ID: 960054735

View in Genome Browser
Species Human (GRCh38)
Location 3:113269081-113269103
Sequence GCCTCCAGGCACACACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960054732_960054735 -7 Left 960054732 3:113269065-113269087 CCTGGGGAAGCTCTGTGCCTCCA 0: 1
1: 0
2: 3
3: 32
4: 265
Right 960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 320
960054726_960054735 28 Left 960054726 3:113269030-113269052 CCATCCAGGCTCTCAGCACATGG 0: 1
1: 0
2: 0
3: 35
4: 277
Right 960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 320
960054728_960054735 24 Left 960054728 3:113269034-113269056 CCAGGCTCTCAGCACATGGTTCT 0: 1
1: 0
2: 0
3: 31
4: 237
Right 960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960054735 Original CRISPR GCCTCCAGGCACACACAGGA AGG Intronic
900333584 1:2149530-2149552 GCCTCCCTCCAGACACAGGATGG - Intronic
900400490 1:2471025-2471047 GCCTCCAGGGACACACAATGGGG + Intronic
900405474 1:2491042-2491064 GCCTGCAGGCAGCCACAGGCAGG - Intronic
900620732 1:3586579-3586601 TCCTCCATGCAGACACAGCACGG - Intronic
901004203 1:6163990-6164012 GCCTCCTGGCACACATAGGCTGG - Intronic
901050394 1:6423345-6423367 GCCTCTGGGCACCCAGAGGAGGG + Intronic
901231955 1:7646417-7646439 GCCTCCAGTCACACTCACCAGGG - Intronic
902456157 1:16535340-16535362 ACCACCAGGGACACACAGGAGGG + Intergenic
902496008 1:16872571-16872593 ACCACCAGGGACACACAGGAGGG - Intronic
903269651 1:22179305-22179327 GCCTCCAGGAACACTCAGCTAGG + Intergenic
904136162 1:28314202-28314224 GCCTCAATGCACAGACAGGTTGG - Intergenic
904359522 1:29962899-29962921 TCCTCCAGCCACTCCCAGGAAGG + Intergenic
904359551 1:29962992-29963014 TCCTCCAGCCACTCCCAGGAAGG + Intergenic
904396878 1:30228098-30228120 GCCACCAGGCCCACAAAGGTGGG + Intergenic
905337841 1:37257662-37257684 GCCTCCAGACAGGCACAGGCTGG - Intergenic
906038120 1:42766017-42766039 GCCCCCACACACACACAGAAAGG + Intronic
906531559 1:46526721-46526743 GCCTCCAGGCTCACCTAGGGAGG - Intergenic
907635860 1:56134268-56134290 GGCTGCTGGCACACAGAGGAAGG - Intergenic
907649957 1:56285628-56285650 GTGGCCAGGCACAAACAGGATGG - Intergenic
911050813 1:93669613-93669635 GCCTCCACGTACCCACAGGCAGG + Intronic
911149311 1:94581823-94581845 GCATCCAGGAAGACACTGGAGGG - Intergenic
911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG + Exonic
912449838 1:109761954-109761976 GCCTCCAGGCCCAGCCAGGATGG - Intronic
912543013 1:110431137-110431159 GCCTCCCAGGACACACAGCAGGG - Intergenic
912578730 1:110701034-110701056 GCCTCCAAGGTCACAGAGGAGGG + Intergenic
913551305 1:119919468-119919490 GCCTCCAGGCCCAGACAGACCGG - Exonic
913598939 1:120404684-120404706 ATCCCCAGGCACAGACAGGAAGG + Intergenic
913602271 1:120433459-120433481 TTTTCCAGCCACACACAGGAGGG + Intergenic
914084779 1:144443178-144443200 TTTTCCAGCCACACACAGGAGGG - Intronic
914088438 1:144474936-144474958 ATCCCCAGGCACAGACAGGAAGG - Intergenic
914190787 1:145408344-145408366 TTTTCCAGCCACACACAGGAGGG - Intergenic
914310174 1:146459274-146459296 ATCCCCAGGCACAGACAGGAAGG + Intergenic
914363443 1:146957065-146957087 TTTTCCAGCCACACACAGGAGGG + Intronic
914379664 1:147104911-147104933 ATCCCCAGGCACAGACAGGAAGG - Intergenic
914488234 1:148130069-148130091 TTTTCCAGCCACACACAGGAGGG - Intronic
