ID: 960057747

View in Genome Browser
Species Human (GRCh38)
Location 3:113287227-113287249
Sequence TGAGGGAACAGCAAGGGGCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 1, 2: 5, 3: 92, 4: 720}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960057740_960057747 3 Left 960057740 3:113287201-113287223 CCCAGGCACATGGTTCATCACGA 0: 1
1: 0
2: 0
3: 7
4: 70
Right 960057747 3:113287227-113287249 TGAGGGAACAGCAAGGGGCACGG 0: 1
1: 1
2: 5
3: 92
4: 720
960057741_960057747 2 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057747 3:113287227-113287249 TGAGGGAACAGCAAGGGGCACGG 0: 1
1: 1
2: 5
3: 92
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960057747 Original CRISPR TGAGGGAACAGCAAGGGGCA CGG Exonic
900173797 1:1283228-1283250 TGTGGGAACACCAAGGGTCTGGG - Intronic
900184947 1:1328600-1328622 GGAGGGGGCATCAAGGGGCACGG - Exonic
900196963 1:1381368-1381390 TAGGGACACAGCAAGGGGCATGG - Intergenic
900520195 1:3101675-3101697 TGAGGGAACAGAACTTGGCAAGG + Intronic
900605067 1:3520199-3520221 TGAGGGAACAGCCATGTCCAAGG + Intronic
900779571 1:4609018-4609040 AGAGGGAGCAGCAAGGGGGCTGG - Intergenic
900834513 1:4989998-4990020 AGAGTGCACAGCAGGGGGCATGG - Intergenic
901175195 1:7293810-7293832 TCAGAGAAAAGCGAGGGGCACGG - Intronic
901407924 1:9062365-9062387 AGAGGGAACAGCATGTGGGAAGG + Intronic
901623193 1:10605564-10605586 AGAGGGAACAGCAAAGGCCCGGG + Intronic
901661984 1:10804364-10804386 GGAGGGAAGAGAAAGGGGCAGGG - Intergenic
901684300 1:10935134-10935156 TGCGGGAACAGCCAGAGGAAAGG - Intergenic
902156644 1:14492980-14493002 AGAGGGAACAGCCAGGGCAAAGG - Intergenic
902374296 1:16023038-16023060 TGGGGGCACAGCAAGGGGCTGGG + Intronic
902379249 1:16044915-16044937 TGGGGCCACAGCAAGGGGCTGGG + Intronic
902437803 1:16409500-16409522 CGAGGGAACAGGCAGGTGCAGGG + Intronic
902650637 1:17835041-17835063 AGAAAGAACAGCAAGGGGAAAGG - Intergenic
902840416 1:19070631-19070653 TGCAGGAACAGCAAAGGGCAGGG + Intergenic
903539265 1:24087548-24087570 TGAGGGACCAGCAAGTGCAAAGG - Intronic
903661162 1:24979719-24979741 GGAGGGAACAGCATGGGCAAAGG + Intergenic
904081202 1:27873500-27873522 CCAGGGAACAGGATGGGGCAGGG - Intronic
904132940 1:28288792-28288814 AGAGGAAACAGCATGGGGAAAGG + Intergenic
904202567 1:28830827-28830849 AGAGGGAACAGCAAGGGCAAAGG + Intronic
904259991 1:29282951-29282973 TGAGGGACCGGCCAGGGTCATGG + Intronic
904320513 1:29695115-29695137 AGTGGGAACAGCAAGTGGGAGGG - Intergenic
904377692 1:30092054-30092076 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
904438609 1:30515376-30515398 AGAGGGAACAGCAAGGGCGTAGG - Intergenic
904596561 1:31649983-31650005 AGAGGGAACAGCACGTGCCAAGG - Intergenic
904879548 1:33685110-33685132 AGAGGGAAGAGGAAAGGGCACGG - Intronic
905312706 1:37061285-37061307 AGAGGAAACAGCAAGGGCAAAGG - Intergenic
905389464 1:37626853-37626875 TGAGGGCTCAGGAAGGTGCAGGG + Intronic
905451745 1:38061466-38061488 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
905527335 1:38649055-38649077 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
905799789 1:40835821-40835843 AGAGGGAACAGCAAGTGCCAAGG + Intronic
905873901 1:41420044-41420066 TGAGGGAGCAGGCAGGGCCATGG + Intergenic
906150463 1:43584505-43584527 GGAGGGTAGAGGAAGGGGCATGG - Intronic
906160206 1:43642514-43642536 TGAGGAGACTGCAGGGGGCAAGG + Intergenic
906541802 1:46592582-46592604 TGCTGGAACAGCCCGGGGCAGGG + Intronic
906681058 1:47725639-47725661 TGAGGGCTCAGAAAGGGGAAGGG - Intergenic
906877131 1:49551823-49551845 AGAGGAAACAGCAGTGGGCAGGG + Intronic
906919996 1:50053980-50054002 AGAGGGAACAGCCAGGGCAAAGG + Intronic
907324981 1:53631819-53631841 AGAGGGAACAGCCAGTGCCAAGG + Intronic
907519483 1:55013875-55013897 GGAGGGAACAGCATGAGCCAAGG - Intergenic
907774797 1:57503418-57503440 GGAGGGAACAGCAAAGGTCCAGG - Intronic
907913296 1:58846100-58846122 AGAGGAAACAGCATGGGGAAGGG - Intergenic
908453631 1:64280790-64280812 TGAGGTAAGAGAAAGAGGCAGGG + Intergenic
908472950 1:64462165-64462187 ATAGGGAACAGCAAGTGGAAAGG - Intergenic
908513816 1:64872087-64872109 AGAGGGAACAGAATGGGGGAAGG - Intronic
909524067 1:76602421-76602443 GGAGGGACCAGGAAGGGGAATGG + Intronic
910202359 1:84712981-84713003 AGAGGGTACAGCAAGGGCAAAGG + Intergenic
