ID: 960052596

View in Genome Browser
Species Human (GRCh38)
Location 3:113252527-113252549
Sequence ATGGAGAAGCAGTAACAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 434}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960052586_960052596 23 Left 960052586 3:113252481-113252503 CCTTGGGGTGGGTGAAGCTTGAG 0: 1
1: 0
2: 1
3: 14
4: 183
Right 960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG 0: 1
1: 0
2: 2
3: 51
4: 434
960052594_960052596 -1 Left 960052594 3:113252505-113252527 CCTGGGAGGAGAGTAGGGAGGGA 0: 1
1: 0
2: 3
3: 70
4: 695
Right 960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG 0: 1
1: 0
2: 2
3: 51
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960052596 Original CRISPR ATGGAGAAGCAGTAACAGAA TGG Intronic
901228873 1:7630962-7630984 AAGGATAAGCAAAAACAGAAGGG - Intronic
902443752 1:16448425-16448447 ATGGAGGAGCAGGCCCAGAAAGG - Intronic
902936361 1:19767661-19767683 ATGAAGAAGCAATGAGAGAAAGG + Intronic
903014623 1:20353943-20353965 AGGGAGAAGCTGTCACAGGACGG - Exonic
903274182 1:22210400-22210422 AGTCAGAAGCAGCAACAGAAGGG - Intergenic
903288362 1:22291237-22291259 ATGGAGAGACAGGAACAGAGAGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
906437300 1:45807213-45807235 TTAGAGAAGCAGTAACAGAATGG - Intronic
906529105 1:46512978-46513000 AGAGAGAAGGAGAAACAGAAGGG - Exonic
906928462 1:50144336-50144358 TGGGAGAAACAATAACAGAATGG + Intronic
908502344 1:64756785-64756807 ACTGAGAAACTGTAACAGAATGG - Intronic
909116319 1:71541644-71541666 ATGGAACAGCAGGAACAGAACGG + Intronic
909203230 1:72719819-72719841 ATGAAAAAGCAGCCACAGAATGG - Intergenic
909228342 1:73054768-73054790 ATGGAGCAGGAGTAACCAAATGG - Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909704549 1:78565695-78565717 ATGAAGAAGAAGGAAAAGAAAGG - Intergenic
911380913 1:97113297-97113319 AGAAAGAAGCAGTAACACAAGGG - Intronic
913206663 1:116545266-116545288 ATGGAGAGGAAGCCACAGAAAGG + Intronic
916161439 1:161919888-161919910 TTGGAGAGGTCGTAACAGAAGGG + Intronic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
917143521 1:171862806-171862828 AAAGAGAAGCAGCAACAGAAGGG + Intronic
917695638 1:177520402-177520424 ATGGAGAAGGACCATCAGAAGGG + Intergenic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
918082703 1:181220062-181220084 ACGGGGAAGCAGTCACTGAAGGG - Intergenic
918394221 1:184097372-184097394 GCGGAGAGGCAGTAACAGCAAGG - Intergenic
918692907 1:187504588-187504610 AAAGAGAAGCAATAACAGAAGGG - Intergenic
918937481 1:190942038-190942060 ATTGAGGAGCAGTAATAGAAAGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919553750 1:199026149-199026171 AGGGGAAAGCATTAACAGAATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922036648 1:221854812-221854834 ATGGAGAAGAAGTCATGGAAGGG + Intergenic
922660668 1:227427783-227427805 TTGGAAAAGAAATAACAGAATGG + Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923303633 1:232667330-232667352 ATGGAGATGGTGTAACAAAATGG + Intergenic
923836874 1:237621086-237621108 ATTAGAAAGCAGTAACAGAAAGG + Intronic
924020183 1:239772709-239772731 ATAGAGAGGGAGTCACAGAAAGG - Intronic
924032044 1:239895442-239895464 TGGGAGAACCAGTAACAGAAGGG - Intronic
924405222 1:243737407-243737429 AAGAAGAAGGAATAACAGAAGGG - Intronic
924805142 1:247355946-247355968 GAAGAGAAGCAGAAACAGAAAGG + Intergenic
1066148599 10:32590091-32590113 CTGGAAAAGCAATAACAAAATGG - Intronic
1066443685 10:35462418-35462440 ATGGCAAAGCAATACCAGAAGGG - Intronic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1069035449 10:63641984-63642006 ATGGCCAAGCATTAGCAGAAAGG - Intergenic
1069812378 10:71171875-71171897 AAGGAAAGGCAGTATCAGAAGGG + Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1071252967 10:83839682-83839704 TAAGAGAAGCAGCAACAGAAAGG + Intergenic
1071383236 10:85092635-85092657 AAGGAGAAGTAGTAACTGAAAGG - Intergenic
