ID: 960051434

View in Genome Browser
Species Human (GRCh38)
Location 3:113242441-113242463
Sequence GTGTTTTAGCAGAAGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960051427_960051434 22 Left 960051427 3:113242396-113242418 CCAGTAACTTTTTCCTCCAGTGC 0: 1
1: 2
2: 6
3: 21
4: 169
Right 960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 231
960051426_960051434 23 Left 960051426 3:113242395-113242417 CCCAGTAACTTTTTCCTCCAGTG 0: 1
1: 0
2: 1
3: 16
4: 266
Right 960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 231
960051425_960051434 24 Left 960051425 3:113242394-113242416 CCCCAGTAACTTTTTCCTCCAGT 0: 1
1: 0
2: 1
3: 27
4: 261
Right 960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 231
960051433_960051434 6 Left 960051433 3:113242412-113242434 CCAGTGCTGGAGCAGGGAGAGGA 0: 1
1: 2
2: 7
3: 70
4: 505
Right 960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 231
960051431_960051434 9 Left 960051431 3:113242409-113242431 CCTCCAGTGCTGGAGCAGGGAGA 0: 1
1: 0
2: 1
3: 42
4: 333
Right 960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960051434 Original CRISPR GTGTTTTAGCAGAAGCTCTG TGG Intronic
901304074 1:8219729-8219751 GTGTTTAAGGAGAATCTTTGGGG + Intergenic
901494909 1:9615321-9615343 GTGTCACAGCACAAGCTCTGGGG + Intergenic
902249232 1:15142497-15142519 ATGTTATAGAATAAGCTCTGTGG - Intergenic
903441959 1:23394876-23394898 GTGTTTGGACAGAAACTCTGTGG - Intronic
903956964 1:27032346-27032368 ATGTTTTAGGAGAAGCTTTCTGG + Intergenic
905224155 1:36468187-36468209 GTGCTTTAGATGCAGCTCTGGGG + Exonic
905377951 1:37537463-37537485 GTGTTTTAGTAGAAGTGTTGTGG - Exonic
905461391 1:38125173-38125195 GTGTTTTAACAAACCCTCTGGGG + Intergenic
906190032 1:43892888-43892910 ATGTTTTGCCAGAGGCTCTGAGG - Intronic
908683423 1:66687949-66687971 GTGTTTTAGGAGAGTCCCTGGGG - Intronic
909749883 1:79145627-79145649 GTGTTTTATCATCAGCTATGTGG + Intergenic
912283788 1:108346564-108346586 GTTTGTTGGAAGAAGCTCTGCGG + Intergenic
912729160 1:112086534-112086556 GTGTTAGAGCAGCAGCTTTGTGG - Intergenic
913532037 1:119740438-119740460 TTGGTCTGGCAGAAGCTCTGGGG + Exonic
915286589 1:154857272-154857294 GTGTTCTTGCCGCAGCTCTGTGG - Intronic
917332778 1:173899337-173899359 GTGTTATAGCAAAAGATCAGGGG - Exonic
917877017 1:179295024-179295046 GGGTTTTGGAAGGAGCTCTGTGG + Intronic
919855717 1:201704730-201704752 CTGTTGAATCAGAAGCTCTGGGG + Intronic
920081932 1:203381224-203381246 GTGATTTTTCAGAAGCTCAGAGG - Intergenic
921525249 1:216209495-216209517 GTGAATTAGCAATAGCTCTGGGG - Intronic
922942044 1:229475722-229475744 GTGTTTTAACAGAAGCACCTGGG - Exonic
1063116612 10:3076289-3076311 GTGTTTTTGCGAAGGCTCTGAGG + Intronic
