ID: 960050398

View in Genome Browser
Species Human (GRCh38)
Location 3:113233811-113233833
Sequence CCTTCCAAGCATGGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960050398_960050408 19 Left 960050398 3:113233811-113233833 CCACCCACCCCATGCTTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 274
Right 960050408 3:113233853-113233875 TCTCCACTAATTAAGAACCACGG 0: 1
1: 0
2: 0
3: 7
4: 119
960050398_960050410 22 Left 960050398 3:113233811-113233833 CCACCCACCCCATGCTTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 274
Right 960050410 3:113233856-113233878 CCACTAATTAAGAACCACGGCGG 0: 1
1: 0
2: 0
3: 4
4: 47
960050398_960050411 23 Left 960050398 3:113233811-113233833 CCACCCACCCCATGCTTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 274
Right 960050411 3:113233857-113233879 CACTAATTAAGAACCACGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960050398 Original CRISPR CCTTCCAAGCATGGGGTGGG TGG (reversed) Intronic
900345288 1:2207577-2207599 CCTGCCAGGCATGGTGTGCGCGG - Intronic
901196823 1:7445030-7445052 CCTCCCTAGCACGGGGTAGGAGG + Intronic
901239998 1:7687372-7687394 CCCTCCAAGCAGGGGGAGGTGGG + Intronic
902600080 1:17534969-17534991 TTTTCCATGGATGGGGTGGGGGG + Intergenic
903711288 1:25326650-25326672 CATTCCAAGCAAGAGGAGGGGGG + Intronic
903715660 1:25364779-25364801 CATTCCAAGCAAGAGGAGGGGGG - Intronic
903753999 1:25647957-25647979 TCTTTCCAGCAAGGGGTGGGAGG - Intronic
904970502 1:34415907-34415929 CCTTCCCAACATAGGGTGGAAGG + Intergenic
905284040 1:36867875-36867897 CATTCCAAGGCCGGGGTGGGGGG + Intronic
906044883 1:42820960-42820982 CCTTCCAGGCTTGGGATGGGAGG - Intronic
906058188 1:42931942-42931964 CCTCCCCAGCAAGGGGTTGGGGG - Intronic
907685835 1:56610098-56610120 GCTTCCAAGCATGTGATGGGTGG + Intronic
911649906 1:100376141-100376163 CCTGCCTGTCATGGGGTGGGGGG + Intronic
912452264 1:109774334-109774356 CTTCCCAGGCATGGTGTGGGTGG - Intronic
913530391 1:119729843-119729865 CATTCCCAGCATGGTGTGGAGGG + Intronic
914734060 1:150399108-150399130 ACTCCAAAGGATGGGGTGGGAGG - Intronic
914802547 1:150972057-150972079 CCTGCAAAACAGGGGGTGGGGGG + Intronic
915147676 1:153805021-153805043 CCTTCCCTGAATAGGGTGGGTGG - Exonic
915742087 1:158126466-158126488 CCTCCCAAGCATGGTGTGCTTGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917531562 1:175840747-175840769 CCCTCCAAGAATTGGGTGAGTGG + Intergenic
918150362 1:181793147-181793169 CCATCCAAAGATGTGGTGGGTGG - Intronic
918486308 1:185032278-185032300 CCTTCTAGGCATGGGGGTGGGGG - Intergenic
918510908 1:185313478-185313500 CCCTCCAAACTTGAGGTGGGCGG - Intronic
919793232 1:201305719-201305741 ACTTCCCAGTATAGGGTGGGGGG + Intronic
919850442 1:201668634-201668656 CCTTCCAAGCAGTGGGGTGGGGG - Intronic