1071409583 10:85375773-85375795 ATGGATTAGCAATAACAGAATGG - Intergenic
1072082732 10:92048005-92048027 TTGGAAAAGCAGCAGCAGAAAGG + Intronic
1072170930 10:92861129-92861151 GTGGAGAAGCACAAACATAAGGG - Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073487934 10:103833168-103833190 ATGGAAAAGACGTAACATAAAGG - Intronic
1075017198 10:118918618-118918640 AGGTAGCAGCAGTGACAGAAGGG + Intergenic
1075361189 10:121836091-121836113 GAGAAGAAGCAGTAAAAGAAAGG - Intronic
1075390821 10:122090244-122090266 ATGGAAAAGTAGATACAGAAGGG + Intronic
1075881807 10:125858929-125858951 GTCTAAAAGCAGTAACAGAATGG + Intronic
1076919709 10:133445323-133445345 ATGGAGAGGCAGGCACACAAAGG + Intergenic
1077032343 11:474230-474252 AGGCAGAAGCAGGAAGAGAAGGG - Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077555978 11:3226293-3226315 CTGGAGAAACAAGAACAGAAAGG - Intergenic
1079279119 11:19072312-19072334 ACAGAGGAGCAGGAACAGAAGGG - Intergenic
1079411661 11:20193333-20193355 ATGGAGAGGCAGTCACAGTATGG - Intergenic
1079663040 11:23065797-23065819 ATATAGAAGCAGTAATAAAATGG - Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080344354 11:31307800-31307822 ATTCAGCAGCAGTATCAGAAGGG - Exonic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084599793 11:70138022-70138044 AAGGAGAAGAAGTCACTGAATGG - Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085587872 11:77728491-77728513 ATGGAGAAACAGGAAAGGAAAGG + Intronic
1085676597 11:78525977-78525999 ATTGAGAAACTGTAATAGAATGG + Intronic
1086250972 11:84813943-84813965 AGCCAGAAGCTGTAACAGAAAGG + Intronic
1086994083 11:93336686-93336708 CTGGAGAAGCTAAAACAGAAAGG - Intronic
1087146249 11:94814515-94814537 AGGGAGAAGGAGTGTCAGAAGGG + Intronic
1087374707 11:97326526-97326548 GTGTAGAGGCAGTAGCAGAAAGG + Intergenic
1087416525 11:97863189-97863211 ATGGAGAAACACGAACAAAAAGG + Intergenic
1087576378 11:99994908-99994930 ATGAAGAGGAAGTAAAAGAAAGG + Intronic
1088095178 11:106091446-106091468 ATGGAGAGGAAGAAAAAGAATGG + Exonic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088758587 11:112907939-112907961 TTAGAGAAGCATTTACAGAAAGG + Intergenic
1090063171 11:123481069-123481091 AAGGAGAAGGAGCAACACAAAGG + Intergenic
1090132289 11:124157285-124157307 ATTGAGAAACAGTATCAGCAAGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090345684 11:126068339-126068361 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091761764 12:3092250-3092272 ATGGAGAACAAGTAACGGAGGGG - Intronic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092268502 12:7002191-7002213 AGGAGGAAGCAGTAACAGAGAGG - Intronic
1092576765 12:9792758-9792780 ATTGTGATGCAGTAACACAAAGG - Intergenic
1093321035 12:17715856-17715878 CTGGAAAACCAGTAACAAAATGG - Intergenic
1093806784 12:23443560-23443582 ATTGAAAAGCATCAACAGAAAGG + Intergenic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1095253545 12:40006250-40006272 ATGTATAAGCTGTAACAGAGTGG + Intronic
1096361608 12:50992751-50992773 AAGAAGAAGAAGTAACAAAAGGG + Intronic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1096984393 12:55746320-55746342 ATGCAGAGGCAGTGATAGAAAGG - Intronic
1097075448 12:56389735-56389757 ATGGAGAGCCAGTAGCTGAATGG + Intergenic
1097957000 12:65496478-65496500 AAGAAGAAGGAGTAACAGACAGG + Intergenic
1097965253 12:65572458-65572480 ATGGGGAGGGAGAAACAGAATGG - Intergenic
1098113093 12:67145019-67145041 TTGCAGAAGAAGAAACAGAAAGG - Intergenic
1098895304 12:76053279-76053301 AAGAAGAAGCAGAAACACAAGGG - Exonic
1099224208 12:79949566-79949588 ATGGAGAAATAGAAAAAGAAAGG - Intergenic
1101391758 12:104307430-104307452 ATGGAGAATTAGTAACTTAAAGG + Intronic
1101608460 12:106268438-106268460 ATGGAGAAATAGGAACAGAAAGG + Intronic
1101841104 12:108328102-108328124 AGGGAAAAACAGTAAAAGAAAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102255612 12:111413130-111413152 ATGGGGAAGCTGAAACAGAGCGG - Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105664777 13:22541670-22541692 ATGGAGAATTTGTTACAGAAAGG - Intergenic