1065756585 10:28936297-28936319 GTGCTCTAGCAAAAGCACTGTGG + Intergenic
1066551345 10:36561218-36561240 GTGGTTTGCCAGGAGCTCTGGGG - Intergenic
1067837056 10:49648046-49648068 GAGTTTGGGGAGAAGCTCTGTGG + Intronic
1070650806 10:78234781-78234803 GTGTTTTAGCACACTCTCTCTGG - Intergenic
1070803564 10:79257282-79257304 GTGTATTAGCAGAGGCTCAGAGG - Intronic
1072235914 10:93453597-93453619 GTGTTCTAAGAGAAGCTCTGAGG - Intronic
1072279805 10:93855459-93855481 GAGTTTTAGCAGAAACTCAAAGG - Intergenic
1074941051 10:118236268-118236290 GTTCTTCAGCAGAAGGTCTGTGG + Intergenic
1076707525 10:132309770-132309792 GTGTTTTGGGAGGAGCCCTGGGG - Intronic
1076767005 10:132641559-132641581 GTCTTTCAGCAGAAGCTCCAGGG + Intronic
1078424977 11:11242254-11242276 GTTTTTGTGCAGGAGCTCTGGGG + Intergenic
1081700905 11:45152026-45152048 GTATTTGAGCAGAAGTCCTGGGG - Intronic
1081744752 11:45464993-45465015 GTGTTTTAGTAGAAGCCATCTGG - Intergenic
1082146117 11:48671614-48671636 CTGTTTTGGCAGAATCTGTGAGG + Intergenic
1082559436 11:54601091-54601113 GTGTCTGAGCAGCTGCTCTGTGG + Intergenic
1082588961 11:54981261-54981283 CTGTTTTGGCAGAATCTGTGAGG + Intergenic
1082879600 11:58024943-58024965 TTTTTTTGTCAGAAGCTCTGGGG + Intronic
1086878902 11:92131235-92131257 GTGTTTTTCCAGAAGCTTTCTGG + Intergenic
1088374192 11:109121812-109121834 AAATTGTAGCAGAAGCTCTGGGG - Intergenic
1088984379 11:114892659-114892681 GTGGTTTAGCAGCAACCCTGGGG - Intergenic
1090558434 11:127902164-127902186 GTGTTTTAGCAGAACCTTTCTGG + Intergenic
1090985984 11:131766512-131766534 GTATTTGAGCAGGAACTCTGGGG + Intronic
1092081550 12:5720642-5720664 GTGTTTTCCCAGAAGCCATGAGG + Intronic
1094267137 12:28572138-28572160 GTATTTTAGCAGAAGATCACAGG + Intronic
1094290731 12:28846276-28846298 GTGTTTTAGAAAGAGCACTGTGG - Intergenic
1095079192 12:37976847-37976869 CTGTTTTTGTAGAAACTCTGAGG + Intergenic
1096449814 12:51728987-51729009 GTGTTTTGGCAGAAACTCAAAGG - Intronic
1098681075 12:73355413-73355435 GTATTTTAGCACACACTCTGAGG + Intergenic
1099723723 12:86398203-86398225 ATGTTTTAGCAGAGGCTGTAGGG + Intronic
1102105656 12:110320128-110320150 GTGTTTCAGTGGAAGCTCAGAGG - Intronic
1106131125 13:26940415-26940437 GTGTTTTTGCAGGAGTTCAGGGG - Intergenic
1106439396 13:29752096-29752118 GTGTTCAAGCAGAAGCTGTCAGG - Intergenic
1107064486 13:36197793-36197815 ATGTTGCAGCAGGAGCTCTGTGG - Intronic
1107079345 13:36357528-36357550 GTGTTTAAACAGAAGTTCTGTGG - Intronic
1107415586 13:40197101-40197123 GTGTCTCAGCAGAACATCTGAGG + Intergenic
1109942904 13:69394711-69394733 GTGTTTCAGCAGGATGTCTGAGG - Intergenic
1111250717 13:85597550-85597572 GAGTGCTAGCTGAAGCTCTGTGG + Intergenic
