ID: 960053196

View in Genome Browser
Species Human (GRCh38)
Location 3:113256984-113257006
Sequence GAGGCCTATCCCCACTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960053193_960053196 -8 Left 960053193 3:113256969-113256991 CCTCAATGATCAAATGAGGCCTA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 960053196 3:113256984-113257006 GAGGCCTATCCCCACTAGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 199
960053192_960053196 -7 Left 960053192 3:113256968-113256990 CCCTCAATGATCAAATGAGGCCT 0: 1
1: 0
2: 0
3: 16
4: 127
Right 960053196 3:113256984-113257006 GAGGCCTATCCCCACTAGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960053196 Original CRISPR GAGGCCTATCCCCACTAGGG AGG Intronic
902146559 1:14405909-14405931 GAGGCCTGCCCACATTAGGGAGG + Intergenic
902446641 1:16470176-16470198 GAGGCCCACCCACACTCGGGAGG - Intergenic
904542295 1:31241113-31241135 GAGGCCGATCTCCACTCAGGTGG - Intergenic
905039416 1:34942326-34942348 GAGGCCCATCCACACTGGGGAGG + Intergenic
905664466 1:39754505-39754527 GAGGCCTACCCACATTATGGAGG + Intronic
907485206 1:54773164-54773186 GAGGCCCACCCACATTAGGGAGG + Intergenic
910712353 1:90194954-90194976 GAGGCCTATCCACATTATGGAGG + Intergenic
911162958 1:94699996-94700018 GAGGCCCATCCACATTAGAGAGG - Intergenic
912701128 1:111878919-111878941 GAGGCCTGCCCACATTAGGGAGG - Intronic
912968488 1:114258270-114258292 GAGGCCCACCCACATTAGGGAGG + Intergenic
913533106 1:119747161-119747183 CAGGCCTGTCTCCACTAGGGAGG - Intergenic
915222930 1:154389558-154389580 GAGAACTATCCACATTAGGGAGG + Intergenic
918294960 1:183147859-183147881 GAGGCCAATCCACACTTAGGTGG - Intergenic
918741685 1:188139990-188140012 GAGGCCTACCCACATTATGGGGG - Intergenic
920347408 1:205315223-205315245 GTGGTCTAGCCCCACCAGGGTGG - Intronic
922423860 1:225476358-225476380 GAGGCCCACCCACACCAGGGAGG - Intergenic
922816708 1:228454266-228454288 AAGACCTGTCCCCACTAGGCAGG + Intergenic
923491699 1:234489852-234489874 GAGGCCCACCCACACTATGGGGG - Intergenic
923869914 1:237980626-237980648 GAGGTCTATCCACACTATGAAGG + Intergenic
1063155974 10:3379494-3379516 GGGGCTTATCCACACTATGGAGG - Intergenic
1063632891 10:7750505-7750527 GAGGCCCACCCACACAAGGGAGG + Intergenic
1063679211 10:8171205-8171227 GAGGCCCACCCACATTAGGGAGG + Intergenic
1064786782 10:18906492-18906514 GAGGTCTATCCACACTAGGGAGG + Intergenic
1065820307 10:29519015-29519037 AATGCCTGTCCCCACTAAGGAGG - Intronic
1066051143 10:31636848-31636870 GATGCCCACCCACACTAGGGAGG + Intergenic
1067248552 10:44567202-44567224 GAGGCCCACCCACATTAGGGAGG - Intergenic
1069595636 10:69668266-69668288 GAGGCCGACCCCCATTAGGGAGG + Intergenic
1070433282 10:76362608-76362630 GAAGCCCAACCCCACCAGGGGGG - Intronic
1071759067 10:88579890-88579912 GAGGCCTACCCACATTAGGGAGG - Intronic
1071967391 10:90866223-90866245 GAGGCCCACCCACATTAGGGAGG - Intergenic
1072035459 10:91559157-91559179 GAGGCCCACCCACATTAGGGAGG - Intergenic
