ID: 960056153

View in Genome Browser
Species Human (GRCh38)
Location 3:113278035-113278057
Sequence CATAGCCCACTCGTAGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960056143_960056153 27 Left 960056143 3:113277985-113278007 CCTTCCCCTTCTCCTGCCCTCTT 0: 1
1: 1
2: 46
3: 421
4: 2981
Right 960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
960056147_960056153 22 Left 960056147 3:113277990-113278012 CCCTTCTCCTGCCCTCTTGGGCT 0: 1
1: 0
2: 5
3: 47
4: 479
Right 960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
960056149_960056153 15 Left 960056149 3:113277997-113278019 CCTGCCCTCTTGGGCTCAGCGCT 0: 1
1: 0
2: 2
3: 8
4: 223
Right 960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
960056148_960056153 21 Left 960056148 3:113277991-113278013 CCTTCTCCTGCCCTCTTGGGCTC 0: 1
1: 0
2: 13
3: 57
4: 642
Right 960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
960056150_960056153 11 Left 960056150 3:113278001-113278023 CCCTCTTGGGCTCAGCGCTGCTT 0: 1
1: 0
2: 0
3: 11
4: 158
Right 960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
960056146_960056153 23 Left 960056146 3:113277989-113278011 CCCCTTCTCCTGCCCTCTTGGGC 0: 1
1: 1
2: 4
3: 77
4: 502
Right 960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
960056151_960056153 10 Left 960056151 3:113278002-113278024 CCTCTTGGGCTCAGCGCTGCTTT 0: 1
1: 0
2: 0
3: 16
4: 167
Right 960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960056153 Original CRISPR CATAGCCCACTCGTAGCCCG AGG Intronic
909607057 1:77518285-77518307 CATAGACCACTTGTAACCCATGG - Intronic
1067539795 10:47143236-47143258 CCCAGCCCAGCCGTAGCCCGAGG - Intergenic
1069959613 10:72072173-72072195 CATGGCCCGCTGGTAGCCCTGGG + Exonic
1073385709 10:103126647-103126669 CATAGTCCACTCTTGGCCAGTGG + Intronic
1075157345 10:119989213-119989235 CATAGCACACAGGTAGCCCAAGG - Intergenic
1075803373 10:125167169-125167191 CATTGCCCCCTCCTAGCCCCTGG - Intergenic
1076576873 10:131475231-131475253 CACTGCCCACTCGGCGCCCGGGG - Intergenic
1082627362 11:55501553-55501575 CATACACCACTCGTACCCCAGGG - Intergenic
1091457044 12:615737-615759 CATAGCCCTCTAATAGCCCATGG - Intronic
1092242459 12:6843570-6843592 CACAGCCCACTGGAAGCCCAGGG - Intronic
1104879948 12:132063848-132063870 CCTAGCCCACTTGTATCCTGCGG + Intronic
1122309275 14:100784250-100784272 CCTAGCCCGCACGTAGCCCCTGG - Intergenic
1123688670 15:22818924-22818946 CATAGTCCACCCGTTGTCCGAGG + Intronic
1129080332 15:73033754-73033776 GATAGCCCCCTCTTAGCCCTGGG + Intergenic
1138347947 16:56331476-56331498 CATAGCCCAGTCCTATCCTGGGG + Intronic
1142254288 16:89006546-89006568 CATAGCTCACTCCCAGCCCTGGG - Intergenic
1143272469 17:5685957-5685979 CATGGCCCACTCCCAGCCCCTGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1175814313 20:61875616-61875638 CACAGCTCACTCGGAGCCCCAGG - Intronic
960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG + Intronic
1012283626 6:97361832-97361854 CATAGCACTCTAGGAGCCCGAGG + Intergenic
1018358761 6:163044684-163044706 GCCAGCACACTCGTAGCCCGCGG - Intronic
1023514885 7:40992090-40992112 CATAGCCAACCAGTAGCCCTCGG - Intergenic
1026775653 7:73229624-73229646 CAGAGCCATCTCGGAGCCCGAGG - Intergenic
1027016512 7:74782996-74783018 CAGAGCCATCTCGGAGCCCGAGG - Exonic
1027071517 7:75162940-75162962 CAGAGCCATCTCGGAGCCCGAGG + Intergenic
1027269413 7:76511799-76511821 CATGGCCCACCCGCAGCACGGGG - Exonic
1027320122 7:77005692-77005714 CATGGCCCACCCGCAGCACGGGG - Intergenic
1046671280 8:117059269-117059291 TATAGCCAAGTCGTAGCCTGGGG + Intronic
1188675689 X:32936542-32936564 GACAGCCCACTCCTAGCCCATGG + Intronic
1189383939 X:40521531-40521553 GACAGCCCCCTCGTAGCCCACGG + Intergenic
1200153195 X:153961510-153961532 CACAGGCCACTCGGAGCCCGAGG + Intronic