1111558675 13:89914324-89914346 GTGGTTTACCAGAGGCTCTTGGG - Intergenic
1111602646 13:90494599-90494621 GTATTTCATAAGAAGCTCTGTGG + Intergenic
1112819883 13:103320198-103320220 GAGTTTTAGTTGAAACTCTGTGG + Intergenic
1113073044 13:106439794-106439816 GTGTATTAGGAGAATCACTGGGG + Intergenic
1113596492 13:111537642-111537664 GCGTGTTTGCAGAGGCTCTGGGG - Intergenic
1113817459 13:113183840-113183862 CTGTTTAAACAGGAGCTCTGTGG + Intronic
1117772043 14:59143270-59143292 GTGTTTTAGCAGTAGCCTTTGGG - Intergenic
1119931336 14:78550507-78550529 GTGTTTTAAAAGAAAATCTGAGG + Intronic
1121439418 14:93939426-93939448 GTGTTGCAGCAGCAGCTCGGTGG + Exonic
1121885855 14:97542174-97542196 GTGTGTTAGCAGAAGCTGGAGGG - Intergenic
1122727472 14:103767569-103767591 GTGTTTTAGAAAGATCTCTGTGG - Intronic
1124619498 15:31265744-31265766 CTGTCTAGGCAGAAGCTCTGGGG + Intergenic
1125490237 15:40141994-40142016 GGGTTTTAACAGGAGCACTGTGG - Intergenic
1125723908 15:41858519-41858541 GTGGTTCAGCACCAGCTCTGGGG + Intronic
1127366728 15:58298453-58298475 GTGTTTCATCAGAACATCTGGGG - Intronic
1128526462 15:68415500-68415522 ATTTCTTAGCAGAATCTCTGGGG + Intronic
1131662625 15:94534761-94534783 GTGTTTTGGCTGAATATCTGGGG + Intergenic
1132407982 15:101556170-101556192 GGGGTACAGCAGAAGCTCTGAGG - Intergenic
1138241685 16:55432461-55432483 GTGATCTAGGACAAGCTCTGGGG + Intronic
1139875609 16:70143713-70143735 GTGCTGTAGCAGAGGCTCTCAGG + Intronic
1140544428 16:75792555-75792577 GTGTGTTAGCAGCAGTTCAGTGG + Intergenic
1140717394 16:77739110-77739132 GTGAGTTATCAGAAGCCCTGGGG - Intronic
1141324244 16:83040450-83040472 GAGATTTGCCAGAAGCTCTGGGG - Intronic
1146457973 17:33021854-33021876 GTGTTCTGGCAGAAGCACCGCGG + Intronic
1147460048 17:40562541-40562563 GTGTTTTGGAAGGAGTTCTGTGG - Intronic
1148169600 17:45508069-45508091 GTGTTTTTGCAGGAGGCCTGAGG + Intergenic
1148365747 17:47054587-47054609 GTGTTTTTGCAGGAGGCCTGAGG - Intergenic
1149026072 17:52028902-52028924 GAGTTTTAGCGTAAGCTATGTGG - Intronic
1151067242 17:71164755-71164777 GGCATTTAGCAGAATCTCTGCGG - Intergenic
1155313105 18:24544370-24544392 CTTGTTTTGCAGAAGCTCTGGGG - Intergenic
1155615266 18:27714784-27714806 GTGTTTTGGCAGAAACTCAAAGG - Intergenic
1155646164 18:28080373-28080395 GTGTTTTAACATAATTTCTGTGG - Intronic
1159252932 18:65905393-65905415 GTTTTTCTGCAGAGGCTCTGAGG - Intergenic
1159460071 18:68713215-68713237 ATGTTTTAGCAGAAGTGCTCAGG + Intronic
1160076456 18:75681822-75681844 GTGTTTGGGGAGAAGCTCTGAGG + Intergenic
1161658292 19:5529631-5529653 GTGTTTGAGCAGTGGCTCTGTGG + Intergenic
1161839695 19:6672071-6672093 GTGTCTTAGCCTAAGCTCAGGGG - Intergenic
1163245397 19:16090564-16090586 ATGTTTAAGCAGAAGCTCAAAGG - Intronic
