ID: 960057745

View in Genome Browser
Species Human (GRCh38)
Location 3:113287221-113287243
Sequence CGAGCATGAGGGAACAGCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960057736_960057745 25 Left 960057736 3:113287173-113287195 CCACAGATAAGCTGGCAAGAGGA 0: 1
1: 0
2: 1
3: 14
4: 177
Right 960057745 3:113287221-113287243 CGAGCATGAGGGAACAGCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
960057740_960057745 -3 Left 960057740 3:113287201-113287223 CCCAGGCACATGGTTCATCACGA 0: 1
1: 0
2: 0
3: 7
4: 70
Right 960057745 3:113287221-113287243 CGAGCATGAGGGAACAGCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
960057734_960057745 26 Left 960057734 3:113287172-113287194 CCCACAGATAAGCTGGCAAGAGG 0: 1
1: 1
2: 0
3: 13
4: 133
Right 960057745 3:113287221-113287243 CGAGCATGAGGGAACAGCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
960057741_960057745 -4 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057745 3:113287221-113287243 CGAGCATGAGGGAACAGCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960057745 Original CRISPR CGAGCATGAGGGAACAGCAA GGG Exonic
903350567 1:22713943-22713965 CGAGCAGGATGGAAGAGCACTGG + Intronic
904438610 1:30515382-30515404 CCAGACAGAGGGAACAGCAAGGG - Intergenic
904464891 1:30701846-30701868 ACAGCAAGAGGGACCAGCAAGGG - Intergenic
906086973 1:43144508-43144530 AGAGCATTAAGGAACAGAAAAGG - Intergenic
909810463 1:79926192-79926214 CGAATACGAAGGAACAGCAAAGG - Intergenic
909904249 1:81176031-81176053 AGAGCACAGGGGAACAGCAAAGG - Intergenic
910228084 1:84956938-84956960 CCAGGCAGAGGGAACAGCAAAGG - Intronic
911006552 1:93231944-93231966 CCAGAAGGAGGGAACAGCATAGG - Intronic
913583588 1:120250996-120251018 CCATCATGAGAGAACAGCAAAGG - Intergenic
913624588 1:120647324-120647346 CCATCATGAGAGAACAGCAAAGG + Intergenic
914565576 1:148862832-148862854 CCATCATGAGAGAACAGCAAAGG - Intronic
914607249 1:149267420-149267442 CCATCATGAGAGAACAGCAAAGG + Intergenic
915266354 1:154720872-154720894 CGGGCATGCGTGAACAGCCACGG + Intronic
916370993 1:164093891-164093913 GGAAGATGAGGGAAGAGCAAAGG + Intergenic
919542176 1:198862154-198862176 GGAGGAGGAGGAAACAGCAATGG - Intergenic
924410963 1:243805222-243805244 TGAGCATGAGGGATGAGCAGAGG - Intronic
924909042 1:248489200-248489222 GGAGCATGAGGACACAGCATAGG - Exonic
924915063 1:248558858-248558880 GGAGCATGAGGACACAGCATAGG + Exonic
1063977443 10:11428686-11428708 CGAGGAAGAGTGGACAGCAAAGG + Intergenic
1065081760 10:22136323-22136345 CCAGCACGAGGGGACAGCATGGG + Intergenic
1069250407 10:66259394-66259416 TGAGCATGGGGGAACACAAAGGG + Intronic
1076834198 10:133012869-133012891 TGAGTGTGAAGGAACAGCAAGGG - Intergenic
1079627530 11:22634127-22634149 GGAACATGAAGGAAGAGCAAAGG + Intronic
1081643008 11:44770411-44770433 CCTGTTTGAGGGAACAGCAAGGG + Intronic
1081989314 11:47329197-47329219 CGTGCACTTGGGAACAGCAAGGG - Exonic