1075342705 10:121660317-121660339 GAGGCCTACCCACATTATGGAGG + Intergenic
1076252768 10:128996839-128996861 CAGGCTTATCCCCCCTAGGCTGG - Intergenic
1077149183 11:1061218-1061240 CAGGTCCAGCCCCACTAGGGTGG + Intergenic
1077726244 11:4677645-4677667 GAGGCCCACCCCCATTATGGAGG + Intergenic
1078479010 11:11659983-11660005 GAGGCCCATCCCTATTAGGGAGG - Intergenic
1081990837 11:47336733-47336755 GACACCTGTTCCCACTAGGGTGG - Intronic
1084200752 11:67556418-67556440 GAGGCCCACCCCCATTATGGAGG + Intergenic
1087725355 11:101709345-101709367 GAGGCCTACCCACATTGGGGAGG + Intronic
1091101525 11:132878363-132878385 GAGGCCCATCCACATTAGGGAGG - Intronic
1092749974 12:11709717-11709739 GAGGCCTACCCGCATTACGGAGG - Intronic
1093222081 12:16433592-16433614 GAGGCCCACCCACATTAGGGAGG + Intronic
1093418415 12:18947115-18947137 CAGGCCTGTCCCCACTATGTGGG + Intergenic
1095061102 12:37690250-37690272 GAGGCCTTTCCCACCTATGGTGG - Intergenic
1097621914 12:61949136-61949158 GAGACCCATCCACAGTAGGGAGG - Intronic
1097783568 12:63734757-63734779 GAGGCCTATCCACATTAAGAAGG + Intergenic
1100037892 12:90275779-90275801 GAGGCCTATCCACGTTATGGAGG + Intergenic
1100223129 12:92528287-92528309 GAGGCCCACCACCACTAGGACGG - Intergenic
1100750286 12:97691198-97691220 GAGGCCCACCCACACTGGGGAGG - Intergenic
1101114532 12:101519025-101519047 GAGGCCCATACACATTAGGGAGG - Intergenic
1104482859 12:129123720-129123742 GAGGCCCATCCGCACTGGGGAGG - Intronic
1104939690 12:132389111-132389133 CAGGCCCATCCCCACTGGGAAGG + Intergenic
1105946858 13:25197736-25197758 GAGGCCCAACCCCATTAGGGAGG - Intergenic
1106010252 13:25813828-25813850 GAGGCCCACCCACATTAGGGAGG - Intronic
1106772666 13:32977035-32977057 GAGGCCCATCCCCTCTATAGGGG - Intergenic
1106957440 13:34955826-34955848 GAGGCCCATCCACATTAGGGAGG + Intronic
1111066186 13:83095533-83095555 GAGGCCCACCCACATTAGGGAGG - Intergenic
1112824150 13:103372645-103372667 GAGGCCCATCCACACTGGGGAGG + Intergenic
1113363040 13:109649110-109649132 GAGGCCCACCCACACTGGGGAGG + Intergenic
1113684751 13:112275218-112275240 GAGGCCCACCCCCATTAGGGAGG - Intergenic
1115239375 14:31239839-31239861 GTGGCCTGTCCGCACTTGGGAGG + Intergenic
1117774371 14:59167485-59167507 GAGGCCCATCCACATTTGGGAGG + Intergenic
1120378889 14:83748028-83748050 GAGGCCCACCCACACTAGAGAGG - Intergenic
1120617635 14:86727414-86727436 GAGGCCCACCCCCACCATGGTGG - Intergenic
1120715678 14:87838498-87838520 GAGGCCCACCCACATTAGGGAGG + Intronic
1120906206 14:89623467-89623489 GAGGCCCACCCACATTAGGGTGG + Intergenic
1120924890 14:89788134-89788156 AAGGCCTGACCCTACTAGGGAGG + Intergenic
1202843317 14_GL000009v2_random:144285-144307 TAGGCCCTTCCCCTCTAGGGAGG + Intergenic
1202912713 14_GL000194v1_random:134523-134545 TAGGCCCTTCCCCTCTAGGGAGG + Intergenic
1124064642 15:26330231-26330253 GATGCCTGTCCACACTGGGGAGG + Intergenic
1124924515 15:34058150-34058172 GAGGCCTACCCACATTATGGTGG + Intronic
1125140512 15:36400989-36401011 GAGGCCTCTTCCAACTAGAGAGG + Intergenic
