ID: 960057744

View in Genome Browser
Species Human (GRCh38)
Location 3:113287220-113287242
Sequence ACGAGCATGAGGGAACAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960057736_960057744 24 Left 960057736 3:113287173-113287195 CCACAGATAAGCTGGCAAGAGGA 0: 1
1: 0
2: 1
3: 14
4: 177
Right 960057744 3:113287220-113287242 ACGAGCATGAGGGAACAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 170
960057741_960057744 -5 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057744 3:113287220-113287242 ACGAGCATGAGGGAACAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 170
960057740_960057744 -4 Left 960057740 3:113287201-113287223 CCCAGGCACATGGTTCATCACGA 0: 1
1: 0
2: 0
3: 7
4: 70
Right 960057744 3:113287220-113287242 ACGAGCATGAGGGAACAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 170
960057734_960057744 25 Left 960057734 3:113287172-113287194 CCCACAGATAAGCTGGCAAGAGG 0: 1
1: 1
2: 0
3: 13
4: 133
Right 960057744 3:113287220-113287242 ACGAGCATGAGGGAACAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960057744 Original CRISPR ACGAGCATGAGGGAACAGCA AGG Exonic
900032005 1:379083-379105 AGGAGGATGAGGGGACAGAAAGG + Intergenic
900052554 1:607269-607291 AGGAGGATGAGGGGACAGAAAGG + Intergenic
901028222 1:6290479-6290501 TGGAGCCTGAGGGCACAGCAGGG - Intronic
904464892 1:30701847-30701869 AACAGCAAGAGGGACCAGCAAGG - Intergenic
905310110 1:37043167-37043189 AGGAGCATGAAGGAGCAGCTGGG + Intergenic
905768450 1:40622333-40622355 ACAAGCATGATTGAAGAGCAGGG - Exonic
906109370 1:43312807-43312829 AGGAGCATGTGGGGAGAGCATGG + Intronic
907870102 1:58435382-58435404 ACGACCATGGGGGAAAAACAAGG - Intronic
915698946 1:157772449-157772471 ACCAGCAAGTGGGAGCAGCAGGG + Intronic
916994830 1:170285208-170285230 AAGAGCATGATAGGACAGCACGG + Intergenic
917452858 1:175161718-175161740 GAGATCATGAGGGGACAGCACGG - Intronic
923402863 1:233632037-233632059 ACGTGGAAGAGGGAACAGGATGG - Intronic
924280996 1:242437350-242437372 ATGAGAATGAGTGAACCGCAGGG - Intronic
1062833721 10:623159-623181 ACGAGCATCAGGTGACAGGAGGG + Intronic
1064800046 10:19060340-19060362 GCCAGCATCAGGGAGCAGCAGGG - Intronic
1065081758 10:22136322-22136344 GCCAGCACGAGGGGACAGCATGG + Intergenic
1066584962 10:36922757-36922779 AAGAGCATTAGAGAACACCATGG - Intergenic
1067287268 10:44915640-44915662 AGGAGCATGAGGGTAGAGGATGG - Intronic
1069250406 10:66259393-66259415 ATGAGCATGGGGGAACACAAAGG + Intronic
1072417198 10:95259033-95259055 AGGAGGATGAGGGAAAAGGAGGG + Intronic
1080371758 11:31655557-31655579 AAGAGCTTGAGGCATCAGCAGGG + Intronic
1080590799 11:33721708-33721730 TGGAGCAGGAGGGAAGAGCAGGG + Intronic
1083616844 11:64030400-64030422 TCCAGCATGTGGGGACAGCATGG - Intronic
1084087761 11:66862406-66862428 AGGACCCTGAGGGGACAGCACGG + Intronic