1108085583 13:46788187-46788209 AAGGATAACCAGTAACAAAAAGG - Intronic
1108173121 13:47764269-47764291 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1108884338 13:55161063-55161085 AAGGAGAAGCTGTCACAGAATGG - Intergenic
1110852730 13:80263159-80263181 ATGTAGAAGAAGCAGCAGAAAGG - Intergenic
1112825658 13:103390165-103390187 ACGGAACAGTAGTAACAGAAAGG - Intergenic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1112995406 13:105568583-105568605 ATGAGGAAGCAGAAACAGTAGGG + Intergenic
1113213483 13:108010642-108010664 ATGAAGAAGCAGTAATACAAAGG - Intergenic
1113370626 13:109722071-109722093 AAGGAAAAGCAGTCCCAGAAAGG - Intergenic
1113955353 13:114097610-114097632 ATGAAGCAGCAATCACAGAACGG + Intronic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117272238 14:54156816-54156838 ATGGGGGAGCAGTAAGACAAGGG - Intergenic
1117925165 14:60771389-60771411 GTGAAAAAGAAGTAACAGAAGGG - Intronic
1119010435 14:70980828-70980850 ATGGCCAAGCAGTAACATGATGG - Intronic
1120036885 14:79707840-79707862 AAGGAGAAGAAGTAAAAGAAAGG + Intronic
1120228922 14:81821765-81821787 ATGGAGAAGCAGCTAGACAAAGG + Intergenic
1121485133 14:94308851-94308873 ATGGAGAATGAGTAAATGAATGG - Intronic
1121685419 14:95831873-95831895 ATGGAGGTGCAGAGACAGAAGGG - Intergenic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1122225895 14:100279338-100279360 ATGGAGAAGCTCTAAGACAATGG - Exonic
1122492884 14:102131818-102131840 AAGGATAAGCAATAACAGAAAGG - Intronic
1202918152 14_KI270723v1_random:3611-3633 AGGGAGAAGCCGTCAGAGAAGGG - Intergenic
1123695039 15:22872978-22873000 AACAAGAAGCAGAAACAGAATGG + Intronic
1124368166 15:29088566-29088588 ATGGAGAGACAGCAACAGATGGG - Intronic
1124832325 15:33161312-33161334 ATTGGGAAACAGTAACAGATTGG + Intronic
1125057830 15:35383603-35383625 CTGGTGAATCAGTAATAGAAAGG - Intronic
1125261774 15:37834143-37834165 AGGGAGAGGTAGTAATAGAAGGG + Intergenic
1125737888 15:41940994-41941016 ATGGAGAAGCAGTGAAACACGGG + Intronic
1126377651 15:48012379-48012401 ATGGAAAACAACTAACAGAAAGG + Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127269947 15:57391346-57391368 ATTGCAAAGCAGTAACAGCAAGG - Intronic
1127295508 15:57605290-57605312 ATGGAGACAAAGTAAAAGAAGGG + Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128649672 15:69401293-69401315 ATGGAAAATCAGGAACAAAATGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1130017237 15:80196939-80196961 ATGGAGAAGGAGTCACCCAATGG - Intergenic
1131744959 15:95437309-95437331 AGAGAGAAGCAGTAACTAAAAGG - Intergenic
1131983524 15:98018389-98018411 AGGGTGAAGCATCAACAGAAAGG - Intergenic
1132058560 15:98671109-98671131 ATGGAGATCCAGTAACAGAGCGG - Intronic
1132863583 16:2083130-2083152 AAGTAGAAGCAGCAACAGAGGGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133462617 16:6000354-6000376 AGGGAGAGGCAGTAACAGCTGGG + Intergenic
1133540906 16:6752743-6752765 GTGAAGAAGCAGTAAGGGAAAGG - Intronic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1134034639 16:11020444-11020466 CTGGAGAAGCAGGGAAAGAAAGG - Intronic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1134852737 16:17494695-17494717 CTGGAGAAGCACTAACAGAGGGG + Intergenic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137605220 16:49782673-49782695 AGGGAGAGGCAGTAGGAGAAGGG - Intronic
1138393857 16:56689724-56689746 ATGGAGAGGAGGTCACAGAATGG - Intronic
1139893524 16:70269842-70269864 ATTGAGGAGCATTAGCAGAAAGG + Intronic
1140917318 16:79505967-79505989 ATAGAGAAGGAGCAAAAGAAGGG + Intergenic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1142923093 17:3208223-3208245 AAGGAGAAACATTATCAGAAGGG - Intergenic
1143410858 17:6707551-6707573 ATGGAGAAGGAAGAAAAGAAAGG + Intronic