914588596 1:149085189-149085211 TTTTCCAGCCACACACAGGAGGG - Intronic
914591936 1:149113865-149113887 ATCCCCAGGCACAGACAGGAAGG - Intergenic
915062763 1:153200070-153200092 GCCTTCAGACACACACAGAGAGG + Intergenic
915328338 1:155092783-155092805 CAGTCCAGGCACCCACAGGAGGG + Intergenic
915602985 1:156933955-156933977 GGCTCCAGGCACTCAGAGGCAGG - Intergenic
916714583 1:167438532-167438554 ACATGCAGGAACACACAGGAAGG + Intronic
917585877 1:176425958-176425980 GCCTCCAGCCACTCCCAGGCAGG - Intergenic
919083302 1:192891650-192891672 CCCAGCAGGCACCCACAGGAGGG + Intergenic
919988687 1:202693680-202693702 GACTCCAGGGACCCACAGGAGGG - Intronic
920096455 1:203489377-203489399 TCCTCCAAACACACACAGAATGG + Exonic
920555099 1:206898865-206898887 GCCACTAGGCACACATAGGCTGG - Intronic
920668372 1:207983393-207983415 GCCTCCAGGAGCACAGAGCAGGG + Intergenic
922898665 1:229119799-229119821 GCCTCCAACCCCACGCAGGAGGG - Intergenic
922971792 1:229747804-229747826 GCCTCCACGCAAGCACATGAAGG - Intergenic
923445779 1:234069900-234069922 TCCTCCAGGCACACAGAAGCTGG - Intronic
924286975 1:242497469-242497491 GCCTCCATACACACACACAAAGG - Intronic
924350946 1:243114199-243114221 TGCTCCAGGCACGCAAAGGAAGG + Intergenic
924554805 1:245109235-245109257 GCCTCCAAGTACATGCAGGAGGG - Intronic
924559040 1:245142633-245142655 GCCTCCTCGCTCCCACAGGAAGG - Intergenic
1062857405 10:786102-786124 GCCTCCAGCCGCACACAGACAGG + Intergenic
1064183538 10:13140732-13140754 GGCTGCAGGCAGACACTGGAAGG - Intergenic
1064567196 10:16653456-16653478 CCCTCCTCGCCCACACAGGATGG + Intronic
1066989761 10:42501803-42501825 GCCTTTAGGCCCACACTGGAAGG + Intergenic
1067048489 10:42999152-42999174 CCCTCCAGGGTCACCCAGGAGGG + Intergenic
1067739427 10:48883226-48883248 CCCTCCAGGCACATGCAGGAGGG - Intronic
1068762927 10:60733138-60733160 GCCGCCTGGCACCCCCAGGAGGG + Intronic
1071255018 10:83864591-83864613 CCCTCCAGGCACACACAGCTAGG - Intergenic
1071430390 10:85602318-85602340 GCCTCCAGGCACGGGCTGGAAGG + Exonic
1071521878 10:86336584-86336606 GGTTCCAGGCACCCAGAGGACGG - Intronic
1072524448 10:96259168-96259190 GTCTCCAGGGACAGAGAGGAAGG - Intronic
1073749434 10:106507299-106507321 GCCTCCAGTCAAAAACAGGCTGG - Intergenic
1075456548 10:122588659-122588681 TACTCTGGGCACACACAGGATGG - Intronic
1075461221 10:122617732-122617754 TACTCTGGGCACACACAGGATGG - Intronic
1075694088 10:124420415-124420437 GCCTCCTGGGACAAACAGCAGGG + Intergenic
1076541673 10:131219100-131219122 GCCTGCAGGCAGAGCCAGGACGG - Intronic
1076664310 10:132077351-132077373 GGCACCAGGCACTCACAGGAAGG - Intergenic
1076727889 10:132421829-132421851 CCCCCCAGCCACACCCAGGAAGG - Intergenic
1076789386 10:132768606-132768628 GCCTTCAGGAAAGCACAGGAAGG - Intronic
1080443608 11:32317370-32317392 GCATCCCGTCCCACACAGGAGGG - Intergenic
1080646709 11:34193068-34193090 GCCCCCAGGCACAACCAGCAAGG + Intronic
1082748871 11:56997000-56997022 GTCTCCAGGCACAAAAAAGATGG + Intergenic
1083195487 11:61083361-61083383 GACTCGAGGCAGACACAGGCAGG + Intergenic
1083614913 11:64021555-64021577 GCCTCCAGGGACATGCAGGTGGG - Intronic
1084458221 11:69281184-69281206 TCACCCAGGCACACCCAGGAGGG + Intergenic
1084524181 11:69685733-69685755 AGGTCCAGGCACACACAGTAGGG + Intergenic
1085320666 11:75572085-75572107 GCCTCAGGGTGCACACAGGATGG + Exonic