1085156743 11:74302522-74302544 AGGACCTTGAGGGAGCAGCAAGG - Exonic
1093941702 12:25062172-25062194 AAGAACATAAGGGAACAGCAAGG + Intronic
1094787739 12:33870247-33870269 ACGAGGATTGGGGAACACCAGGG - Intergenic
1098200449 12:68049253-68049275 ATGAGCATGTGGGAATAGTATGG - Intergenic
1098302193 12:69066045-69066067 AAGATTATGAGGCAACAGCAGGG - Intergenic
1099361649 12:81709182-81709204 TCTAGGAAGAGGGAACAGCAAGG - Intronic
1101090963 12:101284823-101284845 ACGAACATGAGAGGACAGTATGG - Intronic
1103733001 12:123041248-123041270 ACTAGCAAGAGTGAACAACAAGG + Intronic
1104058760 12:125250361-125250383 ATGTGCAAGATGGAACAGCAAGG - Intronic
1104388718 12:128373835-128373857 ACGAGCATCAGGGAGATGCAGGG + Intronic
1104791691 12:131486685-131486707 AAGAGCTTGAGGGAACACTAGGG - Intergenic
1107305309 13:39012830-39012852 CCGGGAATGAGGGAAGAGCAGGG + Exonic
1107417707 13:40216707-40216729 ACAAGCAGGAGTGAACAGGATGG - Intergenic
1114439658 14:22735997-22736019 ATGATCATGAGGGAACATAAAGG + Intergenic
1118108712 14:62691839-62691861 ATGGGCATGAGGGACCAGCTTGG + Intergenic
1118119843 14:62828608-62828630 ACTGTCATGAGAGAACAGCATGG + Intronic
1118120121 14:62830601-62830623 ACTATCATGAGAGAACAGCATGG + Intronic
1118821751 14:69350480-69350502 AAGAGCATGAAGAAACAGGAGGG + Intronic
1120862117 14:89264400-89264422 ACTAACATGACAGAACAGCATGG + Intronic
1121222601 14:92297883-92297905 AAGAGGATGAGGGAAAAGGAAGG - Intergenic
1126282097 15:46965335-46965357 ACTATCATGAGAGAACAGCAAGG - Intergenic
1128040597 15:64569468-64569490 AAGAGCATGAGGGAACTGATAGG - Intronic
1128571213 15:68734403-68734425 AAAAGCATGAGGGAAAGGCATGG + Intergenic
1128674205 15:69596721-69596743 ACCAGGATAAGGCAACAGCAGGG - Intergenic
1131048568 15:89331893-89331915 ATGAGAATGAGGGCAGAGCAGGG + Intronic
1131869548 15:96747553-96747575 ACGGGCATCAGGGAAGAGTAGGG + Intergenic
1132140101 15:99385188-99385210 ACCAGCAGGAGGCACCAGCAGGG - Intronic
1132302098 15:100782178-100782200 ACCAGCTCCAGGGAACAGCAGGG - Intergenic
1133103748 16:3494144-3494166 AGGAGGTTGAGGGAACAGAATGG + Intronic
1133427125 16:5702349-5702371 ACTATCATGAGATAACAGCAAGG + Intergenic
1134352330 16:13449471-13449493 AGGAGCATGAGGGAACTTCCTGG + Intergenic
1135420563 16:22303116-22303138 ACCAGGCAGAGGGAACAGCAAGG - Intronic
1135721116 16:24819298-24819320 AAAAGCATGAGGGGACAGCAAGG - Intronic
1136473056 16:30494664-30494686 AAGCGCCTGTGGGAACAGCAGGG - Intronic
1140648191 16:77057141-77057163 ACGAGTATGCTGGAAGAGCAAGG - Intergenic
1141261711 16:82460243-82460265 TGCAGCAGGAGGGAACAGCAAGG - Intergenic
1141619253 16:85228091-85228113 TCCAGGAGGAGGGAACAGCACGG + Intergenic
1142808674 17:2385187-2385209 AGGACCAGGAGGGAACAGGAAGG + Exonic
1143020223 17:3913750-3913772 AGGAGCATGAGAGAAGAGCCAGG - Intronic
1144807223 17:17976091-17976113 CCTAGCATCAGGGACCAGCAGGG + Intronic