1125522838 15:40357823-40357845 GATGCCTCGCCCCACTGGGGAGG + Intergenic
1125611263 15:40972465-40972487 GAGGCCTGCCCACATTAGGGAGG + Intergenic
1127553848 15:60067818-60067840 GAGGCCCACCCACACTGGGGAGG + Intergenic
1127869583 15:63060099-63060121 GAGGCCTCTCTCCTCAAGGGTGG + Intronic
1128100725 15:64997496-64997518 GAGGCTCATCCACATTAGGGGGG + Intergenic
1132138641 15:99369609-99369631 GAGGCCCACCCACACTATGGAGG + Intronic
1136409234 16:30066617-30066639 CAGGCTTTTCCCCACAAGGGAGG - Intronic
1137343234 16:47630779-47630801 GAGGCCCATTCCCATTAAGGAGG - Intronic
1137672609 16:50288079-50288101 GAGGCCTAGGCCCACGGGGGAGG + Exonic
1141105012 16:81226350-81226372 GATGCCCATCCACACTGGGGAGG + Intergenic
1147197081 17:38774266-38774288 GATGCCCATCCACACTGGGGAGG - Intronic
1148793789 17:50187756-50187778 GACCCCAGTCCCCACTAGGGAGG + Intronic
1149777102 17:59366606-59366628 CAGGCCTCTCCCCACTGGGTGGG + Intronic
1150962340 17:69928091-69928113 GAGGCCCATTCACATTAGGGAGG - Intergenic
1152572650 17:81127400-81127422 GAGACCTAGCCTCACCAGGGAGG - Intronic
1152801491 17:82332852-82332874 GAGGCCTGTCTCCAGCAGGGCGG - Intronic
1153326866 18:3829721-3829743 GAGGCCCATCCACATTATGGAGG + Intronic
1156055417 18:32997343-32997365 GAGGCCCAACCACATTAGGGAGG - Intronic
1156957831 18:42990297-42990319 GGGGCCCATCCACATTAGGGAGG + Intronic
1158554422 18:58463634-58463656 GAGGCCCACCCACACTGGGGAGG + Intergenic
1159079942 18:63725641-63725663 GAGGTCTACCCACACTATGGAGG + Intronic
1166742997 19:45125579-45125601 GAGCTCTCTTCCCACTAGGGTGG - Intronic
925690557 2:6518611-6518633 GAGGCCTGCCCACATTAGGGAGG + Intergenic
926671545 2:15581508-15581530 GAGGCCTACCCACATTATGGAGG - Intergenic
927991649 2:27452144-27452166 GAGGTCTATCCACAGTAGAGAGG - Intronic
931048058 2:58379482-58379504 GAGGCCTACCCACACTGGGGAGG + Intergenic
931660673 2:64559594-64559616 GAGGCCTACCCACATTAGGGAGG + Intronic
931829833 2:66039219-66039241 GAGGCCCATCCACATTATGGAGG + Intergenic
933195227 2:79382063-79382085 GATGCCTACCCCCACTAGTGAGG - Intronic
933704458 2:85279441-85279463 CAGGCCTAGCCCAACTAGAGTGG - Intronic
937678623 2:124619617-124619639 GAGGTCCATCCCCATTATGGAGG - Intronic
938204294 2:129404160-129404182 GAGGCCTGCCCACACTGGGGAGG - Intergenic
938609274 2:132930420-132930442 GATGCCTACCCACACTGGGGAGG - Intronic
939750018 2:146032249-146032271 GAGGCCAACCCACACTGGGGAGG + Intergenic
939842989 2:147211166-147211188 GAGGCCAATCCACATCAGGGAGG + Intergenic
939851187 2:147307248-147307270 GAGGCCTATCCACACTGGGGAGG + Intergenic
939985427 2:148825364-148825386 GAGGCCCATCCACATTAAGGAGG - Intergenic
941299637 2:163785338-163785360 GAGGCCCACCCACATTAGGGAGG - Intergenic
941636041 2:167935855-167935877 GAGGCCCATCCACATTAGGGAGG - Intergenic
944057631 2:195539976-195539998 GAGGCCCATCCACACTGGGAGGG - Intergenic
949073393 2:242040186-242040208 GAGGCCGTTCCCCACTTGGACGG + Intergenic
1169723622 20:8705025-8705047 GAGGCCCATCCACATTAGGGAGG + Intronic