910523414 1:88149914-88149936 TAAAGGAACAACAAGGGCCAAGG + Intergenic
911147257 1:94564749-94564771 AGAGGGAACAGCAGGTGCCAAGG - Intergenic
911156705 1:94644060-94644082 TGAAGAAACAGCAAGGAGGATGG - Intergenic
912303378 1:108539863-108539885 TGAAGAAACAGCAATGGACAAGG - Intergenic
912389195 1:109290219-109290241 TCAGGGAACAGCAGAGGGAAGGG + Intergenic
913223786 1:116680818-116680840 AGAGGGAACTGCAAGTTGCAAGG + Intergenic
914577016 1:148981717-148981739 TGAGGGAACGAGAAGGGGCTAGG - Intronic
914747972 1:150513290-150513312 TCAGGTAACAGCAGAGGGCAGGG - Exonic
915304091 1:154968154-154968176 TGGGAGAAGAGCAAGGGGCTAGG - Intronic
915656732 1:157366900-157366922 TGGGTGAAAAGGAAGGGGCAAGG + Intergenic
915814555 1:158952576-158952598 TGAGGGAAGAGGAAGTGGTAAGG + Intronic
916548402 1:165827911-165827933 CGGGGGAACAGCTAGCGGCAAGG + Exonic
917262905 1:173189061-173189083 TTATGGAAAAGCAAGGGGGAAGG - Intronic
917836849 1:178947859-178947881 AGAAGGAACAGCCATGGGCAGGG - Intergenic
918551717 1:185749892-185749914 AGAGGGAACTGCAAGGGCAATGG - Intronic
918727982 1:187949949-187949971 TCAGGAAACAGTAAGGGCCAAGG + Intergenic
919895332 1:202006251-202006273 TCAGGGAACAGCCAGGGTGAAGG + Intergenic
920035033 1:203060139-203060161 TTTGGCAACAGCAAGGGGCAAGG - Intronic
920099732 1:203509424-203509446 TGAGGGAACTCCAAGGGGCCAGG - Intergenic
920136011 1:203769900-203769922 GTAGGGAACAAGAAGGGGCAAGG + Intronic
920216667 1:204365994-204366016 AGGGGGAACAGCAAGCGCCAAGG + Intronic
920268676 1:204746253-204746275 TGAGTGAACAACAAGGAGGATGG + Intergenic
920544826 1:206807466-206807488 TGAGGGAACAGCATGAGTGAAGG - Intronic
920757978 1:208753363-208753385 AGAGGGAATAGCAAGGGCCAAGG + Intergenic
920764547 1:208819374-208819396 TGAGGGAAAAGCAAGTAGGAAGG - Intergenic
921930350 1:220749260-220749282 TGAAGGATGAGCAAGTGGCATGG + Intronic
922272292 1:224044791-224044813 TGTGGGGACAGAAAGGAGCAAGG + Intergenic
922542125 1:226427505-226427527 AGAGGGAACAGCAAGAGCTAAGG - Intergenic
922928459 1:229370609-229370631 TGAGGTAACAGCAGAGTGCAGGG - Intergenic
924599686 1:245477667-245477689 AGAGGGAACAGCAAGGTTAAAGG + Intronic
1064899277 10:20276052-20276074 TGAGGGAATAGAAAGAGGCTGGG - Intronic
1065110683 10:22437137-22437159 AGAGGGCACAGCAAGGTGCGGGG + Intronic
1065386817 10:25142299-25142321 GGATGGGACAGCAAGGGGCCTGG - Intergenic
1065741373 10:28800136-28800158 TGAGAGAAGAGCAAAGGGGAGGG - Intergenic
1066321017 10:34303988-34304010 GGTGGGAACAGGAAGAGGCAGGG + Intronic
1067289393 10:44930156-44930178 ACAGGGCACAGCAAGGGGCAGGG - Intronic
1067495040 10:46754082-46754104 TGAGGGAACATGAAGGGTAAGGG + Intergenic
1067599615 10:47586314-47586336 TGAGGGAACATGAAGGGTAAGGG - Intergenic
1069567090 10:69470887-69470909 TCAAGAAACAGCAAGGGGGACGG - Intronic
1069771591 10:70903837-70903859 AGGGGGCACAGCAAGCGGCATGG + Intergenic
1069914736 10:71780476-71780498 AGAGGAAACAGCAAGTGGAAAGG + Intronic
1070345751 10:75540269-75540291 AGAGGGAACAGCAAGTGAAAAGG + Intronic
1070486305 10:76935161-76935183 TGTTGGAACAGCTAGGGTCAAGG + Intronic
1071495893 10:86167465-86167487 CTTGGGAACAGCCAGGGGCAGGG - Intronic
1071651141 10:87394198-87394220 CGAGGGAACATCAAGGGTAAGGG - Intergenic
1071792961 10:88975517-88975539 AGATGGTACAGGAAGGGGCATGG + Intronic
1073055852 10:100700768-100700790 AGAGGGAACAGCAAAGTGGATGG - Intergenic
1073280608 10:102351266-102351288 TGAGGGCACAGCAGAGGGCATGG + Exonic
1073480394 10:103783034-103783056 AGAGGGAACAGCAAGGACAAAGG + Intronic
1073662037 10:105486952-105486974 GGAGGGAACAGCATGAGCCAAGG + Intergenic
1074683461 10:115934503-115934525 TGATGGAACAGGAATGGCCAGGG - Intronic
1074848039 10:117416072-117416094 AGAGGAAACAGCAAGGGTAAGGG + Intergenic
1075397254 10:122136410-122136432 GGAGGGACCAACATGGGGCAGGG + Intronic
1075498970 10:122954507-122954529 TGGGGAAACAGCAAGCGGCGTGG + Intronic
1075997688 10:126891796-126891818 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1076143466 10:128097777-128097799 GGAGGGAATAGAAAGGGGCAGGG - Exonic
1076236578 10:128868214-128868236 TGTTGGAACAGCCAAGGGCAAGG + Intergenic
1076698684 10:132259045-132259067 TGGGGGCACAGCTGGGGGCATGG + Intronic