1145758201 17:27408323-27408345 AGTAGGATGAGGGACCAGCAGGG - Intergenic
1146475320 17:33157960-33157982 TCCAGGAGGAGGGAACAGCAAGG - Intronic
1149358291 17:55866894-55866916 ACCATCATGAAAGAACAGCATGG - Intergenic
1151773056 17:76177507-76177529 ATGAGCATGAGGGAAGGGGAAGG + Intronic
1152560440 17:81076003-81076025 ACTAGCAAGAGGGAACACCCGGG - Intronic
1152920990 17:83066538-83066560 ACCTGCAGGAGGTAACAGCAGGG - Intergenic
1152947648 17:83206631-83206653 AGGAGGATGAGGGGACAGAAAGG - Intergenic
1158561495 18:58517386-58517408 ATGAGAATGTGGGAACATCAGGG + Intronic
1160033599 18:75282237-75282259 GGGAGCATGAGGGTGCAGCATGG + Intronic
1164476658 19:28580807-28580829 ATCAGGAAGAGGGAACAGCAGGG + Intergenic
1167277852 19:48549823-48549845 AGGAACATGCGGGAATAGCAAGG + Intergenic
927374684 2:22400378-22400400 GCGAGCATCAGGGGCCAGCAAGG - Intergenic
929337800 2:40771894-40771916 ACAATCATGATGGAAGAGCAGGG - Intergenic
932193818 2:69765517-69765539 AGGAGCATGAGGCAACATCAAGG - Intronic
938589701 2:132724503-132724525 ATGAGCTCAAGGGAACAGCATGG + Intronic
944208748 2:197184668-197184690 AAGAGCATGGAGGAAAAGCATGG - Intronic
946669452 2:222086734-222086756 ACGAGGTTGAGGGAAGAGAATGG + Intergenic
947106296 2:226671300-226671322 AATAGCATGAGGCAGCAGCATGG + Intergenic
947295234 2:228623656-228623678 AAGATCATGAGGGAACAGGAAGG + Intergenic
948623105 2:239249160-239249182 ACGAGGTGGAGGGAACAGCAAGG + Intronic
1170127311 20:12978214-12978236 AGGAGCATGAGGGAACTCCCTGG + Intergenic
1170318706 20:15070169-15070191 AAAAGAATGAGGCAACAGCAGGG - Intronic
1170879964 20:20288275-20288297 AGGAGCATGAGGGGAAGGCAGGG + Intronic
1172119208 20:32587940-32587962 TCCAGGATGAGGGAAGAGCAAGG + Intronic
1173235544 20:41242303-41242325 ACAAGCAACAGGCAACAGCAAGG + Intronic
1174296644 20:49550079-49550101 ACGAGGATGAAGGAGAAGCACGG - Exonic
1174743064 20:53034696-53034718 TCCAGGTTGAGGGAACAGCAAGG + Intronic
1175496408 20:59417553-59417575 AAGAGCAACAGGGAACAGCAAGG - Intergenic
1175523442 20:59617896-59617918 ACGAGGATGAGGCAACAGGTCGG - Intronic
1175531060 20:59674538-59674560 AGGAGAAGGAGGGAACAGAAGGG - Intronic
1175779048 20:61670750-61670772 ACGAGGATGAGGGAAAGGGATGG + Intronic
1177438382 21:21085462-21085484 ACGAGCATGAGACAGCAACATGG - Intronic
1179148839 21:38793386-38793408 AGGAGAATGAGGACACAGCAAGG + Intergenic
1183091510 22:35525411-35525433 AGGAGCTGGAGGGAGCAGCAGGG - Intergenic
1183242427 22:36667970-36667992 CCCAGCATGAGGCAAGAGCAGGG - Intronic
1183716605 22:39536890-39536912 ACGAGCATGTGGGCACCGCCAGG - Intergenic
1183733996 22:39633592-39633614 TCTAGGAAGAGGGAACAGCAGGG + Intronic
1183832644 22:40426608-40426630 AGGTACAAGAGGGAACAGCATGG - Intronic
1184616383 22:45641032-45641054 ACAAGCCTGAGGGAGGAGCACGG - Intergenic
950406299 3:12807223-12807245 AGGAGCATGAGGGGACATAAAGG + Intronic