1170934774 20:20800199-20800221 GAGGCATATCCCCGGGAGGGGGG - Intergenic
1172331524 20:34079058-34079080 GAGTCCTCTACCAACTAGGGGGG - Intronic
1173558291 20:43983397-43983419 CAAGCATCTCCCCACTAGGGTGG + Intronic
1173931482 20:46823800-46823822 GGGGCCTACCCACATTAGGGAGG + Intergenic
1174280426 20:49435076-49435098 GAGGCCTGTCCCCACCAGGGTGG + Intronic
1176054332 20:63135730-63135752 GAGCCCTCTCCCCACTGGGCAGG - Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177644243 21:23881743-23881765 GATGCCCATCCACACTGGGGAGG + Intergenic
1177731204 21:25028688-25028710 GAGGCCCATCCACATTATGGAGG - Intergenic
1179267764 21:39819996-39820018 GAGGCCTACTCACACTAGGGAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1183755075 22:39754349-39754371 CAGGCCTCTGCACACTAGGGTGG + Intronic
1183941366 22:41297329-41297351 GAGGCCCATCCACCTTAGGGAGG + Intergenic
1184366616 22:44055879-44055901 GAGGCCTATCCGCACTGGGGAGG + Intronic
1184626886 22:45741622-45741644 AAGGACTATGCCCAGTAGGGGGG - Intronic
1185244296 22:49765125-49765147 GTGGCCTGTCCCCACCTGGGTGG - Intergenic
949872295 3:8599072-8599094 GAGGACCCTCCCCACTAAGGAGG - Intergenic
950918029 3:16665326-16665348 GAGGCCTGTCCCCACCAGGAAGG + Intronic
951129524 3:19025246-19025268 GAGGCCTATCCACATTATAGAGG - Intergenic
951169424 3:19522506-19522528 GAGGCCCACCCACATTAGGGAGG + Intronic
951438366 3:22691588-22691610 GAGGCCTATTCACATTGGGGAGG + Intergenic
951571466 3:24067676-24067698 AAGGCCTATCCACATTAGGCAGG + Intergenic
954924697 3:54222479-54222501 GAGGCCTATGTACATTAGGGAGG + Intronic
956769547 3:72513151-72513173 GAGGCCTACCCACATTAGGGAGG - Intergenic
957456503 3:80456910-80456932 GAGGCCTAACCACATTATGGAGG - Intergenic
958493045 3:94802773-94802795 AAGGCCTATCCACATTAGGAAGG + Intergenic
959406132 3:105963508-105963530 GAGGCCCACCCACACTATGGAGG - Intergenic
959585609 3:108022417-108022439 GAGGCCTGTCAGCACTTGGGAGG + Intergenic
959916436 3:111821579-111821601 GAGGCCCATCCACAATATGGAGG + Intronic
960053196 3:113256984-113257006 GAGGCCTATCCCCACTAGGGAGG + Intronic
961133564 3:124490606-124490628 GAGGCCTTTCTCCAAGAGGGGGG + Intronic
962255530 3:133867664-133867686 GGGGCCTTTCCCCACTTGGTAGG + Intronic
968504311 4:964848-964870 GAGGCCTCCACCCAGTAGGGAGG - Intronic
969944199 4:10765994-10766016 GAGGCCCATCCACACTCTGGAGG + Intergenic
970151597 4:13095944-13095966 GAGGCTCCTCCCCAGTAGGGTGG + Intergenic
970765637 4:19545451-19545473 GAGGCCTACCTACATTAGGGAGG - Intergenic
971193711 4:24452019-24452041 GAGGCCCACCCACACTTGGGAGG - Intergenic
972397557 4:38671052-38671074 GGGGTCTTTCCCCAGTAGGGAGG - Intronic
973594933 4:52478396-52478418 GAGGCCCATCCACATTAGAGAGG + Intergenic
974596635 4:64021676-64021698 GAGACCTATCCACACTATAGAGG + Intergenic
977933485 4:102774681-102774703 GAGGCCTATCCACATTACGGAGG - Intergenic
979002855 4:115247630-115247652 GAGGCCCATCCACATTATGGAGG - Intergenic
979378705 4:119982088-119982110 GAGGCCCATCCACATTATGGAGG - Intergenic