1085533219 11:77203684-77203706 GCCCCGAGGCACACAGAGCAGGG + Intronic
1087571331 11:99930353-99930375 ACATCCAGGCATACACAGTAAGG - Intronic
1088830495 11:113532332-113532354 GCCCCCAGGAACCCCCAGGAAGG - Intergenic
1088937838 11:114421514-114421536 ACCTCCATGCACACACAACATGG - Intronic
1089631929 11:119789331-119789353 GCCGCCAGGCACCCAGAGCAGGG - Intergenic
1091689676 12:2587413-2587435 GCCTCCCTGCACACACAACAGGG + Intronic
1092033616 12:5311092-5311114 CCACCTAGGCACACACAGGATGG + Intergenic
1092181961 12:6452243-6452265 GCCTCCATGGGCACACAGGAGGG + Exonic
1092312031 12:7368024-7368046 GCCACCAAGGGCACACAGGATGG - Intronic
1092462532 12:8698507-8698529 GCCTCCCGGCACACGCGCGAAGG - Intronic
1093116821 12:15221610-15221632 GCCTCCAGGCTCCCACCGAAGGG + Intronic
1097492109 12:60283012-60283034 GGCTGCAGGTACACCCAGGAGGG + Intergenic
1100610286 12:96186223-96186245 GCCTCCAGACAGAGACAGGAGGG + Intergenic
1100710498 12:97251162-97251184 GCCTCCAGCCAACTACAGGAGGG - Intergenic
1101417279 12:104519456-104519478 GCCTCGAGGCAGCCACAGGATGG + Intronic
1101777172 12:107805923-107805945 GCCCTCAGGCTCTCACAGGACGG - Intergenic
1102043523 12:109815703-109815725 GCCTCCTGGCACCCACAGCCTGG - Intronic
1102987945 12:117293958-117293980 TCCTCCTGGAAGACACAGGAGGG - Intronic
1103229909 12:119320706-119320728 GCCTCCAGAAACACAGAGCAAGG - Intergenic
1106841526 13:33689761-33689783 GCCTCAAGGTACAGACATGAAGG + Intergenic
1108025944 13:46177608-46177630 GCCTCCTGGCTCACCCAGGCTGG - Intronic
1110361624 13:74631824-74631846 GGCTCCAGGCACACACATCAGGG - Intergenic
1112483237 13:99796274-99796296 TCCTCCAGCCAAACCCAGGAAGG - Intronic
1113767289 13:112889285-112889307 GCCTCCAGGCTCTGACAGGGAGG + Intergenic
1114080481 14:19198774-19198796 CCCTGCAGGCAGACCCAGGAAGG + Intergenic
1114817375 14:25976365-25976387 GCTTCCAGACACATACAGGGAGG - Intergenic
1118697313 14:68397669-68397691 GCCTACACACACACACACGAGGG - Intronic
1118979653 14:70706207-70706229 GCCTCCTGGGGCTCACAGGAGGG - Intergenic
1119500938 14:75126946-75126968 GCCTCCGGGCATACGCAGGCTGG - Exonic
1119531959 14:75368309-75368331 GCCTCCAGTCCAACACAGTATGG + Intergenic
1121137028 14:91509292-91509314 GCCACCAGGCACTCAGAGAAAGG + Intronic
1121294916 14:92812334-92812356 GCAGAGAGGCACACACAGGAAGG - Intronic
1121550419 14:94795505-94795527 GCCCCCAAGCACTCAGAGGATGG - Intergenic
1121788883 14:96683893-96683915 GCTTCCAGGCACTGATAGGAAGG + Intergenic
1122281816 14:100628037-100628059 GCCTCCACACACACACGGGGTGG + Intergenic
1123071414 14:105644287-105644309 GGCTCCAGGCAGGCACAGGCTGG - Intergenic
1123076373 14:105669342-105669364 GGCTCCAGGCAGCCACAGGCTGG - Intergenic
1124183821 15:27503137-27503159 GCCTCTAGGCACCTTCAGGATGG - Intronic
1124942538 15:34231518-34231540 ACCTCCAGGCCCACTGAGGATGG - Intronic
1125956436 15:43793803-43793825 GGCTCCAGGCACACAGGCGAAGG - Exonic
1126864423 15:52921656-52921678 GCCTCTAGACACACTCAGGCAGG - Intergenic
1127842122 15:62840711-62840733 GGCTCCAGGCTCACCCGGGAGGG - Exonic
1128063094 15:64747556-64747578 GCAGCCAGGCAGCCACAGGAAGG - Intronic
1128616593 15:69115213-69115235 GGCTCCTGGCACACAAACGATGG - Intergenic
1128683213 15:69666286-69666308 GCCTAAAGGCACACACTGGGAGG + Intergenic