951100498 3:18683112-18683134 ACTATCATAAGAGAACAGCATGG - Intergenic
954011689 3:47645470-47645492 AAGAGTTTGAGGGTACAGCAGGG + Intronic
954461930 3:50631949-50631971 AGGAGCAGCAGGGACCAGCATGG - Intronic
954716189 3:52528087-52528109 AGGACAATGAGGGTACAGCAGGG + Intronic
960057744 3:113287220-113287242 ACGAGCATGAGGGAACAGCAAGG + Exonic
961167562 3:124774069-124774091 GCCAGCATGAAGGGACAGCAGGG + Intronic
967035815 3:185647577-185647599 ACGAGGAGGAGGGAACAGCAGGG - Intronic
972072518 4:35038813-35038835 CAGAGCAGGAGCGAACAGCAGGG - Intergenic
973034093 4:45383857-45383879 ACTATCATGAGAGAACAGCATGG - Intergenic
975632669 4:76418578-76418600 ACGATCATGGAGGAAGAGCAAGG + Intronic
976471535 4:85434863-85434885 AGGGGCATGAGGGAACCTCATGG + Intergenic
980911198 4:138996268-138996290 AAGAGCAGGAGGGGACTGCACGG - Intergenic
981767835 4:148272146-148272168 TCTAGTATGAGGGAATAGCAAGG + Intronic
982989254 4:162249993-162250015 AACAGCAAGAGGGAACAGTATGG - Intergenic
985117484 4:186605746-186605768 AAGAGCAAGAGGGAAGAGGAAGG + Intronic
985633752 5:1026218-1026240 ACTAGCAGGTGGGAAGAGCAGGG - Intronic
986130762 5:4927861-4927883 ATGAGTATTAGGGAACAGAAAGG - Intergenic
986480221 5:8179430-8179452 AAGAACATGGGGGAAGAGCATGG - Intergenic
987350792 5:17020121-17020143 ACAATCATGATGGAAGAGCAAGG + Intergenic
990278704 5:54227012-54227034 ACAATCATGGGGGAAAAGCAAGG - Intronic
996382756 5:122878443-122878465 AAGAGCAAGAAGGAAAAGCAGGG + Intronic
999306397 5:150522241-150522263 ACCACCAAGAGGGAAGAGCATGG - Intronic
999523289 5:152375112-152375134 ACCAAGATGAGAGAACAGCAAGG - Intergenic
999858031 5:155616554-155616576 AGGAGCATGATGGAACTGGATGG - Intergenic
1002424319 5:179166547-179166569 ACGGGCCTCAGGGAACAGCCAGG + Intronic
1002741815 5:181439785-181439807 AGGAGGATGAGGGGACAGAAAGG - Intergenic
1003162959 6:3651546-3651568 ACTAGCATGAGAGAAGAGGAGGG - Intergenic
1004259808 6:14097945-14097967 AGGAGTATGAGGGAATAGGATGG - Intergenic
1007273285 6:40654624-40654646 AAGACCCTGAGAGAACAGCATGG - Intergenic
1007844091 6:44739649-44739671 ACCAGCACGAGTGAACAGTATGG + Intergenic
1008053944 6:46927442-46927464 CAGAGCATAAGGTAACAGCACGG - Intronic
1010810269 6:80292351-80292373 ACAATCATGATGGAAGAGCAGGG + Intronic
1011818459 6:91221918-91221940 AGTAGGATGAGGGAAGAGCAGGG - Intergenic
1014231224 6:118904578-118904600 AAGAGCATGAGCGAAGGGCAGGG - Intronic
1015035311 6:128646125-128646147 ACGATCAAAAGGGAAAAGCAAGG + Intergenic
1015057401 6:128920444-128920466 TGGAGCATGAGGGACCGGCACGG - Intronic
1015225020 6:130847507-130847529 AAGAGCTTGAGGAAACGGCAGGG + Intronic
1015622638 6:135147903-135147925 ACTAGCATGAGGGAACAATATGG - Intergenic
1016814672 6:148292679-148292701 ACTAGCATCAGGGCAGAGCAAGG + Intronic
1017752766 6:157503835-157503857 ATGCGTATGAGGAAACAGCACGG + Intronic