1083946194 11:65924461-65924483 CCAGGGAGAGGGAACAGCAAGGG + Intergenic
1085156742 11:74302521-74302543 GGACCTTGAGGGAGCAGCAAGGG - Exonic
1088461328 11:110086548-110086570 CAAGCATGAGGGAACAAGGAAGG - Intergenic
1089674330 11:120079880-120079902 TGGGCAGGAGGGAAAAGCAAAGG + Intergenic
1091465940 12:684549-684571 AGAGAATGCAGGAACAGCAATGG + Intergenic
1092780322 12:11980205-11980227 CCACCATGAGGTCACAGCAAGGG + Intergenic
1096739707 12:53683975-53683997 CCAGGAAGAGGGAATAGCAAGGG - Intergenic
1097501399 12:60409053-60409075 AGAGAAGGAGGAAACAGCAAAGG + Intergenic
1099134359 12:78877211-78877233 AGAAGATGAAGGAACAGCAAAGG + Intronic
1099361648 12:81709181-81709203 CTAGGAAGAGGGAACAGCAAGGG - Intronic
1100606094 12:96153251-96153273 CGAGCAGGCGGGAACAGCGCAGG - Intergenic
1101782625 12:107849235-107849257 GGAGGATGAGGGAAGAGGAAAGG - Intergenic
1102656562 12:114486979-114487001 CCAGGTAGAGGGAACAGCAATGG + Intergenic
1103526465 12:121572459-121572481 CTAGGTTGAGGGAAGAGCAAGGG - Intronic
1104820597 12:131675325-131675347 CGAGGATGGGGGACCAACAATGG - Intergenic
1106968974 13:35112726-35112748 AGAGCATGAGAGAATAGTAAAGG - Intronic
1107305310 13:39012831-39012853 CGGGAATGAGGGAAGAGCAGGGG + Exonic
1109478668 13:62919176-62919198 CGAGAAGGAGAGAACAGAAAAGG - Intergenic
1112058016 13:95708516-95708538 CCAGGAAGAGGGACCAGCAAGGG - Intronic
1112285197 13:98097706-98097728 CAAGCGTGAGTGATCAGCAATGG - Intergenic
1114155561 14:20099389-20099411 CGAGAATTAGAGCACAGCAACGG - Intergenic
1114439659 14:22735998-22736020 TGATCATGAGGGAACATAAAGGG + Intergenic
1115008704 14:28518390-28518412 CGAGGCAGAGGGAATAGCAAAGG - Intergenic
1118281447 14:64432716-64432738 TGACCATAAAGGAACAGCAAAGG + Intronic
1120876782 14:89382468-89382490 AGAACATGAGGGAACAGAGATGG - Intronic
1122589124 14:102833459-102833481 AGAACTTGAGGGAAAAGCAAAGG - Intronic
1128525014 15:68406431-68406453 CCAGGAAGAGGGAACAGCCACGG - Intronic
1128608794 15:69057899-69057921 TGGGCAGGAGGGAACAGCAGAGG + Intronic
1131798054 15:96040695-96040717 CGAGCAGCAGGGAAGAGGAATGG + Intergenic
1133427126 16:5702350-5702372 CTATCATGAGATAACAGCAAGGG + Intergenic
1133835151 16:9361296-9361318 AGAGCAAGACAGAACAGCAATGG + Intergenic
1135420561 16:22303115-22303137 CCAGGCAGAGGGAACAGCAAGGG - Intronic
1136567805 16:31080476-31080498 GGAGCATGAGGAGACAGAAAGGG + Exonic
1138586520 16:57973817-57973839 TGAGCCTGAGGGAACAGTAGTGG + Intergenic
1139526976 16:67522807-67522829 CCAGGCAGAGGGAACAGCAAAGG - Intronic
1139797771 16:69497167-69497189 GGAACATGAAGGAAGAGCAAAGG - Intergenic
1141261710 16:82460242-82460264 GCAGCAGGAGGGAACAGCAAGGG - Intergenic
1141619255 16:85228092-85228114 CCAGGAGGAGGGAACAGCACGGG + Intergenic
1142263913 16:89054850-89054872 CCAGGCTGAGGGAACAGCCAGGG - Intergenic
1142808675 17:2385188-2385210 GGACCAGGAGGGAACAGGAAGGG + Exonic