1128768478 15:70265307-70265329 GCCTCCAGGAAGACAGAGGCAGG - Intergenic
1129234554 15:74216183-74216205 GCCTCCAGACCCACACTGGTTGG + Intergenic
1130305610 15:82710508-82710530 GCCTCCACGTCCACCCAGGAGGG + Intergenic
1131716805 15:95120587-95120609 TCCTCAAGGGACACACAGAAAGG + Intergenic
1132574730 16:659177-659199 GCCACTAGGCAGACACAGGACGG - Intronic
1132675248 16:1118706-1118728 GCCTCCAGGGAGGCACAGGGAGG + Intergenic
1132871188 16:2116477-2116499 GCCTCCAGGGGCAGGCAGGAGGG + Intronic
1134097872 16:11431064-11431086 GCCTCCTGACACTCACAGGAAGG - Exonic
1134521339 16:14920417-14920439 GCCTCCAGGGGCAGGCAGGAGGG - Intronic
1134632683 16:15768240-15768262 ACCACCAGGGATACACAGGATGG + Intronic
1134709014 16:16319068-16319090 GCCTCCAGGGGCAGGCAGGAGGG - Intergenic
1134716223 16:16359102-16359124 GCCTCCAGGGGCAGGCAGGAGGG - Intergenic
1134950591 16:18349577-18349599 GCCTCCAGGGGCAGGCAGGAGGG + Intergenic
1134958529 16:18393057-18393079 GCCTCCAGGGGCAGGCAGGAGGG + Intergenic
1135975636 16:27107567-27107589 GCATGCAGGCACACCCAGAACGG - Intergenic
1136493178 16:30624384-30624406 ACCCACAGGCACACACATGAGGG - Intergenic
1140211803 16:72976560-72976582 GCGTCCAGGCAGGCAAAGGAAGG + Intronic
1140706254 16:77633088-77633110 GCCACCATTCACAGACAGGAAGG - Intergenic
1141129389 16:81425049-81425071 ACCACCAGGGACAGACAGGAAGG + Intergenic
1141290991 16:82717978-82718000 GCATCCCTGCACACACAGAATGG - Intronic
1141484903 16:84332314-84332336 TCCTCCAGGCCCAGACACGAGGG + Intergenic
1141671234 16:85492785-85492807 CACTCCAGGCAAACTCAGGAAGG - Intergenic
1142309560 16:89304616-89304638 ACATACAGGCACACACATGAGGG + Intronic
1143836793 17:9699353-9699375 CCCTCCTGGCTCACGCAGGAAGG + Intronic
1144081557 17:11768327-11768349 GCCGGCAGGCCCACACAGGGAGG + Intronic
1144648339 17:16990568-16990590 GCCTCCAGGCCAACAAAGGCTGG - Intergenic
1144892317 17:18501080-18501102 GGGCCCACGCACACACAGGATGG + Intergenic
1144947958 17:18979386-18979408 GCCTCCAGAGACAGACAGGCGGG + Intronic
1145139897 17:20443208-20443230 GGGCCCACGCACACACAGGACGG - Intergenic
1146685998 17:34841996-34842018 GCCTCCAGGCCCACGGAGGCTGG + Intergenic
1147447297 17:40482288-40482310 GCCTCCAGGCTCCCCCGGGATGG - Intronic
1147875352 17:43617027-43617049 GGGTCCAGGCACACCCAGCACGG - Intergenic
1147998290 17:44373592-44373614 CCCTCCAGGGCCACATAGGAAGG + Intronic
1149554757 17:57565448-57565470 GCCTCCAGGCACAAAGGGGCAGG - Intronic
1151280717 17:73072251-73072273 GCCTGCAGGGAAACACAGAAGGG + Intronic
1151368432 17:73631732-73631754 GGCACCAGCCACACACAGTAAGG + Intronic
1203167441 17_GL000205v2_random:110755-110777 GCCTCCAAGCATACACAGTGGGG + Intergenic
1153927458 18:9846749-9846771 GACTCCAAGAACCCACAGGAGGG + Intronic
1155874220 18:31064968-31064990 GCCCCCAGACACACACTGCATGG + Exonic
1157126480 18:44960970-44960992 GCCTCCAGGCACTGAGAGGGTGG + Intronic
1157615155 18:48982496-48982518 GCCAGCAGACACACAGAGGAGGG - Intergenic
1160120164 18:76122823-76122845 GGGTACAGACACACACAGGAAGG - Intergenic
1160428252 18:78793068-78793090 GCCTCCCTGCCCACACAGGAAGG + Intergenic
1160608053 18:80066969-80066991 CCCTCCAGGCAGGCAGAGGAGGG + Intronic
1161458838 19:4384327-4384349 GCCCCCAGGCACATACAGCACGG + Intronic
1161637004 19:5395256-5395278 TCCTTCTGGCACAAACAGGAAGG + Intergenic