1144001127 17:11056176-11056198 AAAGAGAAGGAGAAACAGAAAGG - Intergenic
1145058957 17:19720467-19720489 ATGGAGAGGGAGGAATAGAAAGG - Intergenic
1145195029 17:20885111-20885133 GTGGAGAAGAAGAAACAAAATGG + Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152580352 17:81163044-81163066 ATGGAGAGCCAGTCACAGAAGGG + Intronic
1203180748 17_KI270729v1_random:54785-54807 ATGGAGTTGAATTAACAGAATGG + Intergenic
1203180942 17_KI270729v1_random:56278-56300 ATGGAGTTGAATTAACAGAATGG + Intergenic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1155136382 18:22997698-22997720 ATGAAGAAGCAAGAGCAGAAGGG + Exonic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155657124 18:28205289-28205311 GTGGAGAATCAGTAACACCAAGG + Intergenic
1156156029 18:34302657-34302679 AAGGAAAAGCAGCAAGAGAAAGG + Intergenic
1157271239 18:46277956-46277978 TTGAAGACCCAGTAACAGAATGG + Intergenic
1157392515 18:47314669-47314691 AGGGAGAGGAAGAAACAGAAAGG - Intergenic
1157728412 18:49983277-49983299 ATGGAGGACCAGAACCAGAAAGG - Intronic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159605879 18:70474299-70474321 GTGATGATGCAGTAACAGAAAGG - Intergenic
1160929991 19:1566123-1566145 ATGGGGAGGCAGTAACAGGATGG + Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161640797 19:5421504-5421526 TGGGAAAAGCAGTAACAGCATGG + Intergenic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1164958581 19:32406938-32406960 ATGGAGAATCTGGAACAGAGAGG - Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166774946 19:45306787-45306809 ATGGAGAAGAAGTTGGAGAAAGG - Exonic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167831963 19:52030971-52030993 ATGAAGAAAAAGGAACAGAAAGG + Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925940433 2:8811937-8811959 GCGGACAAGCAGTAAGAGAAGGG + Intronic
927256504 2:21044485-21044507 ATGGAAAAGAAGTAACCGATGGG - Intergenic
927332781 2:21885651-21885673 AAGGAGATGCAGTGACAGGAAGG - Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927497580 2:23561167-23561189 ATGGAGAGGCAGAGACAGAGGGG - Intronic
930236739 2:48895770-48895792 AAGGAGAAGTGGTTACAGAAGGG - Intergenic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930737254 2:54792099-54792121 TTGTAGAAGGAGTAATAGAAGGG + Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
932494816 2:72141060-72141082 ATGGAGAAGGAGCTAGAGAATGG - Intronic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932885391 2:75544473-75544495 CAAGAGAAGCAGTAATAGAATGG - Intronic
933664738 2:84955872-84955894 ATGGATAAGAAGTAACAGGCTGG + Intergenic
933896818 2:86818651-86818673 AAGGAGAAGGAGATACAGAATGG - Intronic
933915208 2:86984410-86984432 ATGGACATTCAGTCACAGAAAGG - Intronic
933933123 2:87175678-87175700 CTAGAAAAGCAGTAGCAGAATGG - Intergenic
934007785 2:87785490-87785512 ATGGACATTCAGTCACAGAAAGG + Intronic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935058984 2:99592088-99592110 ATGAAGATACAGTAACAGGAGGG + Intronic
935441554 2:103103919-103103941 ATGGAAAAGGAGGAAGAGAAAGG - Intergenic
935675649 2:105592991-105593013 ATGGAGAAGCCGTGCCAGGAAGG - Intergenic
935771422 2:106426408-106426430 ATGGACATTCAGTCACAGAAAGG + Intronic
935908652 2:107869540-107869562 ATGGACATTCAGTCACAGAAAGG - Intronic
935995055 2:108761755-108761777 ATGGACATTCAGTCACAGAAAGG - Intronic
936130435 2:109834658-109834680 ATGGACATTCAGTCACAGAAAGG - Intronic
936214262 2:110536827-110536849 ATGGACATTCAGTCACAGAAAGG + Intronic
936359990 2:111789769-111789791 CTAGAAAAGCAGTAGCAGAATGG + Intronic
936423399 2:112391390-112391412 ATGGACATTCAGTCACAGAAAGG + Intronic
936685736 2:114823960-114823982 ATGTAGAATCATCAACAGAAGGG + Intronic
937289757 2:120775136-120775158 GTGGAGGAGCTGTCACAGAAGGG - Intronic
937321768 2:120965289-120965311 ATGCAGATGCTGTAACAGAGGGG + Intronic
938396711 2:130955898-130955920 ATGGAGAAGCTGCAACCTAAAGG - Intronic