1145748266 17:27336537-27336559 CCATCAGGAGGCAACAGCAAGGG - Intergenic
1146475318 17:33157959-33157981 CCAGGAGGAGGGAACAGCAAGGG - Intronic
1149344369 17:55719262-55719284 TGAGCATGAGGGAGTAGTAAGGG + Intergenic
1151773057 17:76177508-76177530 TGAGCATGAGGGAAGGGGAAGGG + Intronic
1156018584 18:32574556-32574578 AGAAGATGAAGGAACAGCAAAGG - Intergenic
1159418496 18:68184175-68184197 AGAGCATGAGTGCCCAGCAAAGG - Intergenic
1165176736 19:33935990-33936012 CGAGCATAAGGGAAGAGCCTTGG + Intergenic
1167277853 19:48549824-48549846 GGAACATGCGGGAATAGCAAGGG + Intergenic
1167534940 19:50043898-50043920 CCAGCATGAGGGACCATTAAAGG + Intronic
1167707888 19:51092468-51092490 CCAGGCAGAGGGAACAGCAAAGG - Intergenic
927267219 2:21163552-21163574 AGTGCCTGTGGGAACAGCAATGG - Intergenic
927374683 2:22400377-22400399 CGAGCATCAGGGGCCAGCAAGGG - Intergenic
928209099 2:29310721-29310743 CGAGCAAGAGGGATGAGCGAGGG - Intronic
928632633 2:33209365-33209387 AGACCATGAAGCAACAGCAATGG - Intronic
931387308 2:61809253-61809275 AGAGCAAGAGGGGCCAGCAAAGG - Intergenic
932193817 2:69765516-69765538 GGAGCATGAGGCAACATCAAGGG - Intronic
934567475 2:95348496-95348518 CGAGGATCAGGGAAGAGCAATGG - Intronic
934637796 2:96006959-96006981 CCAGCATTAGGGAACACCGAGGG + Intergenic
935164842 2:100561487-100561509 CAGGCCTCAGGGAACAGCAAAGG + Intergenic
935166942 2:100578149-100578171 AGATCTTGAGGGAAGAGCAAAGG + Intergenic
936507226 2:113117307-113117329 CCAGGTGGAGGGAACAGCAAGGG - Intronic
936909232 2:117573288-117573310 GGAGAATGAGGGGACACCAAAGG - Intergenic
938116088 2:128603743-128603765 GGAGGGTGAGGGAACAGGAAAGG + Intergenic
938995570 2:136674219-136674241 AGAGGAAGAGTGAACAGCAAAGG + Intergenic
946693124 2:222324763-222324785 AGAGCATTAGGGAAAAGCTAAGG + Intergenic
948314509 2:237016988-237017010 TGAGCATTAGGGACCAGCACTGG - Intergenic
948623106 2:239249161-239249183 CGAGGTGGAGGGAACAGCAAGGG + Intronic
948862571 2:240760061-240760083 TGAGCATGTGGGGACAGCAGAGG + Intronic
1170060071 20:12249701-12249723 GGAGCATTCTGGAACAGCAAAGG - Intergenic
1172119210 20:32587941-32587963 CCAGGATGAGGGAAGAGCAAGGG + Intronic
1173494954 20:43511898-43511920 CCAGAGGGAGGGAACAGCAAGGG + Intronic
1173927627 20:46792520-46792542 CTAGGCAGAGGGAACAGCAAGGG - Intergenic
1174743066 20:53034697-53034719 CCAGGTTGAGGGAACAGCAAGGG + Intronic
1177220834 21:18190363-18190385 AGAGCATGATGGAATAGGAATGG - Intronic
1178374735 21:32057337-32057359 AGAAGATGAAGGAACAGCAAAGG + Intergenic
1178926784 21:36782614-36782636 GGAGCATTACCGAACAGCAAAGG + Intronic
1180154942 21:45973167-45973189 CCAGCATGAGGTAACGGGAAAGG + Intergenic
1184717966 22:46292667-46292689 CGGCACTGAGGGAACAGCAAGGG - Intronic
1184907912 22:47502267-47502289 TGAGAATGAAGGAAGAGCAAAGG + Intergenic
950406300 3:12807224-12807246 GGAGCATGAGGGGACATAAAGGG + Intronic
950455955 3:13092892-13092914 CGCGGCAGAGGGAACAGCAAGGG - Intergenic