1163838002 19:19587683-19587705 ATGTTCTTGCAGCAGCTCTGTGG - Intronic
1164364887 19:27567481-27567503 GTGTTTTTGGAGAATCTCAGAGG + Intergenic
1165943766 19:39428956-39428978 CTGATTTAGCTGTAGCTCTGAGG - Intergenic
926054296 2:9765375-9765397 GAGTTTTAGCAGAGGCTGGGTGG + Intergenic
926304950 2:11631165-11631187 GTGTTGTGGCAGGTGCTCTGAGG + Intronic
929033820 2:37672240-37672262 GGGTTTTGGCTGCAGCTCTGAGG - Intronic
929867756 2:45732981-45733003 TTGTTTTCGCAGAGACTCTGTGG - Intronic
929932720 2:46271356-46271378 GGGTTCTTGCAGAAGCTTTGGGG - Intergenic
931729074 2:65137158-65137180 GTGTTTTAGAAGGAACTCTTGGG + Intergenic
932950229 2:76284396-76284418 GTATTTTAGCAACATCTCTGAGG + Intergenic
933030380 2:77321173-77321195 TTGTTTTATCAAAAGATCTGAGG - Intronic
933993325 2:87649377-87649399 GTGTTTTGGCAGAAACTCAGAGG + Intergenic
934729618 2:96648381-96648403 GTGTTTTGGCAGAGACTCAGAGG + Intergenic
936300532 2:111301506-111301528 GTGTTTTGGCAGAAACTCAGAGG - Intergenic
936513441 2:113167051-113167073 GTGTTTCAGCAGATGTTTTGTGG + Intronic
937638600 2:124186063-124186085 GTGTTTTAGCAAATCCTCCGGGG - Intronic
939739547 2:145888422-145888444 GTGGTGTAGCAGACGTTCTGTGG + Intergenic
939955110 2:148521353-148521375 GGGTTTTAGCAGAGCCTCTGTGG + Intergenic
940832885 2:158487860-158487882 GTTTTTTAAGAGAAGCTCTTTGG + Intronic
941293968 2:163713013-163713035 ATATTTTAGCAAAAACTCTGAGG + Intronic
941431664 2:165421479-165421501 GTGTGGTAGCAGAAGCTGAGAGG - Intergenic
942219858 2:173758348-173758370 CTGTGTTAGCAGAGGGTCTGAGG + Intergenic
944169729 2:196761289-196761311 GGGTTTTAGCAGAGTCTGTGAGG - Intronic
946978978 2:225186012-225186034 GTTTTTTTGCAGAAGGTGTGAGG - Intergenic
947625833 2:231618059-231618081 GTGCTGTAGCAGAGGCTCGGGGG + Intergenic
948373116 2:237503299-237503321 ATGTTTTAGGAGATACTCTGAGG + Intronic
948583251 2:239002573-239002595 GTGATTTAGCCGATGCTCTGTGG - Intergenic
948881869 2:240862669-240862691 GAGTTTTAGCCCAAGATCTGGGG + Intergenic
1169596632 20:7207493-7207515 GTCTTAAAACAGAAGCTCTGCGG - Intergenic
1169879327 20:10329273-10329295 GGGCTTTAGCAGAAGGTCTGCGG + Intergenic
1170020053 20:11827566-11827588 CTGTGTTAGAAGAAACTCTGTGG - Intergenic
1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG + Intergenic
1173821903 20:46025038-46025060 GTGTTCTAGCTCAGGCTCTGTGG + Intronic
1176588942 21:8621350-8621372 GTGTTTTAACAGAATTTCTCTGG - Intergenic
1177111729 21:17036832-17036854 GTGCTTTAGTTGAAGCTATGTGG - Intergenic
1180271769 22:10598347-10598369 GTGTTTTAACAGAATTTCTCTGG - Intergenic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182549289 22:31092341-31092363 GGGGTTGGGCAGAAGCTCTGAGG + Intronic