1077113052 11:870330-870352 TGAGGGAGCAGCAGGGCCCAGGG - Intronic
1077395771 11:2320415-2320437 TGGGGGAGCATCAAGGAGCAGGG + Intergenic
1077423888 11:2465576-2465598 AGAGGGGCCAGCACGGGGCAGGG - Intronic
1077797816 11:5509584-5509606 TGGGGACACAGCTAGGGGCATGG + Exonic
1077976827 11:7255217-7255239 AGAGGGAACAGCAAGCGCAAAGG + Intronic
1078212972 11:9286107-9286129 TCAGGGAAGAGGAAGGGGAAGGG + Intronic
1078327737 11:10394151-10394173 AGAGAGAAAAGAAAGGGGCAGGG - Intronic
1079122017 11:17692735-17692757 TGCGGGAAAAGCCAGGGGTAGGG + Intergenic
1079339870 11:19602986-19603008 TGAGGGAACAGCATGAGCAAAGG + Intronic
1079340701 11:19609503-19609525 TGAGGGAATAGCATGGGCAAAGG + Intronic
1079832438 11:25285230-25285252 TCAGGGAATAGGAAGGGCCAAGG + Intergenic
1079990165 11:27238116-27238138 TGAGGTACCAGCAAGGGCAAGGG - Intergenic
1080171069 11:29303600-29303622 TCAGGGAATAGGAAGGGCCAAGG - Intergenic
1080974857 11:37326580-37326602 TGAGGGAACAGCAGGTGCAAGGG - Intergenic
1081652668 11:44834876-44834898 TGAGGGAACAGGACAGGGAAGGG + Intronic
1081989312 11:47329191-47329213 CTTGGGAACAGCAAGGGGCCAGG - Exonic
1082769370 11:57194725-57194747 TAAGGGAAGAGAAAGAGGCATGG - Intergenic
1083285607 11:61656692-61656714 AGAGGGAACAGCATGGGCAAAGG + Intergenic
1083419388 11:62544756-62544778 TGAGGGAAATCCCAGGGGCAGGG - Intronic
1083427875 11:62598289-62598311 TGAGAGAAGAGCGAGGGGAATGG - Intronic
1083583570 11:63840063-63840085 TGGGGGAACTGCAAGGGGCCAGG - Intronic
1083687074 11:64382908-64382930 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1084063956 11:66692903-66692925 TGCAGGAACAGGAAGGTGCAGGG - Intronic
1084107290 11:66988416-66988438 TCCGGGAACAACAAGGGGCCAGG - Intergenic
1084596667 11:70120682-70120704 AGAGGGAAGGGCAACGGGCAAGG + Intronic
1085040904 11:73325786-73325808 TGAGTGTCCAGCAAGGGGCGGGG + Intronic
1085216723 11:74839457-74839479 TGGGGGAACAGAAAAGGACAAGG + Exonic
1085287689 11:75374844-75374866 AGAGGGAACAGCAAGGGCCAAGG + Intergenic
1086132184 11:83412368-83412390 TGAGGAAACAGGAACAGGCAAGG + Intergenic
1086247828 11:84775747-84775769 GGATGGTACAGCAAGGGGCAAGG + Intronic
1086476083 11:87176266-87176288 TGGGGAGACAGGAAGGGGCAGGG - Intronic
1087883581 11:103449120-103449142 AGAGGGAACAGCAAGTGCCATGG + Intronic
1088727939 11:112656103-112656125 TGAAGGAGTAGCAAGGAGCAAGG - Intergenic
1089462171 11:118659723-118659745 TGAGGGCACAGCAGGTGGCTCGG - Intronic
1089604628 11:119634794-119634816 CGAGGGAGCAGCAGGTGGCAGGG - Intronic
1089626943 11:119757261-119757283 TAAAGGCACAGCAAGAGGCAAGG + Intergenic
1090197257 11:124827279-124827301 AGAGGGAATAGCAAGTGCCAGGG - Intergenic
1090439383 11:126713367-126713389 TGAGGGCAGGGCTAGGGGCAGGG + Intronic
1090968659 11:131620606-131620628 AGAGGGAACAGCAGGTGCCAAGG - Intronic
1091042308 11:132293193-132293215 TGATGGAAGAGGAAGAGGCAGGG + Intronic
1091149894 11:133318461-133318483 AGAGGAAACAGCAGGGGTCATGG - Intronic
1092217310 12:6692537-6692559 TGAGGGTACAGGATGAGGCATGG - Intergenic
1092219284 12:6701590-6701612 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1092287604 12:7137931-7137953 TGAGGGCACAGGAAGGGGATGGG - Intronic
1092718211 12:11413934-11413956 TGGGGTAAAAGCAAGGAGCAAGG + Intronic
1095821292 12:46481444-46481466 AGAGAGAACAGCAAGGGCAAAGG + Intergenic
1095857105 12:46872458-46872480 TGAGGGAACAGCATGTGCGAGGG - Intergenic
1096000658 12:48127241-48127263 TGAAGGAACAGGAAGGGGAAGGG - Intronic
1096317940 12:50585052-50585074 AGAAGGAACAGCAAGTGTCAAGG - Intronic
1096390997 12:51229005-51229027 TGAGGGACCAGAGAGAGGCAGGG - Intergenic
1096423570 12:51481552-51481574 TGGGGAGACAGCAGGGGGCAGGG + Intronic
1096571359 12:52525255-52525277 TGAGAGAACAGAAAGTAGCAGGG - Intergenic
1096724880 12:53553414-53553436 TGAGGGAAGAGAAAGGGAGATGG + Intronic
1097260708 12:57718502-57718524 AGAGGGCACAGCACAGGGCAAGG + Intronic
1098094197 12:66937107-66937129 AGAGGGAACAGCAAGTGCGAAGG - Intergenic
1098936397 12:76484243-76484265 TGAGAGAATAGCAAGAGGCAAGG - Intronic
1099682886 12:85850187-85850209 TGAGGGGAGAGAGAGGGGCAAGG - Intergenic
1100573348 12:95863811-95863833 TGAGGGAACAGCAAGTACAAAGG + Intronic
1100642040 12:96491307-96491329 TGTGGGAAGAGCAAGAGGGAGGG + Intronic