919879216 1:201891251-201891273 TCTGCCAAGCAGGGTGTGGGAGG + Intronic
920422299 1:205843376-205843398 CCTTCCAAGGTGGGGGTTGGGGG - Intronic
922219006 1:223543663-223543685 CCTTCCAATGAAGGGATGGGGGG - Intronic
923347047 1:233064617-233064639 CCTGGGAAGAATGGGGTGGGTGG - Intronic
924448461 1:244156123-244156145 CCTTTCAAACATCTGGTGGGGGG - Intergenic
924587903 1:245376065-245376087 CATTCCAAGCTGGGGGTGGGAGG + Intronic
1062966976 10:1615358-1615380 CCTCCCCAGCATGGGCTGGAGGG - Intronic
1063388460 10:5632212-5632234 CCATCCAAGTAAGTGGTGGGTGG - Intergenic
1067440535 10:46306955-46306977 CTGTCCCAGCAGGGGGTGGGGGG - Intronic
1069189245 10:65466858-65466880 ACTTCCAGGCCTGTGGTGGGAGG - Intergenic
1069638690 10:69941257-69941279 CCTGCCAGGTGTGGGGTGGGAGG + Intronic
1069981354 10:72255098-72255120 ACTTCCAGGCCTGGGGTGAGAGG - Intergenic
1070488119 10:76950567-76950589 CCATCCAGGCATGCAGTGGGTGG - Intronic
1072855672 10:98943515-98943537 CCTTCCTAGTATGATGTGGGGGG - Intronic
1073713151 10:106068972-106068994 CCTGCCATGCAGGGGGTGAGTGG - Intergenic
1074081374 10:110170541-110170563 CCTTCCAGGGGTGGGGGGGGCGG - Intergenic
1074404155 10:113166032-113166054 CCTTTCAAGGTGGGGGTGGGGGG - Exonic
1075233258 10:120702804-120702826 CCTGCCAAGCGTGGGCTGGTAGG + Intergenic
1077334146 11:1996045-1996067 CCTGCCACACTTGGGGTGGGGGG - Intergenic
1080475380 11:32585095-32585117 CATTCCTACCATGGGGCGGGGGG - Intronic
1080967083 11:37225162-37225184 ACTTCCAAGCCTGTGGTGGCAGG + Intergenic
1083264484 11:61540237-61540259 CCCTCCCTGCAAGGGGTGGGTGG + Intronic
1085387965 11:76167994-76168016 CCTTACAGCCCTGGGGTGGGAGG - Intergenic
1085607106 11:77911073-77911095 CCTGCCGAGCATGAGATGGGAGG - Intronic
1088751757 11:112847948-112847970 CCTTCCTAGCAAGGTGGGGGTGG - Intergenic
1090270377 11:125381646-125381668 GCTTGCAGGGATGGGGTGGGAGG - Intronic
1090629936 11:128637167-128637189 CTTCACAAGCCTGGGGTGGGAGG + Intergenic
1202817129 11_KI270721v1_random:51227-51249 CCTGCCACACTTGGGGTGGGGGG - Intergenic
1092918326 12:13208247-13208269 CCTTGCAAGTAATGGGTGGGTGG + Intronic
1093714137 12:22362284-22362306 TTTTCCATGCAAGGGGTGGGTGG - Intronic
1095190969 12:39257501-39257523 CCCTGCAAGCATGGGAAGGGAGG - Intergenic
1098000410 12:65936229-65936251 CCTTACAAGAATGTGGGGGGAGG + Intronic
1098450727 12:70615655-70615677 CCTTCCAAGGGTGGGGTGGCAGG - Intronic
1100554887 12:95683609-95683631 CCTTGCAAGCCTGGGGTGGCAGG - Exonic
1101247447 12:102897894-102897916 CTTTCCAAGAATGGGCTGTGGGG + Intronic
1101298935 12:103457770-103457792 CCCTCCTGGCAGGGGGTGGGGGG + Intronic
1102391937 12:112556407-112556429 TCTTATAAGCATGGGGAGGGAGG - Intergenic
1102460731 12:113098041-113098063 CCTGCCAAGAGAGGGGTGGGTGG + Intergenic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1103053871 12:117803378-117803400 GCTCCCCAGCATGGGGTCGGGGG - Intronic
