969531 10:72154278-72154300 CACCAATGGCTGCTAAAACTTGG + Intronic
1071860468 10:89667455-89667477 TACCAATGTCTGCTACAACATGG - Intergenic
1076320253 10:129574691-129574713 CACCACTGACGGCTTGATCAGGG + Intronic
1078773265 11:14370805-14370827 CAGCAATCTGTGCTTTAACAAGG - Intergenic
1081640483 11:44749979-44750001 CCCCCATGCCTGCTTCAACAGGG - Intronic
1084370910 11:68742363-68742385 AACCAATGACTGCTTTAGTAGGG - Exonic
1088132320 11:106508245-106508267 AACCAAGGACTACTTTAACATGG + Intergenic
1089713206 11:120332382-120332404 CACCATTGACTTCAATAACATGG - Intronic
1090484465 11:127100465-127100487 CATTAATGACTGCATTAACTTGG - Intergenic
1091058622 11:132441468-132441490 CACCAAGGACTTTTTTAAAAAGG + Intronic
1094249197 12:28340318-28340340 CACCAAAGACTGAATAAACAAGG - Intronic
1099653797 12:85463565-85463587 TGCCAATGACTGCTTTTATATGG + Intergenic
1101123807 12:101610604-101610626 CAGGAATGAATGCATTAACAGGG - Intronic
1103856672 12:123974714-123974736 CATTTTTGACTGCTTTAACAAGG + Intronic
1107232488 13:38127163-38127185 GAACAATGACTAATTTAACATGG + Intergenic
1108017661 13:46093208-46093230 CACCAAGGATAACTTTAACAAGG + Intronic
1112459883 13:99594527-99594549 CCCAAATGTCTGCTTTATCAGGG + Intergenic
1113123855 13:106954846-106954868 CACCAATGTCTGCATGAAGAGGG - Intergenic
1119898313 14:78239197-78239219 AGGCAATGACTGCTTCAACACGG - Intergenic
1122477403 14:102020277-102020299 CACCACTGTCTGCTTACACAAGG + Intronic
1127460374 15:59193208-59193230 CAGCAATCTCAGCTTTAACAAGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131649754 15:94386149-94386171 CACCAAAGAATGCCTTTACATGG + Intronic
1131998589 15:98157653-98157675 CACCAGGGATTTCTTTAACATGG - Intergenic
1134683065 16:16139962-16139984 TATCTATGACTGCTTTCACACGG - Intronic
1141268601 16:82519354-82519376 CACCAATGCCTGCTTTGGGAAGG + Intergenic
1142721909 17:1782033-1782055 CACCAAGGGCAGCTTTACCAGGG + Intronic
1144712492 17:17411048-17411070 TAGCAATGACTGCTTCAACAGGG + Intergenic
1146548837 17:33762773-33762795 CAACCATGGCTGCTCTAACATGG - Intronic
1147146155 17:38485720-38485742 CACGAATGACTGCTGTGTCACGG + Intronic
1151777654 17:76218024-76218046 CACTAATGAATGCTTAAAAATGG + Intronic
1159071067 18:63624596-63624618 CTCCTATGGCTGCTTTGACAGGG + Intergenic
1165770495 19:38377161-38377183 CACCACTCCCTACTTTAACAGGG - Intronic
1166157889 19:40928522-40928544 CATCAATGACTCCTTTTACCTGG + Intergenic
925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG + Intergenic
928737277 2:34306738-34306760 CATCTATGCCTGCTTTATCAGGG - Intergenic
929677883 2:43955766-43955788 TACCAATAACTGATTCAACAAGG + Intronic
933790215 2:85878060-85878082 CACCAATGCCTGATTTTCCAAGG + Intronic
935858965 2:107306369-107306391 CATCAACGACTGCTTTCCCAAGG - Intergenic
937566865 2:123303857-123303879 CTGCAATGAATGATTTAACATGG - Intergenic
937863865 2:126733370-126733392 CACCATCAACTGCTTTACCAAGG - Intergenic
938188425 2:129253816-129253838 GACCACTGACTGCTTAGACATGG - Intergenic
939641792 2:144648543-144648565 CTTCAATGACTCCTTGAACATGG + Intergenic
939785476 2:146505747-146505769 CACCAATGATTTCTTGAACAAGG - Intergenic
939869342 2:147509568-147509590 CACCAATGACTAATTTTACAAGG + Intergenic
940760826 2:157737402-157737424 CCCAAATGGCTGCTTTGACAAGG - Exonic
947062971 2:226187443-226187465 CAGCAATCAGTGCTTTACCAAGG + Intergenic
948111069 2:235456413-235456435 CACTCTTGACTGCTTTAAAAGGG + Intergenic
1177114358 21:17067390-17067412 AACCAATGACTGGTTAATCATGG - Intergenic
1177689797 21:24490898-24490920 CACCAGTGAGTTCTTTAAAAAGG + Intergenic
1182200036 22:28559119-28559141 CAAAAATGACTGCTTGAAAATGG + Intronic
1183980793 22:41538960-41538982 CCCCAAAGACTGTTTTAACAAGG - Intronic
949421439 3:3870481-3870503 CACCAGAGACTGCTATAAGAGGG - Intronic
949478974 3:4475180-4475202 CAGCAATCATTGCTTTAAGAAGG - Intergenic
951575907 3:24113845-24113867 CACCAATGAGTGGTTTTGCATGG + Intergenic
952114117 3:30158918-30158940 CACCTTTGACTGGGTTAACATGG - Intergenic