1162376160 19:10306489-10306511 GTGTCCAGGCTCACACAGCAAGG - Intronic
1162922616 19:13912507-13912529 GCCTGCAGGGACACACAGCCAGG - Exonic
1163439495 19:17314547-17314569 GCCTCCAGGGAGGTACAGGAGGG + Intronic
1164547817 19:29183798-29183820 GCCTCCAGGTGGACACAAGAAGG - Intergenic
1164651273 19:29892583-29892605 GCCTCCTGGCACCATCAGGAAGG + Intergenic
1164856916 19:31531952-31531974 GCCTCAAGACAGACACAGGTGGG + Intergenic
1165045671 19:33103063-33103085 GCTCACAGGCACACTCAGGAGGG + Intronic
1165096571 19:33412982-33413004 GCCTCCAAGCACACCCAGCCAGG + Intronic
1166213977 19:41323909-41323931 CCCAGCAGACACACACAGGAGGG + Exonic
1166794221 19:45416710-45416732 TGCACCAGGCCCACACAGGAAGG + Intronic
1166921318 19:46230865-46230887 TTCTCCAGGCCCACCCAGGAAGG - Exonic
1167006035 19:46777195-46777217 GCCCCCTGACACTCACAGGATGG + Exonic
1167285360 19:48596168-48596190 GGCTACAGGGACACAGAGGAGGG + Intronic
1167359501 19:49022817-49022839 GCAACCACACACACACAGGATGG - Intergenic
1167364440 19:49047586-49047608 GCAACCACACACACACAGGATGG - Intergenic
1167960839 19:53103233-53103255 GTCTCCGGGCCCACACAGCAAGG + Intronic
1168129606 19:54309947-54309969 GCCTCCAGGTGAGCACAGGAGGG + Intronic
1168169791 19:54577637-54577659 GCCTCCAGGTGAGCACAGGAGGG - Intronic
1202707042 1_KI270713v1_random:31696-31718 ACCACCAGGGACACACAGGAGGG + Intergenic
925171126 2:1750793-1750815 GTCTTCAGGGACACATAGGATGG - Intergenic
926018547 2:9474867-9474889 GGCTCCAGGCACAGACGCGAGGG + Intronic
926148881 2:10413559-10413581 GCCCTCTGGCACACGCAGGAAGG + Intronic
926247347 2:11131249-11131271 GCCTCCCAGGACACACAGCAAGG + Intergenic
926289251 2:11515652-11515674 TCCTCCTGGGAGACACAGGAGGG - Intergenic
927284722 2:21344965-21344987 GCCTCCAGGAGCACACAGCATGG - Intergenic
927318911 2:21720087-21720109 GCATCCTGGGACACACAGGAAGG - Intergenic
928116800 2:28550960-28550982 GCTTCCAGGCACCCAGGGGATGG - Intronic
930661924 2:54063423-54063445 GCCTCCTGGAGCACACAGCAGGG - Intronic
932294448 2:70612785-70612807 GACTAGAGGCACACACAGGAGGG - Intronic
932460613 2:71879644-71879666 GCCTCCAGGGACACAAGGGATGG - Intergenic
932757498 2:74418384-74418406 GCCTCCAAGCAGAAAAAGGACGG - Intronic
934028177 2:88017854-88017876 GCCTCCAGGAACATAAAGTATGG - Intergenic
935619828 2:105119235-105119257 GCCTCCATGCAGCCCCAGGAGGG + Intergenic
935676573 2:105599529-105599551 CCCTCCATGAACACAAAGGAAGG + Intergenic
935962444 2:108439904-108439926 GTTTCCAAGTACACACAGGAAGG + Intergenic
936067428 2:109343101-109343123 GCCTCCACACCCACCCAGGAGGG - Intronic
937446235 2:121960880-121960902 CCCTCCAGACACAGTCAGGATGG - Intergenic
940781240 2:157936312-157936334 GCTTCCAGGCACATACACAACGG + Intronic
942483402 2:176413974-176413996 TCCCCCAGGCTCCCACAGGAAGG + Intergenic
943627970 2:190219762-190219784 GCATGCAGGCACACCCAGCATGG - Intronic
944630526 2:201619259-201619281 GCCTCCAGCCACTCCCAGCATGG - Intergenic
944645792 2:201780433-201780455 GCCGCCAGGGACACTCAGCAGGG + Intronic
946412853 2:219523610-219523632 GCCACCTGGCTCACCCAGGAGGG - Intronic
947463832 2:230324485-230324507 GACTCCAGGGACACCCAGCAAGG + Intergenic
948127331 2:235573989-235574011 GGCTCCTGGCCAACACAGGAAGG - Intronic
948146039 2:235708839-235708861 GCCAACAGGCACAGTCAGGAGGG + Intronic