1103597950 12:122035521-122035543 CATTCCAGGCAAGGGGTAGGAGG + Intronic
1103709370 12:122899986-122900008 CTTTGGAAGCCTGGGGTGGGAGG + Intergenic
1109614118 13:64808627-64808649 GCTTCCAGGCATGTGATGGGAGG - Intergenic
1110638192 13:77790728-77790750 TGTTGCAAGCTTGGGGTGGGAGG + Intergenic
1110872064 13:80463843-80463865 CCTGCCAAGAAGGGAGTGGGAGG + Intergenic
1111736181 13:92141998-92142020 CATTCCAAGCATGAGATGTGAGG - Intronic
1112706848 13:102080034-102080056 CCGGGCAAGGATGGGGTGGGAGG + Intronic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1116781406 14:49241343-49241365 AGTTGCAAGCCTGGGGTGGGAGG - Intergenic
1119441458 14:74631361-74631383 CCTGCCAACCCTGGGGAGGGAGG + Intergenic
1120947464 14:90011981-90012003 GCTTCCAGGCATGTGATGGGAGG - Intronic
1121646775 14:95523703-95523725 GCTTCCATCGATGGGGTGGGTGG + Intergenic
1122979598 14:105185609-105185631 CCTGCCAAGGATGAGATGGGAGG + Intergenic
1123854379 15:24393043-24393065 CCTTCTAATCATGGGGTTGTAGG + Intergenic
1124383944 15:29190574-29190596 CCTTCCAGGTATGGGAGGGGAGG + Intronic
1125882292 15:43205226-43205248 CTTTCCAAGCATGGGAGGAGTGG - Intronic
1126330709 15:47528019-47528041 CCATCCAGACATGGGGTGGGAGG + Intronic
1130908817 15:88257256-88257278 GCTCCCAAGCCTTGGGTGGGGGG + Intergenic
1132076201 15:98823061-98823083 TCTTCACAGCATGAGGTGGGGGG - Intronic
1132608623 16:803977-803999 ACTTCAAGGGATGGGGTGGGGGG + Intergenic
1132959244 16:2612918-2612940 CCTTGCAGGCATGTGGGGGGAGG + Intergenic
1132972304 16:2694893-2694915 CCTTGCAGGCATGTGGGGGGAGG + Intronic
1133436603 16:5785365-5785387 CCTTCCAGGCATGGGGGTGGTGG + Intergenic
1135398182 16:22147129-22147151 CCTTGCAAGGTTGAGGTGGGAGG - Intronic
1135549932 16:23390131-23390153 CTTTCCAAGCATGAACTGGGAGG - Intronic
1136230508 16:28882929-28882951 CTGACCAAGCTTGGGGTGGGTGG - Intronic
1136568568 16:31083865-31083887 CCTTCGAGGAATGGGGAGGGAGG - Exonic
1137455309 16:48613424-48613446 ACTTGGAAGCCTGGGGTGGGAGG + Intronic
1137675604 16:50302309-50302331 CCATCTCAGCACGGGGTGGGGGG - Intronic
1141440699 16:84027805-84027827 CCTTGCAAGCATCGGGGAGGCGG + Intronic
1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG + Intronic
1143835543 17:9689518-9689540 ACTTGCAAGGATGAGGTGGGAGG - Intronic
1144562141 17:16329593-16329615 CTTGCCGAGGATGGGGTGGGTGG - Intronic
1144668059 17:17115418-17115440 CCTTCCAGGCCTGGGTTGGCAGG + Intronic
1146585574 17:34078786-34078808 CCTTTCAAGCCTGGGCTGAGTGG - Intronic
1146672668 17:34752550-34752572 CCTGGCAGGCTTGGGGTGGGAGG - Intergenic
1147318958 17:39634561-39634583 CCTTCCTAGGATGGAGTGGGAGG + Intronic
1147513691 17:41096032-41096054 CCTTCCAGGGGTGGGGTGTGTGG + Intronic