1185085696 22:48739921-48739943 TTGAGTCAGCAGAAGCTCTGGGG + Intronic
949108499 3:229382-229404 GTATTTTAGCAAAAGATTTGTGG - Intronic
949412640 3:3782638-3782660 GTGTTTTGGCAGGAGCGCTCGGG - Intronic
950266591 3:11577709-11577731 GTGTTTAAGCAGCAGCTGTGTGG - Intronic
951541191 3:23783523-23783545 ATGGTTTAGCAATAGCTCTGGGG + Intergenic
952161358 3:30696562-30696584 CTGTTTTGGCTGAAGCTCTTGGG - Intergenic
952419663 3:33119618-33119640 GAATGTTAGCAGAAGGTCTGTGG + Intronic
955188760 3:56740311-56740333 GTGTTATAGAAGAAGCTTTTTGG + Intronic
958726937 3:97917491-97917513 GTGTTATAGCAGCAGGTTTGTGG + Intronic
959555771 3:107715323-107715345 GTGTTTTAACAGAACCTCCAGGG + Intronic
959575652 3:107930174-107930196 ATGTATAAGCAGAAGCTCAGGGG + Intergenic
960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG + Intronic
960799601 3:121524873-121524895 GTATTTTAAAATAAGCTCTGAGG - Intronic
962488398 3:135866850-135866872 GTGTTTTGGCAGATACTCAGAGG + Intergenic
963158097 3:142120899-142120921 CTGCTTTACCAGCAGCTCTGGGG + Intronic
964691063 3:159450600-159450622 GTGTATTTGAAGAAGCTTTGGGG - Intronic
965977756 3:174645373-174645395 TTGTTTTAACAAAAGCTCGGAGG + Intronic
966863968 3:184246316-184246338 GTATTTTAGGAGGAGCTCTTTGG - Intronic
966969520 3:185030400-185030422 GTGTGTTTGCAGAAGCTGAGGGG + Intronic
968893336 4:3384562-3384584 GGTTTTTATCAGAGGCTCTGGGG - Intronic
969161358 4:5261838-5261860 TTTTATTAGCAGAAGCACTGAGG + Intronic
970730070 4:19092106-19092128 GTGTTTTAGCAAACCCTCAGTGG - Intergenic
971850447 4:31978990-31979012 GTGTTCCAGCTGTAGCTCTGGGG - Intergenic
972891945 4:43568129-43568151 GTGCTTTACCAGGAGCTCTTGGG - Intergenic
974433808 4:61831998-61832020 GTGGTTTAGAACAGGCTCTGAGG - Intronic
974579474 4:63777060-63777082 GTGTTGTAGCATAATCTCTCAGG + Intergenic
976348197 4:84029586-84029608 GTAATTTAGCATAACCTCTGTGG + Intergenic
977836014 4:101647227-101647249 ATGTTATAGCAGAAGCTCAGTGG + Intronic
977917250 4:102607842-102607864 GTTTTTCAGCAGTAGGTCTGTGG - Intronic
978304432 4:107309609-107309631 GTATTTTAGCAGAATCTTTTAGG + Intergenic
979592946 4:122501442-122501464 GTGTGGTGGCAGAAACTCTGAGG + Intergenic
981327659 4:143469022-143469044 GTGTTTTAGCAAAAGAGCAGTGG + Exonic
982711702 4:158764384-158764406 GTGCTATAACAGAAGCACTGGGG + Intergenic
984673070 4:182514160-182514182 GTGTACTAGTGGAAGCTCTGAGG - Intronic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
987416086 5:17663354-17663376 ATGTTTGAGCAGCTGCTCTGTGG + Intergenic
987594493 5:19979375-19979397 CAGTTTCAGCAGAAGGTCTGAGG - Intronic
990522013 5:56589500-56589522 GTGTTTGAGTACAAACTCTGGGG - Intronic
990556715 5:56943599-56943621 GTGTTTTAGCATCAGCCCTCTGG - Intronic