948376734 2:237525759-237525781 GCCTGGAGGCTCCCACAGGATGG + Exonic
948918107 2:241048499-241048521 TCCTGCATGCACCCACAGGAAGG - Intronic
1172240959 20:33412281-33412303 GCCACCAGGTACCCACAGGCAGG - Exonic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173143596 20:40506153-40506175 GCCTCCAAGGACACACAGCTGGG + Intergenic
1173698905 20:45048942-45048964 GCCTCCAGGCAGGCACAGAAGGG - Intronic
1175001804 20:55637037-55637059 GAGTCCAGCCACACACAGGAGGG - Intergenic
1175657371 20:60782739-60782761 CAGTCCAGGCACACCCAGGATGG - Intergenic
1175689737 20:61056782-61056804 GCCTCAGGCCACACACAGCAAGG - Intergenic
1175860801 20:62149083-62149105 GACTCCAAGCACACAGAGGCAGG - Intronic
1176919564 21:14670755-14670777 GCCACCAGGCACAGCCTGGAAGG + Intergenic
1177358959 21:20044975-20044997 GCCTGCAGGCACTCACATCATGG + Intergenic
1179189930 21:39115176-39115198 GCCTCCCAGCACACACAGGGGGG - Intergenic
1179571116 21:42279458-42279480 GCCTCCTGGAACCCACCGGATGG + Intronic
1179653551 21:42830977-42830999 GCCTGTGGTCACACACAGGAAGG - Intergenic
1180500298 22:15923910-15923932 CCCTGCAGGCAGACCCAGGAAGG - Intergenic
1180799931 22:18627018-18627040 GTCTCCAGACACGCACAGCAAGG - Intergenic
1181492496 22:23269251-23269273 ACCACCAGGCAGACACAGGCTGG - Intronic
1181521727 22:23452253-23452275 GCCACCAGGCCCACACAAGCAGG + Intergenic
1181596048 22:23915484-23915506 GCAACCTGGCACACACAGGGAGG + Intergenic
1183103396 22:35597981-35598003 GCGTCAGGGCACCCACAGGATGG + Intergenic
1183619998 22:38966694-38966716 CACTCGAGGCACACACAGCATGG - Intronic
1183665195 22:39242741-39242763 GCCTCCAGCCAGGCGCAGGAAGG - Intronic
1183954139 22:41369084-41369106 GCCCCCCAGCACACACATGAAGG + Intronic
1184615237 22:45633468-45633490 GCCTGCAGATACAAACAGGATGG + Intergenic
1184746152 22:46457433-46457455 GCCCACTGGCGCACACAGGAGGG + Intronic
950005998 3:9691346-9691368 GCAGGCATGCACACACAGGATGG - Intronic
950500648 3:13361512-13361534 CCCTCCAGTGACACACAGCAGGG + Intronic
952129968 3:30350110-30350132 GCCACCAGAAACACACATGATGG + Intergenic
952496456 3:33920165-33920187 GTCTCCAGGCACCCAGAGGCTGG - Intergenic
952957473 3:38565942-38565964 GCCTCCATGCACACACGAGGAGG - Intronic
953852014 3:46471680-46471702 TCCTCAAGACACACACAGGTAGG - Intronic
954118031 3:48478076-48478098 GCCTCCAGGCCCACACAGGCTGG + Intronic
955327948 3:58024129-58024151 GCCTCCTGGCTGAGACAGGATGG - Intronic
956178746 3:66499451-66499473 GCCCCAGGGAACACACAGGAAGG + Intronic
956736457 3:72242341-72242363 GCCTCCAGCCCCACACAGCAGGG + Intergenic
960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG + Intronic
960571223 3:119187231-119187253 GCCACCAGACCCACACAGTATGG - Intronic
960977290 3:123187696-123187718 GCGTCCAGACGCACACAGGTTGG + Intronic
961117004 3:124339143-124339165 GCCTCCAGAAACAGACAGCAAGG + Intronic
961141994 3:124563522-124563544 GACACCAGGCACACCCAGGGAGG + Intronic
961455767 3:127023141-127023163 GCCTTCAGGCACCCCCAGGCTGG - Intronic
961751400 3:129097257-129097279 CCCACCAGGCACACACACAATGG + Intronic
962332110 3:134486835-134486857 GGCTCCATGCACACAAATGAGGG + Intronic
962349564 3:134646824-134646846 GCCTCCAGGGACAAACATCAGGG - Intronic
963616282 3:147542354-147542376 GCCTCAAGGAACCAACAGGAAGG - Intergenic