1147958002 17:44148286-44148308 CCTGGCAAGCATGGAGTTGGAGG + Exonic
1148060361 17:44831711-44831733 TACTCCAAGCATGAGGTGGGAGG + Intergenic
1148482772 17:47970955-47970977 CATTCGGAGCCTGGGGTGGGCGG + Intronic
1148821751 17:50364027-50364049 CCTTCAGAGCAGGGGTTGGGGGG - Intergenic
1150281854 17:63933533-63933555 CCTTCCAACCATGGCATGGGAGG - Intergenic
1151786831 17:76279224-76279246 CCTTCCAGGCCGGGGGCGGGTGG - Intronic
1152529577 17:80909475-80909497 ACTTCCAAGGCTGAGGTGGGAGG - Intronic
1155065704 18:22267288-22267310 CCTTCCAGGCCTGTGGTTGGTGG + Intergenic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1160504230 18:79418068-79418090 CCCTGCCACCATGGGGTGGGTGG + Intronic
1161009631 19:1954055-1954077 GCTTCCTCCCATGGGGTGGGCGG + Intronic
1161313479 19:3607325-3607347 CCTTCCAGGGGTGGGGTGGGAGG + Intergenic
1162359491 19:10209685-10209707 CATTCCAGGCATGGGATTGGTGG - Intronic
1162400992 19:10446468-10446490 CCTTCCCAGCAGGGAGTCGGGGG + Intronic
1162819973 19:13216895-13216917 CCCTCAATGCCTGGGGTGGGGGG + Intronic
1163155376 19:15437283-15437305 GCTTCCTGGAATGGGGTGGGAGG - Intronic
1163233020 19:16016512-16016534 GCCTCCATCCATGGGGTGGGGGG + Intergenic
1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG + Intergenic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1165653454 19:37511435-37511457 CTTTGCAAGGATGAGGTGGGAGG + Intronic
1166033189 19:40148232-40148254 CCTTCCACGCATAGGGAGTGGGG + Intergenic
1167271929 19:48510845-48510867 TCATCCAAGCCTGGGGTGAGGGG - Intronic
1167643329 19:50693723-50693745 ACTTCTCAGCATGGGGAGGGGGG - Intronic
1168151874 19:54453570-54453592 CCTTCCCAGTATGGGATGGCCGG + Exonic
926084013 2:10009901-10009923 CTTTCCAAGCAGGAGGAGGGAGG + Intergenic
926220595 2:10933291-10933313 CCTTTCATTCATGGGGTGGTGGG - Intergenic
926228239 2:10983537-10983559 CCTCCGAAGCCTGGGGTGGAGGG - Intergenic
926381214 2:12291895-12291917 ACTTCTAAGCCTGAGGTGGGAGG + Intergenic
927487705 2:23500126-23500148 CCTTCCCAGCATGGTCTGGAAGG + Intronic
929658480 2:43758186-43758208 CTCTCCAAGCCAGGGGTGGGAGG + Intronic
930031282 2:47059516-47059538 CCTGCCAAGGATGGGGTGGGAGG - Intronic
930339689 2:50097093-50097115 CAATCCAAGAATGGGGTGAGGGG - Intronic
931791088 2:65664964-65664986 CCTTCTAAGCCTGGGCTGTGGGG + Intergenic
933967231 2:87440039-87440061 CCTTCTGAGCATGCAGTGGGAGG + Intergenic
934162982 2:89269990-89270012 CTTTCCATGCTTGGGGTGTGGGG + Intergenic
934204291 2:89912534-89912556 CTTTCCATGCTTGGGGTGTGGGG - Intergenic
936326564 2:111510456-111510478 CCTTCTGAGCATGCAGTGGGAGG - Intergenic
936379070 2:111968319-111968341 CCTTCCAAGGATGGGCATGGAGG + Intronic
938732652 2:134158531-134158553 CCTTCCAAGCCTGTGGGGGCTGG + Intronic