938594745 2:132776590-132776612 ATGAAGAAGCAGCAAGAAAATGG + Intronic
939138549 2:138325215-138325237 ATGAAGAACCAGTTACAGAACGG - Intergenic
939606519 2:144262010-144262032 AAGGAGGAGCATTAACAAAATGG + Intronic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
940212652 2:151271655-151271677 ATGGAGAAACAGTAACTCTATGG + Exonic
940280771 2:151987378-151987400 ATGGAGAGAGAGAAACAGAATGG - Intronic
940712967 2:157184540-157184562 ATGGATAAGGAGAAACAGCAAGG - Intergenic
941469676 2:165869039-165869061 ATGGAGATGCAGTTGCAGAGTGG + Intronic
943089680 2:183358887-183358909 ATGGAAATGCAGTTTCAGAAGGG - Intergenic
943791662 2:191939649-191939671 ATGAAGAGGCATGAACAGAAAGG + Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944324893 2:198392578-198392600 ATAGGGAAGAAGTAATAGAAAGG - Intronic
944883943 2:204043741-204043763 ATGGAGAAGCAGTAACTCTGGGG + Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945621627 2:212146799-212146821 TTGGAAAGGCAGTAGCAGAATGG + Intronic
945898496 2:215512216-215512238 AGAGTGAAGCAGTAACAGAAGGG + Intergenic
946179712 2:217942152-217942174 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946199599 2:218064195-218064217 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
947897220 2:233686860-233686882 ATGCAGAAAAAGTGACAGAAAGG - Intronic
948634294 2:239324750-239324772 TTGGAGAGGCCATAACAGAAGGG + Intronic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1169958019 20:11127372-11127394 GTGGATAAGAAGTAAGAGAAGGG - Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171036336 20:21715183-21715205 TTGGGGAAGCAGTAAAACAAAGG - Exonic
1172913502 20:38427435-38427457 ATGCAGGAGCAGAAACAGACAGG + Intergenic
1173387351 20:42601009-42601031 ATGCAGAATCATAAACAGAAAGG - Intronic
1173527062 20:43741128-43741150 ATGGGGAAGGAGGAAAAGAAAGG - Intergenic
1176165211 20:63669475-63669497 ATGAAAAAGCAGTTAAAGAAAGG + Intronic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1177271736 21:18857579-18857601 ATAAAAAAGCAGTATCAGAAGGG + Intergenic
1177731379 21:25031071-25031093 GTGGAGCAGCAGAAACAAAAGGG + Intergenic
1178689164 21:34736933-34736955 ATGGGGGAGAAGTAAAAGAAAGG - Intergenic
1179047192 21:37856443-37856465 ATAGAGAACCAGGAACAGAGAGG - Intronic
1179375665 21:40848073-40848095 ATGGTGAGGCAGAAACAAAATGG + Intergenic
1180262238 21:46679916-46679938 ATGGTGAGGCAGACACAGAAAGG + Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182597617 22:31434244-31434266 ACGGTGAAGCAGCTACAGAAGGG + Exonic
1183461138 22:37951392-37951414 ATGGAGAAGCATTAAAAGTGTGG + Intronic
1184380439 22:44142010-44142032 ATGGAGAAGAGGTGACAGAGGGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
949201215 3:1381743-1381765 ATGGAGTAGCAGGAACAGTGAGG - Intronic
949373121 3:3356599-3356621 ATGAAGAAATAGTAACAGTAGGG + Intergenic
949944179 3:9177221-9177243 ATGGAGACTCCGTAACAGGAGGG - Intronic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950403550 3:12789745-12789767 ATGGAGGAACAGTCACAGATTGG + Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950789776 3:15462706-15462728 ATGGAGAGGCCATAACAGAGAGG + Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951174850 3:19587109-19587131 AGGGAGAGCCAGTAAGAGAATGG + Intergenic
951698769 3:25473247-25473269 ATGGATAAGCAACACCAGAAGGG + Intronic
951771128 3:26258822-26258844 AAGGAGGACCAGTAGCAGAATGG + Intergenic
952300505 3:32100644-32100666 ATGGAGAAGCAGCTCCAGAGAGG + Intergenic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953063550 3:39448620-39448642 ATAGAGAAGCAGCAAAAGAGTGG + Intergenic
953552388 3:43913606-43913628 ATGGTGAAGGAGAAACACAAAGG - Intergenic
954245349 3:49327019-49327041 AGGGAAAAGCAGTATCATAAAGG + Intronic
954590877 3:51780230-51780252 GTGAAGATGCAGGAACAGAAGGG + Intergenic
955554001 3:60116444-60116466 ATGGAGAAGCAAGAAAAGAGGGG - Intronic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