991504216 5:67307313-67307335 TTCTTCTAGCAGAAGCTCTTTGG + Intergenic
992857814 5:80881255-80881277 GTGTTTGAGCAGAGGGTATGTGG - Intergenic
994826313 5:104717694-104717716 GTGTTTTAGCTGATTCTCTTGGG - Intergenic
996214674 5:120852333-120852355 GTTATTTAGCAGATTCTCTGGGG + Intergenic
997140154 5:131370773-131370795 GTGTTTTAGAAGCAACTCTTTGG - Intronic
997831055 5:137150442-137150464 TTGTTTTAGGAGAAGCTCTGTGG + Intronic
1001689831 5:173624778-173624800 GAGTTTGAGCAAAAGCTCAGAGG + Intergenic
1003210703 6:4063065-4063087 GTGTTTTAGGTGCAGCTCAGTGG + Intronic
1003673614 6:8182353-8182375 GTCTTTTGGCAGAAACTCAGAGG + Intergenic
1007851245 6:44804606-44804628 GTGTGCTTGCAGAAGCCCTGGGG - Intergenic
1008896039 6:56556685-56556707 GCATAATAGCAGAAGCTCTGTGG - Intronic
1012292689 6:97477675-97477697 GTGTATTTGCAGAATCTTTGGGG + Intergenic
1012655234 6:101809183-101809205 GAGTTTTAGCAAAAAGTCTGTGG - Intronic
1014321780 6:119938890-119938912 GTCTTTTGGCAGAATCTCTAGGG + Intergenic
1017557175 6:155583865-155583887 GTGTTTTGGCAGAGGCTCCCAGG + Intergenic
1017582345 6:155879962-155879984 GTGTTTTAACTGAAGCTCTCAGG - Intergenic
1018595961 6:165480713-165480735 GTGTTAGAGCAGAAGCCCTCTGG + Intronic
1018976296 6:168569984-168570006 GTGTTTTACACGTAGCTCTGTGG + Intronic
1020096004 7:5369784-5369806 GTGTTTTAGCAGGATTTCTTGGG - Intronic
1021111583 7:16700526-16700548 GTGTTTTATAACAAGCTCTCTGG - Intronic
1021493623 7:21247733-21247755 TTGTTTTGGCAGATCCTCTGGGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021997083 7:26189787-26189809 GTGGCTTTGCAGAAGCACTGAGG - Intergenic
1022993626 7:35731993-35732015 GTGTTTTAATAGAATCTCTCTGG + Intergenic
1025576225 7:62645342-62645364 CTGTTTTTGTAGAATCTCTGAGG - Intergenic
1026051487 7:66950866-66950888 GTGTTTTACCAGCTGCTGTGGGG + Intronic
1028083576 7:86607372-86607394 TAGTTTTAGCAGCATCTCTGAGG - Intergenic
1031087084 7:117313154-117313176 TTGTACTAGCAGAAGGTCTGTGG - Intronic
1034588202 7:152115036-152115058 GTGCTGTAGGAGAAGCACTGTGG - Intronic
1034952338 7:155307452-155307474 GCCCTTTAGCAGAAGCTCCGTGG + Intronic
1036225695 8:6955774-6955796 GTGGTATAGCAGAATCACTGTGG + Intergenic
1036826135 8:11977525-11977547 GTGCTCTAGCACAACCTCTGAGG - Intergenic
1039554206 8:38465549-38465571 GTGGGTTAGGAGAAGCTCCGGGG - Intronic
1040539672 8:48340881-48340903 GTGCTTGAGCAGAAACTCTGGGG + Intergenic
1040877283 8:52166813-52166835 GTGCATAAGCAGAAGCTTTGAGG + Intronic
1041267532 8:56079728-56079750 GTGTCTTGGCACCAGCTCTGTGG + Intergenic
1041317743 8:56581953-56581975 TTGTCTTTCCAGAAGCTCTGAGG - Intergenic
1046675915 8:117108460-117108482 CTGTTTTAGCAGGTGCTCAGAGG + Intronic