939326259 2:140693424-140693446 CCTTCGAAGGCTGAGGTGGGAGG - Intronic
940852384 2:158700957-158700979 CCTGCCAGACATGGGGTGGGAGG + Intergenic
942398222 2:175574551-175574573 CCTTCCAGGCATGTGCAGGGAGG - Intergenic
943372061 2:187028100-187028122 GCTTCCAGGCCTGGGATGGGAGG - Intergenic
945188782 2:207166042-207166064 ACTAGCAAGGATGGGGTGGGGGG - Intronic
946409724 2:219509977-219509999 CCTGACATGCATGGGGTGTGGGG + Intergenic
947580371 2:231312431-231312453 CCTTCCCTGCATGGGATGAGTGG + Intronic
948058558 2:235027341-235027363 CCTTCGGGGCCTGGGGTGGGTGG - Intronic
948253474 2:236549700-236549722 CCTTTCACCCATGGGTTGGGTGG - Intergenic
948681710 2:239639688-239639710 ACTTCAAAGGAGGGGGTGGGTGG - Intergenic
1169671281 20:8105779-8105801 CATCACAAGCTTGGGGTGGGAGG + Intergenic
1170525203 20:17229031-17229053 CTTGCCAAGTTTGGGGTGGGGGG - Intronic
1170850795 20:20002852-20002874 CCTTCCAAGCATGGGGAGTATGG - Intergenic
1170864702 20:20142963-20142985 CCCTCCATGCCTAGGGTGGGGGG + Intronic
1171049506 20:21842213-21842235 ACTTCCAGGTATGGGGTGGCTGG + Intergenic
1172038832 20:32029634-32029656 CCTTTCAGGCAGGGGTTGGGTGG + Intronic
1172198398 20:33107952-33107974 CCTTCCAAGCATGGGGCTGAGGG + Intronic
1173440245 20:43069098-43069120 CCTTCCAAGCTTGGGGCTGAGGG - Intronic
1173650850 20:44663128-44663150 CCTTCAAAGCAAGAGGAGGGAGG + Intergenic
1175904763 20:62374271-62374293 CCTGCCACGCCTGGTGTGGGAGG - Intergenic
1175950592 20:62581282-62581304 CAGTCCCAGCATGGGGTGGGGGG - Intergenic
1175950626 20:62581394-62581416 CAGTCCCAGCGTGGGGTGGGGGG - Intergenic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176515413 21:7780243-7780265 CCTTCCAGGCCTGGTGTGGAGGG - Intergenic
1178649441 21:34410255-34410277 CCTTCCAGGCCTGGTGTGGAGGG - Intergenic
1178899473 21:36587782-36587804 TCTTCCAGCCATGGGGTGGCAGG - Intergenic
1180833632 22:18919034-18919056 CCTTCCAAGTTTGGGGTGTCGGG + Intronic
1181066198 22:20307220-20307242 CCTTCCAAGTTTGGGGTGTCGGG - Intergenic
1181544745 22:23595744-23595766 ACTTCCAACCATGGTGAGGGAGG + Intergenic
1181815563 22:25434115-25434137 ACTTCCAACCATGGTGAGGGAGG - Intergenic
1182093220 22:27609882-27609904 ACTGCAAAGCATGGGCTGGGTGG - Intergenic
1182408401 22:30158791-30158813 CCTTGGAAGCCTGGGGTGGGAGG - Intronic
1183513650 22:38250676-38250698 CCTTCCAAGCAAGGTGTGGGGGG + Intronic
1183683552 22:39349366-39349388 CCCTCCAGGCTGGGGGTGGGAGG + Intergenic
1184512780 22:44942998-44943020 CCTTCTGAGGATGGGGGGGGGGG - Intronic
1185381780 22:50512027-50512049 CTTTCAAAGGATGAGGTGGGCGG - Intronic
1203283717 22_KI270734v1_random:144332-144354 CCTTCCAAGTTTGGGGTGTCGGG + Intergenic
949120864 3:382027-382049 CCTTCCATATGTGGGGTGGGGGG + Intronic
949472000 3:4406054-4406076 CTTTAGAAGCATGGGGCGGGCGG - Intronic