950466290 3:13156838-13156860 CTAGGCTGAGGGAACAGCACAGG + Intergenic
950530001 3:13548003-13548025 CCAGGCAGAGGGAACAGCAATGG + Intergenic
950670895 3:14524824-14524846 AGAGCATTAGGGAACAGCAAAGG - Intronic
952825084 3:37517973-37517995 AGAGCATGATGGAGCATCAAAGG - Intronic
956346701 3:68287381-68287403 GGAGGGTGAGGGAGCAGCAAAGG - Intronic
959051977 3:101533132-101533154 TGAGCATGGGGGAACACAAAAGG - Intergenic
960057745 3:113287221-113287243 CGAGCATGAGGGAACAGCAAGGG + Exonic
960916277 3:122698199-122698221 CAAGCATGAGGGAAAAGCAGTGG - Intronic
961041039 3:123678481-123678503 CAAGCATGAGGGAAAAGCCAAGG - Intronic
961167564 3:124774070-124774092 CCAGCATGAAGGGACAGCAGGGG + Intronic
961753799 3:129114613-129114635 CTAGCATGAGGTCTCAGCAAAGG + Intronic
962735306 3:138320293-138320315 CGACCATGAAGCAGCAGCAAGGG + Intronic
965661868 3:171050530-171050552 AGAGCATGTGGGTACAGAAATGG - Intergenic
965663795 3:171069954-171069976 CCAGAAAGAGGGAAGAGCAAAGG - Intronic
967058666 3:185852103-185852125 CCATCATGAGGCCACAGCAAGGG - Intergenic
968434757 4:578704-578726 CGAGCATCTGGGAAATGCAAAGG - Intergenic
969621725 4:8282049-8282071 GTAGCATGAGGGAACAGACAAGG + Intronic
970103868 4:12557623-12557645 CCAGGATGAGGCCACAGCAATGG + Intergenic
973034092 4:45383856-45383878 CTATCATGAGAGAACAGCATGGG - Intergenic
974265115 4:59577177-59577199 AGAGAATGAGAGACCAGCAAAGG - Intergenic
975632670 4:76418579-76418601 CGATCATGGAGGAAGAGCAAGGG + Intronic
977321282 4:95519722-95519744 TGTGCATAAGGGAACAGAAAGGG + Intronic
977740718 4:100478103-100478125 GGAGAATGAGGGAACAACATTGG - Intronic
981767836 4:148272147-148272169 CTAGTATGAGGGAATAGCAAGGG + Intronic
985671113 5:1207138-1207160 CGAGGGTCAGGGAACAGCAGAGG - Intronic
986130761 5:4927860-4927882 TGAGTATTAGGGAACAGAAAGGG - Intergenic
986273960 5:6257376-6257398 GGAGGATGAAGGAAGAGCAAAGG - Intergenic
987350793 5:17020122-17020144 CAATCATGATGGAAGAGCAAGGG + Intergenic
987467719 5:18292284-18292306 CGAATGTGTGGGAACAGCAAGGG - Intergenic
990278703 5:54227011-54227033 CAATCATGGGGGAAAAGCAAGGG - Intronic
990497591 5:56364033-56364055 AGAGGATGAAGGAAGAGCAAAGG - Intergenic
995931192 5:117447531-117447553 CCAGCAAGAGTGGACAGCAAAGG + Intergenic
996284797 5:121776848-121776870 CCAGGCAGAGGGAACAGCAAAGG - Intergenic
997078133 5:130705296-130705318 AGAGAATGAGGGAACAACAGTGG - Intergenic
997259802 5:132457100-132457122 AGAGCAAGAGTGAACAGGAAGGG - Intronic
997977560 5:138449336-138449358 AGGGAATGAGGGGACAGCAAGGG - Intergenic
999804668 5:155070600-155070622 CCAGGCTGAGGGAAAAGCAAGGG - Intergenic
1000342300 5:160287227-160287249 CCAGCTTGAGGGAAGAGGAAGGG - Intronic
1000938215 5:167328662-167328684 CCAGCTAGAGGGAACAGCTAGGG - Intronic
1008053943 6:46927441-46927463 AGAGCATAAGGTAACAGCACGGG - Intronic
1008697099 6:54051722-54051744 AGAAAATGAGGGAACAGGAATGG + Intronic