965212459 3:165810412-165810434 GCCTATCTGCACACACAGGAAGG - Intronic
968931322 4:3581089-3581111 GCCTCAATGCACACACATGTCGG - Intronic
969110602 4:4841789-4841811 GCCCCCAGGCACAGAAAGGAGGG + Intergenic
970380633 4:15503780-15503802 TCCTCCAGAGACACAGAGGAAGG + Intronic
970581554 4:17478159-17478181 CCCACCAGGAACAGACAGGAAGG + Intronic
972746260 4:41935361-41935383 GCCTCGCGCCACACACAGGCCGG - Exonic
973919543 4:55670912-55670934 GCCTCCAGATAACCACAGGATGG - Intergenic
979250994 4:118566359-118566381 TGCTCCAGGCACGCAAAGGAAGG - Intergenic
979794036 4:124822083-124822105 GCTTTAAGGCACACACAGGCTGG - Intergenic
980749622 4:137071146-137071168 GCCTCCAGACTAACGCAGGAAGG - Intergenic
982478143 4:155877754-155877776 GGCTGCAGGCATACACAGGATGG - Intronic
985207354 4:187553385-187553407 GTTTCCAGGTACACACATGAAGG + Intergenic
986206642 5:5630710-5630732 CCCTCCAGGGCCACACAGGCTGG + Intergenic
986301122 5:6479112-6479134 GCATCTAGGGACACACAGCACGG + Intronic
986310001 5:6544659-6544681 GTCTGCAGGCAGAGACAGGATGG + Intergenic
988541856 5:32117427-32117449 GCATCCAGGCAAAAACAGCAAGG + Intergenic
989305276 5:39947978-39948000 ACTTCCAGTCACACACTGGAGGG - Intergenic
992039196 5:72812705-72812727 GCCTCCACTGACACCCAGGATGG + Intergenic
992291273 5:75282537-75282559 GCATCCAGGGGCACACAGTATGG - Intergenic
997261976 5:132472287-132472309 GTCTCCAGGGTCACACAGCAAGG + Intronic
1001295528 5:170496188-170496210 GCCCCCAGGCACTAAAAGGATGG + Intronic
1001996398 5:176163375-176163397 GCCTTCATCAACACACAGGATGG - Intergenic
1002183353 5:177442632-177442654 CCCCACAGGCGCACACAGGAAGG - Intronic
1002376229 5:178791037-178791059 GCACCCATGCACACACAGCAGGG + Intergenic
1003573270 6:7269826-7269848 CCCTCCAGGCACCCACAGTTAGG - Intronic
1004339786 6:14798244-14798266 GCCTCCAGGAAAACAGAGCAGGG + Intergenic
1004348835 6:14873316-14873338 GCTTCCAAACAGACACAGGAAGG - Intergenic
1006276747 6:33010214-33010236 TCCTCCAGGCTGACACAGGCTGG + Intergenic
1008292991 6:49740807-49740829 GCATCCAGCCCCACACAGGATGG - Intronic
1008543247 6:52564093-52564115 GGTCCCATGCACACACAGGATGG - Intronic
1010355296 6:74925654-74925676 GCCTCCTGGGTCACACTGGAGGG - Intergenic
1012292865 6:97480909-97480931 GCCTCCAGGCATCCAAAGCATGG + Intergenic
1012310171 6:97714367-97714389 GCCTCCAGCCACACAAATAAAGG - Intergenic
1016652152 6:146474599-146474621 TTCTCCATGCACACACAGCAGGG - Intergenic
1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG + Intronic
1018058059 6:160069340-160069362 GCCTCAAACCACACAGAGGATGG - Intronic
1018133710 6:160757544-160757566 GCCCCCAGGAACACACAGCTGGG + Intergenic
1019442752 7:1055725-1055747 GCCTCCAGTCACTGACAGGAGGG - Intronic
1019967150 7:4508944-4508966 GCCTCCAGGGACACTGAGGCTGG + Intergenic
1020139946 7:5606658-5606680 GCCCCAAGACACACACAGGCCGG - Intergenic
1020277788 7:6635468-6635490 GCCCCCAGGCACTCCCAGGAAGG - Intergenic
1021431415 7:20562631-20562653 GCCTCCAGGAAAGCACAGCAAGG - Intergenic
1024701812 7:51911833-51911855 TCCTCCAGGCACAAAGAAGAAGG + Intergenic
1024780096 7:52837639-52837661 GCCACCAGGAACACACTTGAGGG + Intergenic
1024979564 7:55146056-55146078 GACTCCAGGGATGCACAGGATGG - Intronic
1028522221 7:91744052-91744074 GAATCCAGTCACAGACAGGATGG + Intronic