949715716 3:6929006-6929028 CTTTCCAAGCAGGTCGTGGGTGG - Intronic
949867580 3:8559061-8559083 CCCTCCAAGCAGGGGATGAGTGG + Intronic
950318282 3:12025155-12025177 CATTCCCATCATGGGGGGGGAGG + Intronic
951932692 3:27986362-27986384 ACTGCCAAGCTTGGGCTGGGAGG + Intergenic
952145711 3:30529852-30529874 TCTTCCAAACATTGGCTGGGTGG + Intergenic
952956745 3:38562376-38562398 CCTTCCCACCAGGGAGTGGGAGG - Intronic
953742199 3:45547574-45547596 CCTTCCAGGCCTGGGATGAGGGG + Exonic
955221417 3:57026424-57026446 CTGTGCAAGCGTGGGGTGGGAGG - Intronic
955989533 3:64611558-64611580 TCTTCCACAGATGGGGTGGGTGG + Intronic
959739129 3:109695603-109695625 AGTTGCAAGCCTGGGGTGGGAGG - Intergenic
960050398 3:113233811-113233833 CCTTCCAAGCATGGGGTGGGTGG - Intronic
960405465 3:117253902-117253924 GCTTACAAGCCTGGGGTGTGAGG - Intergenic
960580898 3:119277939-119277961 GTTTCCAAGCTTGTGGTGGGGGG - Intergenic
960597584 3:119420401-119420423 CTTTCCAAGCATGGAGAGGAGGG + Exonic
962154860 3:132935340-132935362 TTTTCCAAGGATGGGGTTGGGGG - Intergenic
963598404 3:147356741-147356763 GCTTCCTAGGATGGGATGGGGGG + Intergenic
965074896 3:163963839-163963861 GCTTCCAAGCCTGTGATGGGAGG - Intergenic
968475579 4:805194-805216 CCTTCCAAACATGGGCTCTGCGG - Intronic
968496387 4:919556-919578 CCTTCCAGGCCTGTGGTGTGTGG - Intronic
968590500 4:1456639-1456661 CCTTCCAGGCCTGTGATGGGAGG + Intergenic
971922656 4:32962415-32962437 TCTTTCAAGATTGGGGTGGGGGG - Intergenic
976576033 4:86672924-86672946 TTTTCCAAGGATGGGGTGGTGGG + Intronic
978534437 4:109746032-109746054 CCTTCTGAGCATGGGGTGCTGGG + Intronic
979060933 4:116059438-116059460 ACTTCCAAGCATGTGATGGGAGG + Intergenic
980724640 4:136742634-136742656 CCTTGCAAGCATGTTTTGGGAGG + Intergenic
982561061 4:156928332-156928354 ACTTGCAAGGCTGGGGTGGGAGG - Intronic
982832893 4:160086122-160086144 CCGTGAAAGCATGGGGAGGGAGG - Intergenic
984710301 4:182879115-182879137 CCTTCCCAGTTTGGGGTGTGAGG + Intergenic
984785619 4:183564940-183564962 CCTTGGAAGGATGAGGTGGGCGG - Intergenic
984995459 4:185426171-185426193 CATTCCAAGCACGCTGTGGGAGG - Intergenic
985569745 5:638547-638569 CCGTAGCAGCATGGGGTGGGGGG + Intronic
985636872 5:1040022-1040044 GCCTCACAGCATGGGGTGGGCGG + Intergenic
985657311 5:1139051-1139073 TCACCCAAGCTTGGGGTGGGGGG + Intergenic
986420726 5:7578807-7578829 CCTTGCAAACCTGTGGTGGGAGG + Intronic
988496257 5:31748641-31748663 CATTCCTGGCAAGGGGTGGGTGG + Intronic
988579837 5:32459143-32459165 GCTTCCAGGCATGTGATGGGAGG + Intergenic
989192072 5:38680210-38680232 CTAACCAAGCTTGGGGTGGGGGG + Intergenic
989193760 5:38695823-38695845 GCTTCCAAGCAGGCTGTGGGCGG + Intergenic
992266447 5:75022998-75023020 CCTTTCAACTATGGGGTGGTGGG - Intergenic
992582885 5:78200222-78200244 ACTGCCAAGCAGGGGGAGGGGGG + Intronic