1100678913 12:96897897-96897919 AGAGGGAGCAGCAAGGGCCAAGG + Intergenic
1100860426 12:98799838-98799860 TGGGGGGAGGGCAAGGGGCAGGG - Intronic
1101247866 12:102902158-102902180 TGAGGGAACAGCCAGTGCAAGGG + Intronic
1101360373 12:104020769-104020791 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1101504006 12:105330506-105330528 CGAGGGAGCGGCAAGGGGCGTGG - Intronic
1101807412 12:108076433-108076455 GGTGGGAACAGCAAGGGCAAAGG - Intergenic
1101958974 12:109233912-109233934 AGAGGGAGAAGCAAGGGGTAGGG - Intronic
1102189563 12:110976761-110976783 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1102300244 12:111766445-111766467 ACAGGGAACAGCAAGGGCAAAGG - Intronic
1102380925 12:112466299-112466321 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1102396368 12:112589472-112589494 TGAGGGAACAGCCAGTGCAAAGG - Intronic
1102441045 12:112964154-112964176 TCAGAGGACATCAAGGGGCAGGG + Intronic
1102656563 12:114486985-114487007 AGAGGGAACAGCAATGGTGAAGG + Intergenic
1102774742 12:115508693-115508715 TGAAGTTTCAGCAAGGGGCAGGG - Intergenic
1102987003 12:117286268-117286290 TGAGTGAAGAGGAAGGGACATGG + Intronic
1103018794 12:117517040-117517062 TGAGGAAAAAGGAAGGGGCATGG - Intronic
1103189478 12:118988935-118988957 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1103466821 12:121148742-121148764 TGGGGGCTCAGCAAGGGGCGAGG - Intronic
1103570765 12:121843344-121843366 AGAGGGATCAGCAAGGGCCGAGG - Intronic
1103912635 12:124360729-124360751 AGAGGGAACAGCACAGGGAAAGG - Intronic
1103945699 12:124525223-124525245 TGAGGGAACAGCAGGCGCGAAGG - Intronic
1104010322 12:124925628-124925650 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1104051351 12:125195914-125195936 TGAGAGAACAGCAGGAGGAAAGG + Intronic
1104368844 12:128204277-128204299 TGGGGGAAGAGGAAGAGGCAGGG + Intergenic
1104547622 12:129726403-129726425 TGGGGGAACAGCAAGAGCAAAGG + Intronic
1104646616 12:130502103-130502125 GGAGGGGAGAGCAAGGAGCAAGG + Intronic
1104806689 12:131593960-131593982 AGAGGGAACAGCCACTGGCAGGG - Intergenic
1104842735 12:131832380-131832402 TGGGGGAACGGGAAGGGGGAAGG + Intronic
1105870623 13:24502972-24502994 AGAGGGAACAGCAGAGGACAGGG + Intronic
1106470385 13:30049192-30049214 AGAGGGAACAGTAAGTGCCAAGG + Intergenic
1106485328 13:30167345-30167367 AGTGGGAACAGCAAGGAGCTTGG - Intergenic
1106613803 13:31308504-31308526 TGAGGGAACAGCAAGCCTGATGG - Intronic
1107560597 13:41553825-41553847 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1108458854 13:50644809-50644831 AGAGGAAACAGCAAGCAGCAAGG - Intronic
1108473130 13:50787617-50787639 AGTAGGAACAGCAGGGGGCAGGG - Intronic
1108481045 13:50872037-50872059 TCAGGGCTCAGCAAGGGCCAGGG - Intergenic
1108558996 13:51624825-51624847 TGAGGGAACAGCCAGTGCAAAGG + Intronic
1108622010 13:52194186-52194208 TGAATGTACAGCACGGGGCACGG + Intergenic
1108726518 13:53188752-53188774 TGATGGAACAGCAAGACACAGGG + Intergenic
1108793730 13:54005093-54005115 TGAGGCAACAGCAACAGGGAGGG + Intergenic
1110574565 13:77040877-77040899 TGAGGGAGCAGGAGTGGGCAGGG + Intergenic
1111100306 13:83575651-83575673 TGAGGAAAAAGTAAGGGGGATGG - Intergenic
1112202096 13:97286720-97286742 GGAGGGAACAGCCAGTGCCAAGG - Intronic
1113424015 13:110192976-110192998 TGAGAGAACAGAAAAAGGCAAGG + Intronic
1113641603 13:111961556-111961578 TAAGGGAGCAGCAATGTGCAGGG - Intergenic
1113974297 13:114214143-114214165 TGTGGAAACTGCAGGGGGCAAGG - Intergenic
1114257645 14:21016978-21017000 TGGGGCAACAGGAAGGGGCCTGG - Exonic
1114410644 14:22497325-22497347 ACTGGGAACAGCCAGGGGCATGG - Intergenic
1114614295 14:24060086-24060108 GGGTGGCACAGCAAGGGGCAGGG + Intronic
1115019567 14:28659788-28659810 TGGGAGAACTGCAAGTGGCAGGG + Intergenic
1115343023 14:32312176-32312198 TGAGGGAAGAGGAAGATGCAGGG + Intergenic
1116790917 14:49339034-49339056 TGAGGATACAGCAAGGAACAGGG + Intergenic
1117336233 14:54759376-54759398 GGAGGGCACAGCAAGGGCAAAGG - Intronic
1117789531 14:59325054-59325076 TGAGGAAACAGCAAGCGCAAAGG - Intronic
1118254148 14:64190578-64190600 TGAGGCAGGAGCAACGGGCATGG - Intronic
1118271214 14:64344075-64344097 TGAAGGAAAAGCAAGGGTCTTGG + Intergenic
1118891857 14:69916622-69916644 AGAGGGAACAGCAAGGGCAAAGG - Intronic