981407418 4:144387267-144387289 GATGCCCACCCCCATTAGGGAGG - Intergenic
981576029 4:146206778-146206800 GAGGCCCATGCACACTGGGGAGG + Intergenic
983270726 4:165558473-165558495 GAGGCCCATCCACATTAGGGAGG - Intergenic
983770152 4:171539195-171539217 GAGGCCTACCCACATTAGGGAGG - Intergenic
983857226 4:172661158-172661180 GAGGCCCATCCACATTATGGAGG - Intronic
983930766 4:173450861-173450883 CAGGCCTTTCCCCTCTGGGGAGG - Intergenic
986751300 5:10790383-10790405 GAGGCCCATCCACATTGGGGAGG + Intergenic
989125428 5:38048129-38048151 GAGGCCTATGCATACTATGGAGG - Intergenic
990835599 5:60015679-60015701 GAGGCCCATCCACATTATGGAGG - Intronic
990915835 5:60905150-60905172 GAGCCCCCTCCCCACCAGGGTGG - Intronic
991299997 5:65120790-65120812 GAGGCCTAACCACATTATGGAGG + Intergenic
991554312 5:67878027-67878049 GATGCCTACCCACACTGGGGAGG - Intergenic
992832523 5:80608212-80608234 GAGGCCCATCCACATTAGGAAGG + Intergenic
994296689 5:98098121-98098143 GAGGCCCACCCACACTATGGAGG + Intergenic
995793676 5:115920532-115920554 GAGGCTCACCCACACTAGGGAGG + Intergenic
996755944 5:126935264-126935286 GAGGCCTACCCACATGAGGGAGG - Intronic
997098557 5:130941874-130941896 GAAGCCTATCCACACTGGGGAGG - Intergenic
998628556 5:143873389-143873411 GTGGCCTATCCACATTATGGAGG + Intergenic
1006720863 6:36149760-36149782 GAGGCCCACCCTCAGTAGGGAGG + Intergenic
1007164292 6:39817807-39817829 GAGGCCTACCCACATTATGGAGG + Intronic
1008223463 6:48881927-48881949 GAGGACTATCCACATTAGGGAGG - Intergenic
1008534020 6:52493006-52493028 GAGGCCCACCCACATTAGGGAGG - Exonic
1009449399 6:63783944-63783966 GAGGCCCACCCACATTAGGGAGG - Intronic
1010947136 6:81988360-81988382 TAGGCCTAAGCCGACTAGGGTGG + Intergenic
1011074011 6:83418485-83418507 GAGGCCCACCCACATTAGGGAGG + Intronic
1011780621 6:90785412-90785434 GAGGCCTACCCACATTACGGAGG + Intergenic
1012686184 6:102252721-102252743 GAGGCCCACCCCCATTAGAGAGG + Intergenic
1013427033 6:110021580-110021602 GAGGCCCACCCACACTGGGGAGG - Intergenic
1014571926 6:123020006-123020028 GAAGCCTCTCCCCACTGGGGAGG + Intronic
1015661019 6:135573665-135573687 GAGGCCCACCCACACTGGGGAGG + Intergenic
1015927156 6:138322109-138322131 GAGGCCCACCCACATTAGGGAGG - Intronic
1016784037 6:147990314-147990336 GAGGCCCACCCTCATTAGGGAGG - Intergenic
1018763544 6:166911007-166911029 GAGGCCAACCCACATTAGGGAGG + Intronic
1021240682 7:18197001-18197023 GAGGCCCATCCCCATTAAAGGGG - Intronic
1021463184 7:20912013-20912035 GAGGCCCACCCACACTGGGGAGG + Intergenic
1021807312 7:24370110-24370132 GAGGCCCACCCACATTAGGGAGG - Intergenic
1022668103 7:32429883-32429905 GAGGCCTATCCACATTGGGGAGG + Intergenic
1024086653 7:45897560-45897582 GATGCCCATCCCCATTATGGAGG + Intergenic
1024928359 7:54642132-54642154 GAGGCCCATCCATACTGGGGAGG - Intergenic
1026972034 7:74474336-74474358 GAGGGGTTTCCCCACCAGGGGGG - Intronic
1029263364 7:99319639-99319661 GAGGCCCACCCACATTAGGGAGG + Intergenic
1031188541 7:118515811-118515833 GAGGCCTACTCCCATTATGGAGG - Intergenic