1028920668 7:96306904-96306926 GGCTCCAGGCACACAAGTGAAGG - Intronic
1031082456 7:117271914-117271936 GACTCCAGGGACACACAGTGCGG + Intergenic
1033156463 7:138961139-138961161 TCCTCTAGGCACACACTGGGAGG + Intronic
1034090026 7:148355034-148355056 GCATCCAGGTACTCACTGGAAGG + Intronic
1034931655 7:155168158-155168180 GCATCCAGGCTCACGAAGGACGG + Intergenic
1034979754 7:155468130-155468152 GCCTCCACGGAGACCCAGGAGGG + Intergenic
1035202859 7:157278224-157278246 GACTCCAGGCACCCACCTGAGGG - Intergenic
1035320168 7:158023798-158023820 GCATGCAGGCACACACAAGCAGG + Intronic
1035556716 8:572680-572702 GGCTCGTGGCTCACACAGGATGG - Intergenic
1036285472 8:7441328-7441350 CTCTCCAGGAGCACACAGGAGGG - Intergenic
1036336002 8:7870201-7870223 CTCTCCAGGAGCACACAGGAGGG + Intergenic
1036815909 8:11902707-11902729 CCCTCCAGTCACAGACAGGAAGG - Intergenic
1037308720 8:17532372-17532394 TACTACTGGCACACACAGGAGGG - Intronic
1037466781 8:19168680-19168702 GCCTCAAGGCACACACATGCAGG + Intergenic
1037821033 8:22134604-22134626 GCCTCCAGTTGCACACTGGAGGG - Intergenic
1038239760 8:25797691-25797713 GCTTCGAGGGAGACACAGGAGGG + Intergenic
1038972167 8:32647886-32647908 GCTTCTAGGCACGCACAGCAGGG - Intronic
1041695014 8:60726854-60726876 ACCCCCTGGGACACACAGGAAGG - Intronic
1048180963 8:132193777-132193799 GCCTCCAAGCTCAGGCAGGAGGG + Intronic
1048854373 8:138673887-138673909 GCCTCCAACCAAACACAGGCAGG + Intronic
1049687106 8:143943411-143943433 GGCTCCCTGCACACACAGCAGGG - Intronic
1049815969 8:144600461-144600483 GCCTCGATGCACACGCAGGTAGG - Intronic
1049815975 8:144600503-144600525 GCCTCCACGCACACGCAGGTAGG - Intronic
1049815987 8:144600633-144600655 ACCTCCATGCACACGCAGGTAGG - Intronic
1049815995 8:144600760-144600782 GCCTCCATGCACACGCAGGTAGG - Intronic
1049816050 8:144601487-144601509 GCCTCCACGCACACACACACAGG - Intronic
1049816098 8:144602148-144602170 GCCTCCACGCACACACACACAGG - Intronic
1049816152 8:144602902-144602924 GCCTCCACGCACACACACACAGG - Intronic
1049848991 8:144820744-144820766 GCATCCTGGCACACCCAGCATGG + Intergenic
1050080704 9:1912888-1912910 GCCTTCAGGCCTTCACAGGATGG + Intergenic
1052963398 9:34319657-34319679 GCCTCAGGGTGCACACAGGATGG + Intronic
1056442122 9:86631807-86631829 GCCTAGAGGCAAACATAGGAAGG + Intergenic
1057192185 9:93094449-93094471 GCCTGCAGGGACCCACAGGCTGG + Intergenic
1058761519 9:108138260-108138282 GACTACAGGCAGACAGAGGAAGG + Intergenic
1058814496 9:108670842-108670864 GCCTCCAGAAACACCCAGGTTGG + Intergenic
1059142829 9:111870393-111870415 GCCCCCAGGCAGTCTCAGGATGG + Intergenic
1060995536 9:127873358-127873380 GGGTCCAGGCACCCACAGGGAGG - Intronic
1062318621 9:135979837-135979859 TCCTCCAGGGACACCCAGGGAGG + Intergenic
1062435418 9:136544786-136544808 GCCCCCATACACCCACAGGAGGG + Intronic
1062483699 9:136763900-136763922 GCCATCAGGCCCACAGAGGAGGG - Exonic
1185761228 X:2691170-2691192 GCCTCCACGCGCGCACAGAAGGG - Exonic
1188854624 X:35177916-35177938 GACAGCAGGGACACACAGGATGG - Intergenic
1189753685 X:44249199-44249221 GCCTCCAAGCAAACGCAGTAGGG + Intronic
1196515651 X:116606944-116606966 GCCTCCAGACAGACAGAGAAAGG - Intergenic
1198137793 X:133771421-133771443 GTCTCCAGGCCCACACAGAGGGG - Intronic
1200217926 X:154376735-154376757 GGCTCCAGGTACCCACAGGGTGG + Intergenic