1119191368 14:72684450-72684472 TGAAGGAAAACCAAGAGGCAAGG + Intronic
1119725072 14:76917367-76917389 TGAGGCTGGAGCAAGGGGCATGG + Intergenic
1120264693 14:82234010-82234032 TCAGGGAATAGGGAGGGGCAAGG - Intergenic
1120765035 14:88321192-88321214 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1120844779 14:89116175-89116197 AGAGGGAAGAGCAAGGGCCAAGG - Intergenic
1121051605 14:90822562-90822584 TCAGGGAACTCCAAGGGGGAGGG - Intergenic
1121120773 14:91374592-91374614 AGAGGGAACAGCCAGGGGCAAGG + Intronic
1121202386 14:92129207-92129229 TGAGGGAACAGCCAGGTACCTGG + Intronic
1121260117 14:92559768-92559790 TGACATAACAGCAAGGGCCAAGG + Intronic
1121435425 14:93916064-93916086 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1121693604 14:95895014-95895036 TGAGGGCACAGAAATGGCCAAGG + Intergenic
1121794185 14:96721992-96722014 GCGGGGAGCAGCAAGGGGCATGG + Intergenic
1122149697 14:99718243-99718265 AGAGGGAACAGCATGTGCCAAGG - Intronic
1122183307 14:99971346-99971368 TGAGGGAAGCGCGAGGGGCGTGG - Intergenic
1122296033 14:100706207-100706229 TCAGGCAACAGCCAGGGGCTCGG + Intergenic
1122580591 14:102769217-102769239 AGAGGGAACAGCAGGTGCCAGGG + Intergenic
1122811434 14:104291301-104291323 TCAGGGGACAGCAAGGGCCACGG + Intergenic
1122828193 14:104382507-104382529 GGAGGGAAAAGCAAGAGGCCGGG + Intergenic
1124786412 15:32685340-32685362 TGAGGGAAATGCAGTGGGCATGG + Intronic
1125104818 15:35958186-35958208 AGGGGGAGAAGCAAGGGGCAGGG - Intergenic
1126111875 15:45179959-45179981 AGAGGGAATAGCAAGGTGGAAGG - Intronic
1126680797 15:51200225-51200247 GGAGGGAACAGCAAGTGAGAAGG - Intergenic
1127557865 15:60105778-60105800 TGAGGATACAGCAAGGAACATGG + Intergenic
1128317571 15:66670940-66670962 AGAGGGAATAGCAAGGGCAAAGG + Intronic
1128369864 15:67032778-67032800 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1128418141 15:67465919-67465941 TGAGGGCACAGGCAGGGACAGGG - Intronic
1128716519 15:69912552-69912574 TGACGGAAAAGGAAGGAGCACGG - Intergenic
1128791973 15:70440382-70440404 TGAGGGAAGAGCCATGTGCAGGG - Intergenic
1129148823 15:73673828-73673850 TAAGGAAGCAGAAAGGGGCAGGG - Intergenic
1129266041 15:74393639-74393661 AGAGGGAACAGCCAGGGCAAAGG - Intergenic
1129327600 15:74809404-74809426 GAAGGGAGCAGCCAGGGGCAGGG + Intergenic
1129801958 15:78421689-78421711 TAAAGGAACAGCAAAGAGCAAGG + Intergenic
1130559209 15:84945398-84945420 TGGGGGAGCAGGAAGGGGGATGG - Exonic
1130944070 15:88537805-88537827 AGAAGTTACAGCAAGGGGCAGGG - Intronic
1132059708 15:98682072-98682094 TGAGTGAACAGCAGGGTGGATGG + Intronic
1132912797 16:2324140-2324162 TGAGGGAACAGAAAGGAGCTTGG + Intronic
1132913058 16:2325669-2325691 TGAGGGAACAGAAAGGAGCCTGG + Intronic
1132957083 16:2600047-2600069 AAAGGGAAGAGCAAGGGGCTGGG - Exonic
1133026099 16:2989583-2989605 TGAGGGCAGGGCACGGGGCAGGG + Intergenic
1133739352 16:8639939-8639961 AGAGGGAAGAGCAAGGGCAAAGG - Intronic
1134005663 16:10817679-10817701 TGAAGGAACAGCAAGCGCAAAGG - Intronic
1134297649 16:12961185-12961207 AGAGGGAACTGCATGGTGCAGGG + Intronic
1134316892 16:13127110-13127132 TGAGGGAACAGAGAGAGGGAGGG + Intronic
1134457647 16:14406364-14406386 TGAGGGGACAGCATGGGCAAAGG - Intergenic
1135075547 16:19390342-19390364 TAAGAAAACAGGAAGGGGCAAGG - Intergenic
1135420559 16:22303109-22303131 AGAGGGAACAGCAAGGGTTAGGG - Intronic
1135535943 16:23294581-23294603 AGAGGGAACAGCAAGGGCAAAGG - Intronic
1135673919 16:24398220-24398242 AGATTGAACAGAAAGGGGCATGG + Intergenic
1135738636 16:24954545-24954567 TCTGGGTACAACAAGGGGCATGG + Intronic
1135913946 16:26586727-26586749 AGAGGGAACAGCAGGGGCAAAGG + Intergenic
1136057243 16:27699442-27699464 TGAGGGCACAGAAAAGGGCAGGG - Intronic
1136381200 16:29896798-29896820 TGAGGCGACAGCAAGGGGATGGG - Intronic
1136521628 16:30800343-30800365 AGAGGGAACGGGAAGGGGCTGGG + Intergenic
1136596390 16:31253119-31253141 AGAGGGAACAGCCAGTGCCATGG + Intergenic
1137548999 16:49423893-49423915 TGAGGCAGCAGCAAGGGTTAAGG - Intergenic
1137665941 16:50249079-50249101 AGAAGGCACAGCAAAGGGCAAGG - Intronic
1137692643 16:50440320-50440342 AGAGGGAACAGCATGGGTGAAGG + Intergenic
1137781652 16:51102784-51102806 GGAGGGAAGAGAAGGGGGCAGGG + Intergenic