994125025 5:96159283-96159305 CCATCCCAGCATGAGGAGGGAGG - Intergenic
994303128 5:98171068-98171090 GTTTCCATGCATGGGGTCGGGGG + Intergenic
995717326 5:115092882-115092904 GCTTCCAAGAAGGTGGTGGGCGG - Intergenic
998367190 5:141639102-141639124 CCTTGCATGTATGGGGTTGGGGG + Intronic
999056906 5:148587684-148587706 CTTTCCAAGCAGGGTGTGTGGGG + Intronic
999189876 5:149739466-149739488 CCTTCCAGGCTTGGGGCAGGGGG + Intronic
999721008 5:154399307-154399329 CCTTCCAAGGACGGGCTAGGGGG - Intronic
1002301312 5:178258801-178258823 ACTTCCAAGGCTGAGGTGGGAGG - Intronic
1002314599 5:178334937-178334959 CCATCCAAGTCTGGGGTGTGGGG - Intronic
1002535111 5:179871836-179871858 CCTTCCCAGGATGGGCTTGGGGG + Intronic
1003390071 6:5706046-5706068 TTTTCCATGGATGGGGTGGGTGG + Intronic
1004380946 6:15132025-15132047 CCCTCACAGCCTGGGGTGGGGGG - Intergenic
1006416970 6:33910444-33910466 ATCTCCAGGCATGGGGTGGGAGG + Intergenic
1006934331 6:37706711-37706733 CCTTGGAAGCCTGAGGTGGGAGG + Intergenic
1007910718 6:45511656-45511678 CCTTTCTAGCATGGGGTGAAGGG - Intronic
1011038211 6:83000771-83000793 GCTTCTAGGCAAGGGGTGGGAGG - Intronic
1013145901 6:107391474-107391496 TATTCCAAGCAGGGGATGGGGGG + Intronic
1015868723 6:137754119-137754141 CCATCCCTGCATGGGGTGTGTGG - Intergenic
1016177553 6:141099027-141099049 ACCTCCAAGCCTGTGGTGGGAGG - Intergenic
1016528448 6:145030969-145030991 CCTTCCAGGGGTGGGGTGGAAGG - Intergenic
1017010410 6:150059539-150059561 GCTTTCAAGAATGGGGTTGGAGG - Intergenic
1017503637 6:155047629-155047651 CCTTCTAAGGCAGGGGTGGGGGG + Intronic
1017547592 6:155468518-155468540 GCCTCCAGGCATGTGGTGGGAGG + Intergenic
1019739356 7:2665038-2665060 CTCTCCAGGGATGGGGTGGGCGG + Intergenic
1019810982 7:3165011-3165033 CCTTCCAAGCAGGATGGGGGTGG + Intronic
1021082925 7:16384794-16384816 TCCTCCAGGGATGGGGTGGGAGG + Intronic
1024072850 7:45801018-45801040 CTTTACAAGGATGAGGTGGGAGG - Intergenic
1024659363 7:51478245-51478267 CCGTCAGGGCATGGGGTGGGGGG + Intergenic
1024755024 7:52519047-52519069 CCTTCCAAGCCTATGATGGGAGG + Intergenic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1025845897 7:65197145-65197167 CCCACCAAGCATGAGATGGGAGG + Intergenic
1025859447 7:65312689-65312711 GCTTCCAGGCATGGGTGGGGTGG + Intergenic
1025896122 7:65702857-65702879 CCCACCAAGCATGAGATGGGAGG + Intergenic
1025982789 7:66420968-66420990 CCTGCGAAGTAAGGGGTGGGGGG - Intergenic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1027171931 7:75878884-75878906 CCTCCCACGCACGGGGGGGGGGG + Intronic
1027433875 7:78143098-78143120 CTTTCCAATCAAGGGGTGGAAGG + Intronic
1029549860 7:101232046-101232068 CCGGCCAAGCAAGGGGTGAGGGG - Intergenic
1031100497 7:117474104-117474126 TCTTCCATGAATGGGGTGGAGGG + Intronic