1019246955 6:170715542-170715564 AGGAGGATGAGGGGACAGAAAGG - Intergenic
1019807482 7:3138722-3138744 AGGACCCTGAGGGTACAGCAGGG - Intergenic
1023541564 7:41271906-41271928 ACGAGGAAGAGGAAGCAGCAGGG - Intergenic
1024048036 7:45598492-45598514 AGGAGCATGAGGGATGAGAAAGG + Intronic
1024110031 7:46135203-46135225 ACAATCATGATGGAAGAGCAAGG + Intergenic
1025228301 7:57182052-57182074 AGGAGGATGAGGAAACAGCTAGG - Intergenic
1025610801 7:63074024-63074046 ACCAGCACGATGGACCAGCATGG + Intergenic
1025945258 7:66099802-66099824 AGGAGCAGGAGGAAACAGCCAGG + Intronic
1034219901 7:149436068-149436090 AGGAGCAAGAGTGAGCAGCATGG + Intronic
1034414240 7:150956414-150956436 AGGGGCAGGAGGGAACAGCTTGG + Intronic
1034489873 7:151387452-151387474 ACCAGCTAGAGGGAACAGCAAGG - Intronic
1035476470 7:159147733-159147755 AAGAGCATCAGGTAACCGCAGGG - Intergenic
1035501186 8:92411-92433 AGGAGGATGAGGGGACAGAAAGG + Intergenic
1037733269 8:21547141-21547163 AAGAGCAAGTGGGAACACCAGGG + Intergenic
1040886338 8:52267338-52267360 ACCAGCAACAAGGAACAGCAAGG + Intronic
1042656744 8:71107020-71107042 ATGAGCATGAGGAAATAACAAGG - Intergenic
1044082993 8:87908120-87908142 AGGCACATGTGGGAACAGCATGG - Intergenic
1046706458 8:117458221-117458243 ACGGTCATTATGGAACAGCATGG + Intergenic
1049237040 8:141517625-141517647 AGGAGCCTGTGGGAACAGCCTGG - Intronic
1049358996 8:142202929-142202951 GAGAGGAGGAGGGAACAGCACGG - Intergenic
1049533885 8:143169169-143169191 AGGAGCATGAGGGGACACCGGGG + Intergenic
1050253634 9:3771693-3771715 TCGAGCATCAGGGAAGAGAAGGG + Intergenic
1053846345 9:42241521-42241543 ACGAGAAAGTGGAAACAGCAGGG + Intergenic
1058111526 9:101035482-101035504 TCCAGAAAGAGGGAACAGCATGG - Intronic
1059693961 9:116713287-116713309 TGGAGTAGGAGGGAACAGCAAGG + Intronic
1061118003 9:128626780-128626802 ACGAGCAGGATGGAGGAGCATGG + Intronic
1061286800 9:129628191-129628213 AAGAGTCTGAGGGAACAGCAAGG - Intronic
1061372424 9:130205067-130205089 ACGAAGATGAGAGCACAGCAAGG + Intronic
1061511370 9:131063256-131063278 ACGAGAATGGAGGGACAGCATGG - Intronic
1061866384 9:133493688-133493710 TCGAGCCTGAAGGACCAGCAGGG + Intergenic
1203607726 Un_KI270748v1:71001-71023 AGGAGGATGAGGGGACAGAAAGG - Intergenic
1186497345 X:10022123-10022145 ACCAGCAGGCAGGAACAGCATGG - Intronic
1187152531 X:16694295-16694317 AGGAGCAGGAAGGAAGAGCATGG - Intronic
1192699878 X:73457589-73457611 AAGAGAATGAGGGGCCAGCAAGG + Intergenic
1192728906 X:73782561-73782583 AGGAGGAGGAGGGAACAGGAAGG - Intergenic
1196414372 X:115455028-115455050 ACGAGAAAGTGGGAGCAGCAAGG + Intergenic
1200095109 X:153655192-153655214 ATGACCATGAGGGAATAGGAGGG - Intergenic
1200149567 X:153944601-153944623 AGGAGCAGGAGGGATGAGCAAGG - Exonic
1200226460 X:154420358-154420380 CTGAGCATGAGGCTACAGCAGGG + Intronic
1200909347 Y:8516588-8516610 ATGAGCAGGAGGGACAAGCAGGG + Intergenic