1137835281 16:51586249-51586271 TGATGGAACAGCAAGTGCCTAGG - Intergenic
1138104084 16:54277866-54277888 AGAGAGACCAGCAAGAGGCAGGG + Intergenic
1139403907 16:66703337-66703359 AGAGGGAACAGCATGTGCCAAGG + Intergenic
1139424150 16:66868663-66868685 ACAGGGAACAGCAAGGGCAAGGG + Intronic
1139428206 16:66896064-66896086 GGAGGGAACAGCAAGGCCAAAGG - Intergenic
1139470644 16:67176407-67176429 TGAAGGAGCACCAAGGGGCCAGG + Exonic
1139543924 16:67639910-67639932 TGAGGGAACAGAGAGGAGCTGGG + Intergenic
1139829858 16:69788528-69788550 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1139908040 16:70380269-70380291 TGAGGGAACAGGGACCGGCAGGG - Exonic
1140031391 16:71342019-71342041 TGTGGGAACAGCAAGTGCAAAGG + Intergenic
1140505595 16:75470120-75470142 TGAAAGAGCAGCAAGGGGCCAGG - Intergenic
1141261708 16:82460236-82460258 GGAGGGAACAGCAAGGGCAAGGG - Intergenic
1142055569 16:87993533-87993555 GGAGGGAATGTCAAGGGGCACGG - Intronic
1142153060 16:88521171-88521193 GGAGGGAACGGCATGGGGGAGGG - Intronic
1142153146 16:88521509-88521531 TGGGGGAACAGCACGGGGGAGGG - Intronic
1142153158 16:88521544-88521566 AGAGGGAACAGCATGAGGGAGGG - Intronic
1142153173 16:88521598-88521620 TGGGGGAACAGCATGAGGGAAGG - Intronic
1142153182 16:88521633-88521655 GGAGGGAACAGCACGGGGGAGGG - Intronic
1142153188 16:88521650-88521672 TGGGGGAACAGCACAGGGGAGGG - Intronic
1142153199 16:88521685-88521707 AGAGGGAACAGCATGAGGGAGGG - Intronic
1142153210 16:88521723-88521745 TGTGGGAACAGCACAGGGGAGGG - Intronic
1142153219 16:88521758-88521780 TGTGGGAACAGCACAGGGGAGGG - Intronic
1142153228 16:88521793-88521815 GGAGGGAACAGCACAGGGGAGGG - Intronic
1142153233 16:88521810-88521832 GGAGGGAACAGCACAGGGGAGGG - Intronic
1142153238 16:88521827-88521849 AGAGGGAACAGCATAGGGGAGGG - Intronic
1142197559 16:88745805-88745827 GGAGGAAACAGGAAGGGGCGGGG + Intronic
1142263912 16:89054844-89054866 TGAGGGAACAGCCAGGGCTTCGG - Intergenic
1142871834 17:2826314-2826336 TGAGGAAACAGTAAGGGCAAAGG + Intronic
1142903502 17:3027489-3027511 GGAGGGAACAGCATGTGGAAAGG + Intronic
1143014775 17:3885822-3885844 AGAGGGAACAGCCAGGGCAAAGG - Intronic
1143488486 17:7269202-7269224 AGAAGGAACAGCAAGGGCAAAGG + Intergenic
1143511208 17:7396099-7396121 AGAGGGAACAGCAAGGGCATAGG + Intronic
1143622789 17:8090571-8090593 AGAGGGAACAGCATGTGCCAAGG - Intergenic
1143786203 17:9257572-9257594 TGATGGGAAAGCAAGAGGCAGGG + Intronic
1145230931 17:21172681-21172703 TGAGGGGACAGCTGGGGGCCTGG - Intronic
1145238744 17:21227144-21227166 AGGGAGAACAGCAGGGGGCATGG + Intergenic
1145801072 17:27685273-27685295 TGAGGGAGTGCCAAGGGGCAGGG - Intergenic
1146424156 17:32719935-32719957 AGAGGGAACAGCCAGGGAAAAGG - Intronic
1146467366 17:33096827-33096849 GGAGGGAACAGCAAGTGCCAAGG + Intronic
1146668475 17:34720698-34720720 TGGGGGAATGGCAAGGAGCATGG + Intergenic
1146851640 17:36226961-36226983 TGAGGGCACAGTAGTGGGCAGGG + Intronic
1146867549 17:36350837-36350859 TGAGGGCACAGTAGTGGGCAGGG + Intronic
1147070425 17:37951451-37951473 TGAGGGCACAGTAGTGGGCAGGG + Intergenic
1147081949 17:38030976-38030998 TGAGGGCACAGTAGTGGGCAGGG + Intronic
1147097898 17:38154941-38154963 TGAGGGCACAGTAGTGGGCAGGG + Intergenic
1147178680 17:38672137-38672159 TGATGGATCCGAAAGGGGCAGGG - Exonic
1147924335 17:43937523-43937545 TGCGGGAACAGCAGGGAGAAAGG + Intergenic
1148028273 17:44603137-44603159 AGAGGGAACAGCAAGTGAAAAGG + Intergenic
1148073337 17:44921383-44921405 CCAGGGAAGAGCAAGGGGAAGGG - Intergenic
1148253500 17:46107191-46107213 TGCAGCAACAGCAAGGGGGATGG + Intronic
1148683946 17:49490365-49490387 TGAGGGAACAGGGTGGGGCCTGG - Intergenic
1148808957 17:50278527-50278549 AGAGGGCACAGAAAAGGGCAAGG - Intronic
1148851467 17:50557593-50557615 AGAGGGACCAGCAAAGGGGAAGG - Intergenic
1148909372 17:50932515-50932537 TGAGGGCAGAGCAAGGGCCCTGG + Intergenic
1149280420 17:55098574-55098596 AGAGGGAACAGCAAGTGGAAAGG + Intronic
1149292450 17:55230332-55230354 AAAGGGAACAGCAAGGGCAAAGG - Intergenic
1150079599 17:62225039-62225061 TGAGGGCACAGTAGTGGGCAGGG + Intergenic
1151596323 17:75079899-75079921 TGGGGGAAAAGGGAGGGGCAGGG + Intergenic
1151815275 17:76468646-76468668 TTGGAGAACAGCAAGGGACAGGG - Intronic
1151996989 17:77616045-77616067 TGAGGGACCAGCTATGGGCATGG - Intergenic