1031318541 7:120289737-120289759 GCTTCCAAGCATGGTGTGTGTGG - Intronic
1033639614 7:143248929-143248951 TCTTCCAGGCCTGGGGAGGGAGG + Intronic
1034750092 7:153560273-153560295 GCTTCCAAGTCTGTGGTGGGAGG + Intergenic
1036463292 8:8973345-8973367 CTTTCCAAACGTGGGGAGGGGGG + Intergenic
1037419434 8:18686759-18686781 CCTTCCATGCATGGGCTGAGTGG - Intronic
1037834538 8:22208392-22208414 AGTTCCTAGTATGGGGTGGGGGG - Intronic
1039071337 8:33651901-33651923 GCCTCCAAGCCTGTGGTGGGAGG - Intergenic
1039257523 8:35735242-35735264 CTCTCCAACCATGGGGTCGGGGG - Intronic
1041715366 8:60927248-60927270 CCTTCCAGGAATGGGGAGGAGGG - Intergenic
1043136788 8:76537462-76537484 TCTTCCCAGTATTGGGTGGGGGG + Intergenic
1045247983 8:100460044-100460066 CCTTCCACGCCTGGGGCGGCTGG - Intergenic
1045314026 8:101027759-101027781 CCTTGGAAGCATGGTGTGGGGGG + Intergenic
1046709700 8:117496536-117496558 CATCACAAGCCTGGGGTGGGAGG - Intergenic
1047691069 8:127355162-127355184 CAATCCCAGCATGGGGTGGGTGG + Intergenic
1048174662 8:132140836-132140858 CAATCCAATCATGGGGCGGGGGG + Intronic
1048373963 8:133805462-133805484 CCTGTTAAGCATGGGGAGGGTGG + Intergenic
1049231934 8:141489035-141489057 CCTGCTAATCCTGGGGTGGGAGG + Intergenic
1050729841 9:8696434-8696456 CCCTCCAGTCTTGGGGTGGGGGG + Intronic
1051766972 9:20535310-20535332 TTTTCCATGGATGGGGTGGGGGG - Intronic
1053073442 9:35114611-35114633 GCTTCCAAGCCTGGAGTGTGGGG + Intronic
1056963552 9:91147331-91147353 ACTTCAAATCCTGGGGTGGGTGG + Intergenic
1057891623 9:98874240-98874262 CCTCCTAAGCTTGGGGTGGAAGG + Intergenic
1059342131 9:113603229-113603251 CATTCCAAGGAAGGGGAGGGTGG + Intergenic
1062338572 9:136083342-136083364 CCTTCCCAGGCTGGGTTGGGGGG + Intronic
1062400401 9:136370209-136370231 CCTTCCAGGCACGGAGTGGGCGG + Intronic
1062721289 9:138045611-138045633 CCTGCAAAGCCTGGGGTGGCTGG + Intronic
1186486545 X:9938048-9938070 TGTTCCAAGCATCTGGTGGGTGG + Intronic
1186802812 X:13110611-13110633 CCTTCCAAGCACGGGCGGAGGGG - Intergenic
1188357388 X:29208813-29208835 AACTCCAAGCAAGGGGTGGGAGG + Intronic
1189127135 X:38460754-38460776 CATTCCAAAGACGGGGTGGGAGG + Intronic
1189436535 X:40997870-40997892 CAATCCAGTCATGGGGTGGGTGG + Intergenic
1190296670 X:49031630-49031652 AGTTCTAAGCATGTGGTGGGAGG - Intronic
1194790463 X:98142194-98142216 ATTTCTAAGCAAGGGGTGGGGGG - Intergenic
1195416118 X:104621356-104621378 CATTGCAAGCCTGGGGTAGGAGG + Intronic
1195765585 X:108293452-108293474 CATTCTAAGCATGGGCAGGGTGG - Intronic
1195944201 X:110191852-110191874 TTTTCCACGGATGGGGTGGGTGG + Intergenic
1197198775 X:123731294-123731316 CATTCTAAGCATAGGCTGGGGGG + Intronic
1200079247 X:153567432-153567454 CTGCCCAAGCCTGGGGTGGGGGG + Intronic
1200207998 X:154331778-154331800 CCTTTCAAGAGTGTGGTGGGGGG + Intergenic