952499141 3:33943284-33943306 CACTGATGACAGCTTGAACAAGG + Intergenic
953401830 3:42629556-42629578 TACAGTTGACTGCTTTAACATGG + Intronic
957964342 3:87303500-87303522 CACCAATTTCTGTTTTTACAGGG - Intergenic
959446632 3:106448612-106448634 CCCGAATCACTGCTTTAATATGG + Intergenic
960049920 3:113229327-113229349 CACCAATGACTGCTTTAACAAGG - Intronic
960223017 3:115138248-115138270 TTCCAAGGCCTGCTTTAACATGG + Intronic
962066161 3:131982470-131982492 AACCAATTACTGCTTTTATATGG - Intronic
964163344 3:153671943-153671965 TCCCAGTGACTGCTTGAACAAGG - Intergenic
965347988 3:167575944-167575966 CACAAGTGACTGCTTTCTCATGG + Exonic
968392049 4:201642-201664 CAACATTGAATGCTTTATCAGGG + Intergenic
970130300 4:12862318-12862340 CATCAATGTCTGCTTAAATAAGG - Intergenic
971784538 4:31083758-31083780 CACATCTGACTGCTTTGACAAGG - Intronic
974887525 4:67838411-67838433 CACAAATGAATTCTTTAAAAGGG - Intronic
976224925 4:82788340-82788362 TCCCAATGACTGGTTTACCAAGG + Intronic
982636121 4:157898911-157898933 CCCCAATGACTGCTTTAATAAGG - Intergenic
982664389 4:158243750-158243772 CACCAATGAATGCTAAAAAAAGG - Intronic
986420034 5:7570947-7570969 CAACAATCAATGCATTAACAAGG - Intronic
993876423 5:93312487-93312509 CAAAAATGACTGTTTTAAAATGG + Intergenic
995601378 5:113800652-113800674 AATCAAGGACGGCTTTAACATGG - Intergenic
995981136 5:118105696-118105718 CACTAATGCCTGCAGTAACATGG - Intergenic
996432118 5:123392806-123392828 CACCAATGTTTGCTTTTAAATGG + Intronic
999708942 5:154299259-154299281 CAGCAATCAGTGTTTTAACAAGG + Intronic
1002285285 5:178158607-178158629 CACTAATAAATGCTGTAACATGG - Intergenic
1003568114 6:7237624-7237646 CACGAATAACTGCTTTAGAAGGG - Intronic
1007295418 6:40817198-40817220 CACCAATGACTCCTTGGAAAGGG - Intergenic
1010959961 6:82134612-82134634 CACCACTGACTGCTTTGGCCAGG + Intergenic
1012663572 6:101936734-101936756 CACCATTGATGGCTTTAACTTGG - Intronic
1014760110 6:125346693-125346715 CCCCAAGGACTGCTTTAACAAGG - Intergenic
1020077240 7:5266445-5266467 CCCAAATGACTGCTTTCTCAAGG - Intergenic
1020484202 7:8701282-8701304 TCCCAATGACATCTTTAACATGG - Intronic
1024398631 7:48897709-48897731 GACAAATGACTGCTTTCAGATGG - Intergenic
1033369163 7:140693677-140693699 CACAATTGACTGCTCAAACAGGG - Intronic
1033648870 7:143324853-143324875 CACCGATGACATCTCTAACAGGG + Intronic
1034221593 7:149450691-149450713 CACTAATGACTGCTTGACAAGGG + Intronic
1034348223 7:150399824-150399846 CATCAAACCCTGCTTTAACAGGG + Intronic
1037177499 8:15964072-15964094 CAAGAATTAATGCTTTAACAGGG + Intergenic
1042918898 8:73902203-73902225 CACCAATCACTTCTTCAACATGG - Intergenic
1043019375 8:74982344-74982366 CACCAGTGACTGATTTAGCATGG - Intergenic
1043331065 8:79119641-79119663 CATCAATGACAGCTTTAAGCAGG + Intergenic
1043751248 8:83937878-83937900 CACTGATGAATGCTTCAACATGG - Intergenic
1050682607 9:8130867-8130889 CATCATTGACTAATTTAACAAGG - Intergenic
1050875936 9:10636472-10636494 AAGAAATGACTGCTTTAAAAAGG + Intergenic
1051207812 9:14707653-14707675 CACAAAAGACTGTTCTAACAGGG + Intergenic
1057837574 9:98457708-98457730 CAGCAACGACTTCTTTAACCTGG - Intronic
1058948326 9:109879595-109879617 CAGCAATTACTGCTTTGAGAAGG - Intronic
1059155388 9:111984465-111984487 CAACAATGTCTGGTTAAACAAGG - Intergenic
1059536628 9:115086764-115086786 CCCCAATGACTGCTTCGACCGGG - Exonic
1186662847 X:11686806-11686828 CAACAATGAATGCTTTTTCAGGG + Intergenic
1188568812 X:31557467-31557489 CACAACTGTCTGTTTTAACAAGG + Intronic
1189534162 X:41919851-41919873 CCTCAAAGACAGCTTTAACAAGG + Intronic
1192820864 X:74643639-74643661 AACCACTGAATGCTTTAAAATGG - Intergenic
1194985388 X:100484608-100484630 CTCCACTGACTGCTTTCAGAAGG - Intergenic
1195023802 X:100855529-100855551 CAGCTATGACAGCTGTAACAAGG - Intronic
1195503448 X:105629872-105629894 CTCCAATGCCTGCTTTTATAAGG - Intronic
1196028093 X:111063836-111063858 AATCAATGACTCCTTAAACATGG + Intronic
1200269914 X:154673192-154673214 CACCAAAGACTGCTTGTATATGG - Intergenic
1201676611 Y:16593178-16593200 CACCAATCACTGCCTTGTCAGGG + Intergenic