955796071 3:62638509-62638531 ATAGAGAAGCTGAATCAGAAAGG + Intronic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
957690264 3:83556955-83556977 ATGGAGAATGAGGAAAAGAAGGG - Intergenic
959079990 3:101790048-101790070 ATGAGGAATCAATAACAGAAAGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960436772 3:117635757-117635779 TTTTAGAAGCAGTAACAGATGGG - Intergenic
960841572 3:121963896-121963918 CTGCAGAAGCAGTGACAGAGAGG - Intergenic
960984793 3:123269952-123269974 ATGGAGGAGCTGTTACAGATTGG + Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961661950 3:128473630-128473652 TGGGAGAAGGAGAAACAGAATGG + Intergenic
962526052 3:136238427-136238449 ATCCAGAAGCAGTCACAGCAAGG + Intergenic
962840474 3:139227987-139228009 AGGGACAAACAGGAACAGAAAGG - Intronic
963179164 3:142335926-142335948 ATGGGCAGCCAGTAACAGAAAGG + Intronic
963465182 3:145670438-145670460 ATAGAGAAGCAGAACCAGTAGGG - Intergenic
963596729 3:147337021-147337043 ATGGACAAGCAATAACACAGAGG + Intergenic
963837185 3:150069348-150069370 ATGAAGAAGCTGGAACAGATGGG - Intergenic
964503593 3:157374717-157374739 ATGGAGAAGTAGTACCAAACTGG + Intronic
964649732 3:158996963-158996985 ATAGAGAAGCAGCAAGATAAAGG - Intronic
965065257 3:163840078-163840100 ATGGAGAAAAAGTATCACAAAGG + Intergenic
965110785 3:164419057-164419079 AGGGATAAGTAGCAACAGAAAGG - Intergenic
965173950 3:165305874-165305896 ATGCAGAAGCAGTACCAACAGGG + Intergenic
965259223 3:166458738-166458760 ATGGAGAATAAGTAATGGAAAGG - Intergenic
965344075 3:167525924-167525946 GTGGGGAAGAAGAAACAGAAAGG - Intronic
966388399 3:179426486-179426508 ATGGGGAATTAGTACCAGAATGG + Intronic
968107867 3:196015107-196015129 ATGGTGAGGCAGACACAGAAAGG - Intergenic
970004594 4:11398462-11398484 ATGGAGAAGCAGTTAGTGACTGG - Exonic
970018147 4:11535801-11535823 ATGGAAATCCAGTAAAAGAAGGG - Intergenic
970494070 4:16608290-16608312 AATGAGAAGCAGTAAAAAAAGGG + Intronic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
971076269 4:23152899-23152921 GTGGAGTAGAAGTAACAGAAAGG - Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971345436 4:25807787-25807809 CTGGAGAAGAAGGAACAAAAAGG + Intronic
974062832 4:57051214-57051236 AAGGGGAAGCAGTAACTGTATGG + Intronic
974329519 4:60459532-60459554 ATTTCTAAGCAGTAACAGAATGG + Intergenic
974404409 4:61447250-61447272 ATAGAGAAACAGTAACACAAAGG - Intronic
974423362 4:61707705-61707727 ATGAAGAAGAAGTAAAAGAAAGG + Intronic
974467436 4:62274851-62274873 ACTGAGAAACAATAACAGAAGGG - Intergenic
975375554 4:73640051-73640073 ATGGAGATGGAGTAGAAGAAGGG - Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977536880 4:98263809-98263831 GGGGATAAGCAGAAACAGAAAGG + Intronic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979194211 4:117900576-117900598 ATACAGAAGCAGACACAGAAGGG - Intergenic
980511919 4:133803168-133803190 ATAGAGAAAGTGTAACAGAAAGG + Intergenic
981072450 4:140558162-140558184 AAGGTGAAGCAGTAACACGAAGG - Intergenic
981702388 4:147620680-147620702 GAGGAGAAGCAGTGAGAGAAAGG + Intronic
982185402 4:152791974-152791996 ATGGATAAACAGGAACAGAATGG - Intronic
982443516 4:155463595-155463617 GTGTTGAAGCAGTAACATAAAGG + Intergenic
983255933 4:165400618-165400640 ATGGATAAGGAGTAAGTGAAGGG + Intronic
985469802 5:33174-33196 ATGGTGAGGCAGACACAGAAGGG - Intergenic
985728911 5:1534060-1534082 ATGAAAAAGCAGCCACAGAATGG - Intergenic
988513693 5:31887287-31887309 ATGGAGAGGCAGTGACAGAGTGG + Intronic
990446611 5:55899233-55899255 GTGTATAATCAGTAACAGAAGGG + Intronic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991507794 5:67343115-67343137 ATGGAGAAGCCACACCAGAAAGG + Intergenic
992309295 5:75478786-75478808 ATGGAGAAATAGTATCAGATAGG - Intronic
992754230 5:79889171-79889193 AAGGAGAAGCTGTAGCAGAATGG + Intergenic
993704652 5:91155847-91155869 ATTTAGAAGCAATATCAGAAAGG + Intronic