1152100809 17:78300883-78300905 TGGGGGAACAGGAAGGTGGAGGG - Intergenic
1153818166 18:8808895-8808917 TCAGGGAACAGGAACGTGCAAGG + Intronic
1154132009 18:11745521-11745543 GGAGGGGACAGCCAGGGCCAGGG - Intronic
1156467536 18:37357219-37357241 AGAGGGAACAGCAAGCGAAAAGG + Intronic
1157621946 18:49021749-49021771 TGTGGGGACAGCAAGGTGTAGGG - Intergenic
1157755012 18:50210068-50210090 TCAAGGAACAGCAAGGGGACTGG - Intergenic
1157911739 18:51623029-51623051 TCCAGGAACAGAAAGGGGCAGGG + Intergenic
1158836366 18:61334529-61334551 TGGGGGAAGAGCCGGGGGCAAGG + Intronic
1158945954 18:62447171-62447193 TGAGGGAACAGGATAGGGCAAGG - Intergenic
1160059488 18:75516296-75516318 AGAGGGAACAGCAAGTGCGAAGG + Intergenic
1160367124 18:78335672-78335694 AGAGGGGACTGCATGGGGCAGGG + Intergenic
1160513652 18:79466667-79466689 GGTGGGAACAGCCAAGGGCACGG - Intronic
1160659829 19:292664-292686 TGAGGGAACTCCAAGGGCAAGGG + Intergenic
1160901158 19:1429392-1429414 AGAGGGAACGGCAGGTGGCAAGG - Intronic
1161335440 19:3710449-3710471 TGAGGCATCAGCTGGGGGCAGGG - Intronic
1161496255 19:4587525-4587547 AGTGGGAACAGCAAGTGCCAAGG - Intergenic
1161664095 19:5564515-5564537 TCAGGGATGGGCAAGGGGCAGGG + Intergenic
1161914568 19:7218916-7218938 AGAGGGAACAGCAAGTGCCGAGG + Intronic
1162330591 19:10026857-10026879 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1162366756 19:10254413-10254435 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1162449802 19:10747941-10747963 TGAGGGAACAGCCTGGGCAAAGG + Intronic
1162752492 19:12837486-12837508 GGAGGGAACTGCAAGGGCAAAGG - Intronic
1162868967 19:13571364-13571386 TGAGGGAACAGAAAGTGCAAAGG - Intronic
1163032946 19:14556222-14556244 AGAGGGAACAGTAAGTGCCAAGG - Intronic
1163159055 19:15454096-15454118 GGTGGGAACAGGAAGGAGCAGGG - Intronic
1163597734 19:18230161-18230183 TGAGGGAACAGCAGGGAACATGG - Intronic
1165697815 19:37914264-37914286 AGAGGGAACAGCAAGTGTTAAGG + Intronic
1165895122 19:39136696-39136718 TGAGAACATAGCAAGGGGCAGGG - Intronic
1165920687 19:39296238-39296260 TGAGGGAACAGGTGTGGGCAGGG - Intergenic
1165937982 19:39401085-39401107 AGAGGGAACTGCAAGTGCCAGGG + Intergenic
1165950584 19:39472210-39472232 TGGGGGAACAGCAAGTGCAAAGG + Intronic
1166006915 19:39914394-39914416 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1166110741 19:40621583-40621605 TCAGGGAACAGGCTGGGGCAGGG + Intronic
1166113713 19:40639873-40639895 AGAGGGAACAGCCAGTGCCAAGG - Intergenic
1166160935 19:40952515-40952537 TGAGGGAACAGCAAGGTAAAAGG + Intergenic
1166186336 19:41141557-41141579 AGAAGGAACAGCAAGAGGAAAGG + Intergenic
1166202738 19:41249006-41249028 TGAAGGAACAACTGGGGGCAGGG + Intronic
1166219595 19:41355945-41355967 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1166254673 19:41594670-41594692 TTAGGGAGCAGGAAGGAGCAAGG + Intronic
1166279900 19:41784963-41784985 GTAGGGAACAGGAAGGAGCAGGG + Intergenic
1166391148 19:42409630-42409652 TGGGCGCACAGCCAGGGGCAGGG - Intronic
1166412853 19:42568241-42568263 GTAGGGAACAGGAAGGAGCAGGG - Intergenic
1166521861 19:43486301-43486323 GGAAGGAACAAGAAGGGGCACGG - Exonic
1166535282 19:43569988-43570010 TGAGGGAACTGCTGGGGGCTAGG + Intronic
1166658423 19:44628957-44628979 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1166673954 19:44727882-44727904 AGAGGGAACAGCAAGTGCCAAGG - Intergenic
1166737884 19:45096985-45097007 CCTGGGAACAGCAAGGAGCAGGG + Intronic
1166879288 19:45917421-45917443 TTTGGGAACAGCAAGGGGGCTGG + Intergenic
1166883120 19:45940853-45940875 TGATGGAACAGTCAGGAGCATGG - Exonic
1166929853 19:46296026-46296048 TGTGGGAACAGCAAGTGCAAAGG + Intergenic
1167277854 19:48549830-48549852 TGCGGGAATAGCAAGGGCAAAGG + Intergenic
1167294561 19:48642044-48642066 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1167322622 19:48806031-48806053 GGAGGGCACAGCCAGGGGGATGG - Intronic
1167347788 19:48957086-48957108 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1167393107 19:49210153-49210175 TCAGGGCCCAGCCAGGGGCAAGG - Intronic
1167417285 19:49381617-49381639 TGAGGGAATAGCAAGTGCAAAGG + Intergenic
1167433162 19:49464708-49464730 TGAGGGAACAGCGAGGCCAAAGG - Exonic