1009027537 6:58017954-58017976 GGAGAATGAGAGAACATCAAAGG - Intergenic
1009264925 6:61541960-61541982 TGAGCATGAGGGAAATGCCACGG - Intergenic
1011355309 6:86467263-86467285 CAATCATGAAGGAAGAGCAAAGG - Intergenic
1011540906 6:88427363-88427385 CCAGCATAATGGAAAAGCAATGG - Intergenic
1016814673 6:148292680-148292702 CTAGCATCAGGGCAGAGCAAGGG + Intronic
1017543450 6:155426598-155426620 CCAGGTGGAGGGAACAGCAATGG + Intronic
1024110032 7:46135204-46135226 CAATCATGATGGAAGAGCAAGGG + Intergenic
1026454527 7:70559158-70559180 AGAAGATGAGGGAAGAGCAAAGG - Intronic
1027713507 7:81639645-81639667 CAAGTATGAGGGAAGAGGAAGGG + Intergenic
1028936184 7:96466385-96466407 AGAGCACTAGGGAACAGCACAGG - Intergenic
1029469413 7:100744772-100744794 CGAGCAAGATGGAAAAGGAAAGG - Intronic
1030646727 7:112069867-112069889 CAAGGAAGAGGGAAGAGCAAAGG + Intronic
1032484597 7:132275907-132275929 CTAGACAGAGGGAACAGCAATGG - Intronic
1033550317 7:142441059-142441081 CAAGCATGAGGTGACAGAAATGG + Intergenic
1034069828 7:148173589-148173611 TGAGCATGAGACAACAACAAAGG + Intronic
1034074764 7:148221116-148221138 CAGGCATGAGGGCACAGCAGTGG - Intronic
1034357839 7:150467022-150467044 GGAGGATGAGGAAACAGCCAAGG + Exonic
1034410432 7:150938557-150938579 CGAGGATGAGGAAGCTGCAAAGG - Intergenic
1039375459 8:37028193-37028215 AAAGCATGAGGGAACAGGCAGGG + Intergenic
1039567463 8:38561407-38561429 AGAGCAGGTGGGAAGAGCAATGG - Intergenic
1040886340 8:52267339-52267361 CCAGCAACAAGGAACAGCAAGGG + Intronic
1046514605 8:115241973-115241995 GGAGAATGAGGGAACAGGGAGGG - Intergenic
1047549622 8:125855938-125855960 CCAGGCTGAGGGAACAGCATAGG + Intergenic
1048486555 8:134853134-134853156 CTAGAAAGAGGAAACAGCAAAGG - Intergenic
1049016739 8:139925235-139925257 AGAGCATCAGGCAACAGCACTGG + Intronic
1050172001 9:2829624-2829646 AAAGCATGAGGGAAAATCAAGGG + Intronic
1059069643 9:111121597-111121619 CTATCATGAGAGAACAGCACAGG + Intergenic
1187244192 X:17539155-17539177 CCAGGCAGAGGGAACAGCAAGGG - Intronic
1187754428 X:22505999-22506021 GAAGCATGAGAGAAGAGCAAAGG - Intergenic
1187963417 X:24587538-24587560 CAAGAAAGAGGGACCAGCAAAGG - Intronic
1189354135 X:40298678-40298700 CGAGCAGGAGAGAGGAGCAATGG + Intergenic
1189626201 X:42899723-42899745 TGAGCATGAGGTAAGAGCCAAGG - Intergenic
1192302583 X:69921105-69921127 CATGCATGAGGGTACATCAAAGG - Intronic
1192359020 X:70426766-70426788 AGAGCATGAGTGGCCAGCAAGGG - Intronic
1192699879 X:73457590-73457612 AGAGAATGAGGGGCCAGCAAGGG + Intergenic
1193554416 X:82934646-82934668 GGAGCATGAGAGAGGAGCAAGGG + Intergenic
1195255242 X:103083343-103083365 CGAGCAAGAGGGCAGGGCAAGGG - Intronic
1196321117 X:114341262-114341284 CCAGGTAGAGGGAACAGCAAAGG - Intergenic
1199596505 X:149510149-149510171 GGAGCATGAGGGGGCAGCCAAGG + Intronic
1200149566 X:153944600-153944622 GGAGCAGGAGGGATGAGCAAGGG - Exonic
1200226461 X:154420359-154420381 TGAGCATGAGGCTACAGCAGGGG + Intronic