ID: 960057741

View in Genome Browser
Species Human (GRCh38)
Location 3:113287202-113287224
Sequence CTCGTGATGAACCATGTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960057741_960057744 -5 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057744 3:113287220-113287242 ACGAGCATGAGGGAACAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 170
960057741_960057748 15 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057748 3:113287240-113287262 AGGGGCACGGTATCACAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 76
960057741_960057747 2 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057747 3:113287227-113287249 TGAGGGAACAGCAAGGGGCACGG 0: 1
1: 1
2: 5
3: 92
4: 720
960057741_960057746 -3 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057746 3:113287222-113287244 GAGCATGAGGGAACAGCAAGGGG 0: 1
1: 0
2: 1
3: 30
4: 333
960057741_960057745 -4 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057745 3:113287221-113287243 CGAGCATGAGGGAACAGCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960057741 Original CRISPR CTCGTGATGAACCATGTGCC TGG (reversed) Exonic
917363069 1:174198723-174198745 CTCTTGATGACCAAGGTGCCCGG - Intronic
920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG + Intronic
921583337 1:216921194-216921216 CTCCTGATGAAAGATGTGTCTGG - Intronic
923915660 1:238500945-238500967 CTAGTGAAGCACCCTGTGCCTGG + Intergenic
1062791270 10:307946-307968 CTCCAGATGGACCGTGTGCCGGG - Intronic
1062791290 10:308004-308026 CTCCAGATGGACCATGTGCTGGG - Intronic
1063496258 10:6511691-6511713 ATCATGATGAACCAGGGGCCTGG + Intronic
1065266497 10:23982047-23982069 GTAGTGGTGAGCCATGTGCCTGG + Intronic
1079193386 11:18301694-18301716 CTCCTGCTCAACGATGTGCCAGG + Intronic
1079320628 11:19448542-19448564 CCCATGAAGAACCACGTGCCAGG - Intronic
1081252978 11:40858416-40858438 ATAGGCATGAACCATGTGCCTGG - Intronic
1089598762 11:119600049-119600071 GTGGTTATGAATCATGTGCCTGG + Intergenic
1094114315 12:26893814-26893836 CATTTAATGAACCATGTGCCAGG - Intergenic
1095593715 12:43935900-43935922 CTCATGCTGAACCCTCTGCCTGG - Intronic
1098851412 12:75600649-75600671 CACCTGATGAAACATGTGCTGGG + Intergenic
1100853237 12:98735697-98735719 ATTGAGATGTACCATGTGCCTGG + Intronic
1101405103 12:104421635-104421657 CTCGAGATGGTGCATGTGCCTGG + Intergenic
1102285886 12:111656174-111656196 CTCGACATCCACCATGTGCCAGG - Intronic
1104652393 12:130545211-130545233 CTCGAGATGTACCAAGTACCAGG - Intronic
1104988470 12:132610944-132610966 TTTGTGATCGACCATGTGCCAGG + Intergenic
1105704673 13:22961594-22961616 TTCATAATGAACCCTGTGCCCGG - Intergenic
1118264524 14:64282062-64282084 GACGTGATGAACACTGTGCCTGG - Intronic
1129204092 15:74025144-74025166 CTCTTGATGGGCCATGAGCCAGG + Intronic
1133580152 16:7136938-7136960 CTCGTCATGGCCCATGGGCCAGG + Intronic
1140973829 16:80040367-80040389 TTTGTGATGAAACATTTGCCAGG + Intergenic
1144663129 17:17084388-17084410 TTCGGGAGGAGCCATGTGCCCGG + Intronic
1159518598 18:69489370-69489392 CCAGTGATGGACCATGGGCCAGG + Intronic
1164691855 19:30217246-30217268 CTGGTGATGAACCATGTTTGGGG + Intergenic
1164965443 19:32479295-32479317 CCCCTGATGAACCTGGTGCCTGG - Intronic
1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG + Intergenic
1167782856 19:51611716-51611738 CACATCATGAACCAAGTGCCAGG + Intergenic
934769231 2:96897275-96897297 CTAGACATGTACCATGTGCCAGG - Intronic
1171002947 20:21433306-21433328 CTGGTGCTGAGCCATGTGCATGG - Intergenic
1171119691 20:22557799-22557821 CTTGGGAGGCACCATGTGCCTGG - Intergenic
1172151103 20:32791034-32791056 CTCCTGATGTACCAAGTCCCTGG - Intronic
1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG + Intronic
1183093944 22:35541181-35541203 CTCCTGCTGAGCCAGGTGCCCGG - Exonic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
952441879 3:33338862-33338884 TTCGTCATGAAGCATTTGCCAGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG + Intronic
984025478 4:174538604-174538626 CTGCAGAGGAACCATGTGCCTGG - Intergenic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
987026568 5:13932767-13932789 CTCTTGATGAACCCAGTGTCTGG - Intronic
988041889 5:25900356-25900378 TTCGTGATGGACCATCTACCTGG - Intergenic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
999671751 5:153964662-153964684 CTCCTGTGGAACCAAGTGCCAGG - Intergenic
1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG + Intronic
1002240706 5:177837399-177837421 CTCCTGGTCAACCATGTGGCAGG - Intergenic
1005396716 6:25389890-25389912 CTGGTGTTGAACTATGTGCTAGG + Intronic
1008405095 6:51110117-51110139 CTGGTTATGTACCATGTGCTAGG - Intergenic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1020098062 7:5379547-5379569 CTGGTGACCATCCATGTGCCAGG - Intronic
1024581602 7:50805272-50805294 AGCCTGATGAACCATGGGCCTGG - Intergenic
1034357751 7:150466067-150466089 CTCGTGATGCACCCAGTGCCAGG - Intronic
1042530684 8:69811749-69811771 TTAGTGTTTAACCATGTGCCAGG + Intronic
1043437061 8:80245164-80245186 CTATTGATGAACTATGTCCCAGG + Intergenic
1043560460 8:81487801-81487823 TTGGTGAAGAACCAGGTGCCAGG - Intergenic
1048857183 8:138695239-138695261 CTGATGATCTACCATGTGCCAGG - Intronic
1050272953 9:3965619-3965641 CTCCTGACGAAACATGTGCATGG + Intronic
1050959972 9:11717248-11717270 CTTGTGCTTAACCTTGTGCCTGG - Intergenic
1060355918 9:122906805-122906827 CTCTTTATGAAACATATGCCAGG + Intergenic
1060385118 9:123218770-123218792 ATTATGATTAACCATGTGCCAGG + Intronic
1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG + Intergenic
1186907345 X:14125909-14125931 TTCCTGATGATCCAAGTGCCAGG - Intergenic
1187246856 X:17560623-17560645 ATAGTGCTGAACCATGTGCTGGG - Intronic
1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG + Exonic