993837754 5:92835602-92835624 ATGGAGAAGGAGGAAAAGCAGGG - Intergenic
994054323 5:95398854-95398876 ACGGTGTAGCAGGAACAGAAAGG + Intronic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
996598176 5:125229013-125229035 ATGGAGAGGCAGAAATATAATGG + Intergenic
996617010 5:125454095-125454117 CTGGAAAAGCTGTTACAGAAAGG - Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
999450176 5:151671999-151672021 ATGGAGACCCAGGAACACAATGG - Intronic
1000136175 5:158353302-158353324 ATGAAGGAGCTGTCACAGAATGG - Intergenic
1001260001 5:170220193-170220215 ATGGAGTAGGAGTAACAAATGGG + Intergenic
1001667182 5:173443004-173443026 ATGGATATGCAGTTACATAAAGG + Intergenic
1002824344 6:759513-759535 ATTGAAGAGCAGTAAGAGAAAGG - Intergenic
1004782598 6:18927858-18927880 ATGGTAAAGCAGCAAGAGAAAGG - Intergenic
1006205934 6:32342896-32342918 AAGGAGAAGCAGTTAAAGGAAGG + Intronic
1006467358 6:34203565-34203587 ATGCAGAAGCAGGAAAAGAATGG + Intergenic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1007001829 6:38320619-38320641 GTAGAGAAACAGTCACAGAATGG - Intronic
1008485946 6:52035898-52035920 AGGGAGAAGTAGTGACAGGAGGG + Intronic
1008653064 6:53583253-53583275 ATGGAGAAATAGTAAGAGTAAGG - Intronic
1009045963 6:58237767-58237789 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1009221780 6:60992080-60992102 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1010394044 6:75370194-75370216 ATGGGAAAGCAATCACAGAATGG - Intronic
1010690451 6:78905426-78905448 ATAGAGAAGCAGTAATTGCATGG - Intronic
1011441689 6:87393802-87393824 ATCGATAAGGAGTAACAGGATGG - Intronic
1014055514 6:117010275-117010297 TTATAGAAGCAGTTACAGAATGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015586796 6:134784605-134784627 ATGTAGAAGTTGTAAAAGAAAGG + Intergenic
1015598469 6:134889327-134889349 ATGTATAAAGAGTAACAGAAGGG - Intergenic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1018879983 6:167868012-167868034 AAAGAGAGGCAGTAACAGCATGG - Intronic
1020040733 7:4998940-4998962 ATTGAGAAGCCGGAACAGAGTGG + Intronic
1021170241 7:17390861-17390883 AGGAAGAAGCAGTAAATGAAGGG - Intergenic
1023042242 7:36181896-36181918 TTGGAGAAGGAGTAACAGATGGG - Intronic
1023057564 7:36302278-36302300 ATGGAGAAGCAAGAAAAGAATGG - Intergenic
1027406239 7:77864236-77864258 AGACAAAAGCAGTAACAGAATGG - Intronic
1027615231 7:80414937-80414959 ATGGAGAAAAAGTAAAAGAGAGG + Intronic
1027814394 7:82950603-82950625 GTGGAGAAGCAGTTCCAGAAGGG + Exonic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1028923922 7:96337053-96337075 AATGACAAGCAGTAACAGTAAGG - Intergenic
1030398524 7:109018962-109018984 AAGGAGAAGGAAAAACAGAAAGG + Intergenic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1032002668 7:128275604-128275626 AGGGAGAGGCAGGAGCAGAATGG + Intergenic
1032953147 7:136939137-136939159 ATGAGGAAGCAGTAGCAGAAGGG + Intronic
1032961588 7:137041622-137041644 ATGAAGAAGCAGCAAGAAAATGG - Intergenic
1033250686 7:139755881-139755903 ATACAGAAGCAGTATCTGAAGGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034330889 7:150281385-150281407 AAGGAGCAGGAGTTACAGAAGGG + Intronic
1034667154 7:152828468-152828490 AAGGAGCAGGAGTTACAGAAGGG - Intronic
1035147568 7:156835275-156835297 ATGGAGGTGGACTAACAGAATGG - Intronic
1035339452 7:158151134-158151156 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339462 7:158151171-158151193 AGGGAGAGGCAGGAGCAGAAAGG - Intronic
1035339479 7:158151244-158151266 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339489 7:158151281-158151303 AGGGAGAGGCAGGAGCAGAAAGG - Intronic
1035339509 7:158151354-158151376 AGGGAGAGGCAGGAGCAGAAAGG - Intronic
1035339519 7:158151391-158151413 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339529 7:158151428-158151450 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339539 7:158151465-158151487 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035812432 8:2504021-2504043 TTGGAACAGCAGTAACAGGAGGG - Intergenic