1033496559 7:141903065-141903087 GATGCTTATCCACATTAGGGAGG + Intergenic
1034356946 7:150458410-150458432 GAGGCCCACCCCCACAAGTGAGG + Intronic
1035217294 7:157377651-157377673 GAGGCCCATCCACATTAGGGAGG + Intronic
1040653232 8:49473908-49473930 GAGGCCCATCCACACTATTGAGG + Intergenic
1041020798 8:53636231-53636253 AAGGCCCATCCACACTATGGAGG + Intergenic
1041204492 8:55484719-55484741 GAGGCCCACCCACACTGGGGAGG - Intronic
1042204011 8:66310190-66310212 AAGGCCCATCCACACTGGGGAGG - Intergenic
1042617735 8:70669001-70669023 GGGGCCGGTCCCCACTAGGTAGG + Exonic
1043117278 8:76274010-76274032 GAGGCCCATCCACATTAGGGAGG - Intergenic
1043356223 8:79415900-79415922 AAGGCCCATCCCCATTAGGGAGG - Intergenic
1044568910 8:93696617-93696639 GAGGCCTGCCCACATTAGGGAGG - Intergenic
1045487606 8:102644309-102644331 GAGGCCAATCCCCATTGGGGAGG - Intergenic
1045523176 8:102921038-102921060 GAGGCCAACCCACATTAGGGAGG + Intronic
1046366510 8:113238993-113239015 GAGGCCTACTCACATTAGGGAGG - Intronic
1046472841 8:114701273-114701295 GAGTCCTATCCACATTATGGAGG - Intergenic
1048692602 8:136984509-136984531 GAGGCCTATCCACATTAGAGAGG - Intergenic
1050311453 9:4357294-4357316 GAGGCCCACCCACACTTGGGAGG - Intergenic
1050501633 9:6304440-6304462 GAGGCCCACCCCCATTATGGAGG + Intergenic
1051061882 9:13054407-13054429 GAGGGCTATCCCCATTATGAAGG - Intergenic
1053861526 9:42391002-42391024 AAGGCCCATCCACACTATGGAGG + Intergenic
1054820550 9:69516636-69516658 GAGCCCTATGCCGACTACGGCGG - Exonic
1055743672 9:79418205-79418227 GAGGCCCATCCAGATTAGGGAGG - Intergenic
1057990719 9:99766883-99766905 GAGGCCCATCCACATTAGGAAGG - Intergenic
1058650515 9:107171634-107171656 GAGGTCCATCCACATTAGGGAGG + Intergenic
1059598098 9:115744861-115744883 GAGGCCCATTCACATTAGGGAGG - Intergenic
1060363172 9:122980663-122980685 CATGCCTATCTCCACTAGAGAGG - Intronic
1203754900 Un_GL000218v1:116820-116842 TAGGCCCTTCCCCTCTAGGGAGG + Intergenic
1187004886 X:15222839-15222861 GATGCCTACCCACACTAAGGAGG - Intergenic
1187137114 X:16558698-16558720 GAGGCCCACCCACATTAGGGAGG + Intergenic
1189539118 X:41967737-41967759 GATGCCTACCCACACTGGGGAGG + Intergenic
1191011339 X:55762598-55762620 GAGGCCTACCCACATTAGAGAGG + Intergenic
1193891469 X:87050974-87050996 GAGGCCCATCAACATTAGGGAGG - Intergenic
1193902670 X:87202197-87202219 GAGGCCCATCCACATTAGGGAGG - Intergenic
1194649783 X:96500869-96500891 GATGCCCATCCACACTGGGGAGG - Intergenic
1195303031 X:103550712-103550734 GAGGCCCACCCACACTGGGGAGG - Intergenic
1195331112 X:103801365-103801387 GAGGCCTGTCACCACTTGGCAGG - Intergenic
1195660624 X:107374295-107374317 GAGGCCCACCCACAATAGGGAGG + Intergenic
1197224066 X:123939221-123939243 GAGGCCCACCCACACTGGGGAGG - Intergenic
1198845888 X:140910040-140910062 GAGGCCCATCCACATTATGGAGG - Intergenic
1199052657 X:143255086-143255108 GAGGCCTATCCACATTGGGGAGG - Intergenic
1201168526 Y:11234428-11234450 TAGGCCCTTCCCCTCTAGGGAGG + Intergenic