1049021869 8:139962707-139962729 GGGTTCTTGCAGAAGCTCTTTGG - Intronic
1049188611 8:141273139-141273161 ATGTTCTAACAGAAGCTCAGTGG - Intronic
1050243047 9:3658525-3658547 GTGCTCTAGCATGAGCTCTGAGG - Intergenic
1053792516 9:41696863-41696885 CTGTTTTAGCAGGAGTTGTGGGG - Intergenic
1054143677 9:61547790-61547812 GAGTTCTTGCAGAAACTCTGTGG - Intergenic
1054180929 9:61908884-61908906 CTGTTTTAGCAGGAGTTGTGGGG - Intergenic
1054472435 9:65549105-65549127 CTGTTTTAGCAGGAGTTGTGGGG + Intergenic
1054656662 9:67672258-67672280 CTGTTTTAGCAGGAGTTGTGGGG + Intergenic
1056083201 9:83118863-83118885 GTGTCATAGCAAAAGCACTGTGG - Intergenic
1056129941 9:83574565-83574587 GTTTCTTAGCAGAAACACTGAGG + Intergenic
1057261715 9:93588171-93588193 GTGCTTGACCAGATGCTCTGGGG + Intronic
1057558478 9:96108340-96108362 GTGTTTCAGCAGTAGCTGTCTGG + Exonic
1059468945 9:114488941-114488963 GTTTTATAGCAGAAGCAATGGGG - Intronic
1062059850 9:134489312-134489334 ATGTTTTAGCAGAGGCTCAAAGG + Intergenic
1062294283 9:135815699-135815721 GTGGTTTAGTAGAAGCTCTTAGG - Intronic
1188480134 X:30629174-30629196 GTGTTATAGCAGGGGATCTGAGG + Intergenic
1189488115 X:41447975-41447997 CTCTTTGGGCAGAAGCTCTGTGG - Intronic
1189745719 X:44166977-44166999 GTGTTTTAGAAAGAGCACTGTGG - Intronic
1190012905 X:46800725-46800747 GTGTTTGAGCATGAGCTGTGAGG - Intergenic
1190979430 X:55442898-55442920 GTGGTTTAGCAAAATCTCTTTGG - Intergenic
1190988946 X:55526029-55526051 GTGGTTTAGCAAAATCTCTTTGG + Intergenic
1191578517 X:62734099-62734121 GTGTTTTTGTAGAATCTGTGAGG - Intergenic
1191668837 X:63730509-63730531 GTGTTTTAACAAGACCTCTGAGG - Intronic
1194233183 X:91349023-91349045 GTGATTTGCCAGAAGCTCTCAGG + Intergenic
1195615425 X:106908259-106908281 GTGTTTTAGAAAAATCTCTGGGG - Intronic
1197033365 X:121845920-121845942 GTTTTATAGCTGAAACTCTGTGG - Intergenic
1199091624 X:143700073-143700095 GTGAATTGGCACAAGCTCTGTGG + Intergenic
1199592192 X:149477656-149477678 GTGTTTTATCAGACACTCAGAGG + Intergenic
1202164260 Y:21969800-21969822 GGGTTTTAGGAGCAGCTCAGAGG + Intergenic
1202167535 Y:22006396-22006418 GTTTTTTGGCAGAATCACTGTGG + Intergenic
1202223825 Y:22579973-22579995 GTTTTTTGGCAGAATCACTGTGG - Intergenic
1202227096 Y:22616572-22616594 GGGTTTTAGGAGCAGCTCAGAGG - Intergenic
1202316026 Y:23579082-23579104 GGGTTTTAGGAGCAGCTCAGAGG + Intergenic
1202319290 Y:23615688-23615710 GTTTTTTGGCAGAATCACTGTGG + Intergenic
1202350488 Y:23985196-23985218 GAGTTTTAGGAGCAGCTCGGAGG + Intergenic
1202520291 Y:25684925-25684947 GAGTTTTAGGAGCAGCTCGGAGG - Intergenic
1202551479 Y:26054369-26054391 GTTTTTTGGCAGAATCACTGTGG - Intergenic
1202554739 Y:26090985-26091007 GGGTTTTAGGAGCAGCTCAGAGG - Intergenic