1036181482 8:6588982-6589004 ATGGAAAGGCAGTCACTGAAGGG + Intronic
1037312184 8:17567978-17568000 ATTCACAAGCAGAAACAGAAAGG - Exonic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1037716073 8:21401579-21401601 ATGTTGAAGGAGTAAAAGAAGGG - Intergenic
1038568701 8:28641240-28641262 ATGTAAAAGAAGTAACAGACTGG + Intronic
1038622225 8:29155149-29155171 ATGGAGAATCAAAAAAAGAAAGG + Intronic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039569129 8:38573009-38573031 AGGCAGAAGCACTGACAGAAAGG + Intergenic
1041734315 8:61093884-61093906 CTGGAGAAGCAGGGACAGACAGG + Intronic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042957480 8:74267335-74267357 ATGGAACAGCAGTAACATACAGG + Intronic
1043419546 8:80084523-80084545 AAGGAGAAACAGAAACAGACAGG + Intronic
1044480346 8:92680028-92680050 ATGGAGACTCATTCACAGAATGG - Intergenic
1046109593 8:109706385-109706407 TGGGAGAAGCAGTGACTGAAAGG - Intergenic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1050619965 9:7442125-7442147 TTGGAGAAGCAGTGACAGTCTGG + Intergenic
1051030890 9:12676966-12676988 ATGGAGCAGAAGTCACTGAAAGG + Intergenic
1051719228 9:20018481-20018503 AAGGAGAAGAAGCAACAGCATGG - Intergenic
1051751849 9:20350939-20350961 ATAGAGAAGCAGTTAAAGTAAGG - Intronic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052626476 9:30982172-30982194 CTGCAGAGGCAGTAACAGAGAGG - Intergenic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1052955180 9:34248664-34248686 ATGGTTAAGCACCAACAGAATGG + Intronic
1053053716 9:34981228-34981250 AGGGAGCAGCAGGACCAGAAAGG - Exonic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054903872 9:70397629-70397651 ATGCACAAACAGTAACAGTAGGG + Intronic
1055874117 9:80922364-80922386 ATGAAGGAGCAGTAAAAGAAGGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1058092448 9:100820311-100820333 ATGGAGAATCAAATACAGAAAGG + Intergenic
1058197896 9:102001324-102001346 ATGGAGAGGGAGTAAGAGAGAGG - Intergenic
1058437684 9:104978149-104978171 AAGGAGAATCAATAACAGAAGGG - Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059954157 9:119498576-119498598 ATAGAGAGGCAGTACTAGAAGGG + Intronic
1061021840 9:128020773-128020795 AGGGGGAAGGAGAAACAGAAAGG - Intergenic
1185986015 X:4834779-4834801 ATGCAGAAGTGGGAACAGAAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186117340 X:6318719-6318741 ATAGAGAAGCTGTGAAAGAAAGG - Intergenic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188297658 X:28469666-28469688 TTGGAAAAGCCTTAACAGAAAGG - Intergenic
1188563571 X:31498918-31498940 ATGGAAAAGTGGTAACTGAAAGG - Intronic
1189285645 X:39850518-39850540 AAGGAGGAGCAGAAACATAAGGG + Intergenic
1190635042 X:52425017-52425039 CTGCAGCAGCAGTAACAGCAAGG + Intergenic
1190803951 X:53817497-53817519 ATGAAGAATAAGTTACAGAAGGG - Intergenic
1191172682 X:57464602-57464624 ATCAACAAACAGTAACAGAATGG + Intronic
1192241858 X:69337643-69337665 ATAGAGAAGAAATAACAAAATGG - Intergenic
1192435274 X:71139491-71139513 ATTGAGACGCAGTCCCAGAAAGG + Intronic
1192851806 X:74964331-74964353 ATGGAGAAGCAATCACTGAAGGG - Intergenic
1193789124 X:85797308-85797330 CTGCAGAGGCAGTAACAGAGAGG + Intergenic
1195091394 X:101463081-101463103 ATGGAGAAAGAGAGACAGAATGG - Intronic
1195792756 X:108607001-108607023 AATGTGTAGCAGTAACAGAATGG - Intronic
1196068962 X:111498192-111498214 CTGGAGATGCAGTATCAGATGGG - Intergenic
1196903770 X:120412043-120412065 ATGGAGGGGCATTAACAGGAGGG - Intergenic
1197228723 X:123980045-123980067 TTTGAGAAGCAGAAACAAAAAGG - Intronic
1197635764 X:128913279-128913301 AAGGAAAGGCAGTCACAGAAAGG + Intergenic
1199818449 X:151421078-151421100 ATGGAAAAGCATTAACATTAGGG + Intergenic
1201688900 Y:16740396-16740418 ATGCAGAAGTGGGAACAGAAAGG - Intergenic