1167560100 19:50221874-50221896 AGAGGGCACAGCCAGGGGAAAGG - Intronic
1167674888 19:50877865-50877887 TGAGGGCCCAGGCAGGGGCAAGG - Intronic
1167812547 19:51847377-51847399 TGAGGCAACAGCAAGATGCTTGG - Intergenic
1168153286 19:54460438-54460460 GGAGGGAGCAGCACGTGGCAGGG - Intronic
1168472321 19:56649707-56649729 TTGGGGAACACCAAGGGGCATGG + Intronic
1168487626 19:56777965-56777987 AGAGCGAACAGCAAGTGCCAGGG - Intronic
924982338 2:235449-235471 GGAGGCAACAGCATGGGCCAGGG + Intronic
924982372 2:235550-235572 GGAGGCAACAGCATGGGCCAGGG + Intronic
925555997 2:5132290-5132312 GGAGGGAGAAGCAAAGGGCATGG - Intergenic
925913242 2:8586897-8586919 TGGGGGAACAGCTAGAGCCATGG + Intergenic
925979308 2:9164230-9164252 AGGGGGAACAGGAGGGGGCATGG - Intergenic
926246002 2:11122863-11122885 TGGGGGAACAGCATGGGCGAAGG - Intergenic
926270069 2:11358898-11358920 TGAGGAAACAGCAAAAGGAAAGG - Intergenic
926789590 2:16556757-16556779 TGTGGGAGCAGCAGTGGGCATGG + Intronic
927625431 2:24712284-24712306 TGAGGAAACAGTAAGATGCAAGG + Intronic
928360726 2:30660198-30660220 TGATGGAAAAGATAGGGGCAAGG + Intergenic
929032626 2:37663226-37663248 TGAGGGACCAGCCAGGGGCTGGG - Intronic
929823633 2:45292915-45292937 TGAGGAAGGAGCAAGGGTCAGGG - Intergenic
930340190 2:50103430-50103452 TGAGTGAACAGGAAGGTGAAAGG - Intronic
930958234 2:57230143-57230165 TGAGGGAAAAGAAGGGGGAATGG - Intergenic
931391409 2:61847201-61847223 AGAGGGAACAGCAAGTGCAAAGG - Intronic
932269052 2:70392880-70392902 TGAGGGAACAGTGAGAGGAAAGG - Intergenic
932427320 2:71646315-71646337 TGAGGGAGCAGCGAGGGGCCAGG - Intronic
932569054 2:72928159-72928181 TGAGGGAAGAGCCCTGGGCAAGG + Intronic
933626722 2:84609473-84609495 TCAGGGAATAACAGGGGGCACGG + Intronic
933642968 2:84783983-84784005 TGAGGGAACAGCCAGTGCAAAGG + Intronic
934158759 2:89228241-89228263 TGAGGCCTCAGTAAGGGGCACGG - Intergenic
934208516 2:89954187-89954209 TGAGGCCTCAGTAAGGGGCACGG + Intergenic
934700351 2:96434697-96434719 AGAGGGAACATCAAGGGTAAGGG - Intergenic
934856109 2:97731459-97731481 TGAGGGCACACAAAAGGGCAAGG - Intronic
934936916 2:98472283-98472305 TGAGGGAACTCCCAGGAGCAGGG - Intronic
935066506 2:99652913-99652935 TGAGGGAGCAGCGAGAGGCAGGG + Intronic
935090387 2:99890233-99890255 TGAGGCAGCAGCAAGGGAAATGG + Intronic
936401740 2:112169810-112169832 AGAGTAAACAGCACGGGGCAAGG + Intronic
936507225 2:113117301-113117323 GGAGGGAACAGCAAGGGCAAAGG - Intronic
936512487 2:113159393-113159415 AGAGGGAACAGCAAGTGCAAAGG + Intronic
936600180 2:113888429-113888451 AGAGTGAACAGCAAGTGTCAAGG - Intergenic
937309173 2:120891616-120891638 AGGGGGAGCAGCAAAGGGCAGGG + Intronic
937415918 2:121714407-121714429 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
937805874 2:126145027-126145049 TGAGGCTACAGTAAGTGGCAAGG + Intergenic
937986183 2:127639132-127639154 TGAGGGAACAGGAAGGGAGAAGG + Exonic
938212109 2:129477062-129477084 TGAGAGAACAGCCTGTGGCATGG + Intergenic
939008639 2:136819436-136819458 TGAGGGAAAAAGAAGGGGGAGGG - Intronic
940012833 2:149072949-149072971 AGAGGGAACAGCAAGTGCAAAGG + Intronic
940224640 2:151388899-151388921 AGAGGGAACAGCAGGGATCAAGG - Intergenic
940940720 2:159557523-159557545 AGAGGGAAGAGCAAGTGTCAAGG - Intronic
941360022 2:164540189-164540211 AGAGGGAACAGCAAGTGGAAAGG - Intronic
942369386 2:175266158-175266180 TGAGGAACCAGCAAAGGTCAGGG - Intergenic
942953775 2:181750798-181750820 TTAGGGAAGCGCAAGGGGCCAGG - Intergenic
943464993 2:188218084-188218106 TGGGGGGGCAGTAAGGGGCAGGG - Intergenic
944075653 2:195727830-195727852 TAAAGGAAGAGCACGGGGCAAGG - Intronic
944917649 2:204377644-204377666 AGAGGGACCAGCAAGGGCAAAGG + Intergenic
945727939 2:213495853-213495875 TGTGGGAACAGCAAGGGGTCCGG + Intronic
945939049 2:215930120-215930142 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
946007207 2:216535561-216535583 TGGGGGAACAGCAAGCAGCGTGG + Intronic
946390088 2:219409798-219409820 GCAGGGAACAGCAAAGGCCAAGG + Intergenic
946417660 2:219548557-219548579 AGAGGGAACAGCAAGGGCGAGGG + Intronic
947295237 2:228623663-228623685 TGAGGGAACAGGAAGGTGGTGGG + Intergenic
947581069 2:231318967-231318989 AGAGGGAAGAGCAAGTGGCAAGG + Intronic
947581081 2:231319018-231319040 TGCGGGAACAGGAAGAAGCAGGG + Intronic
947591880 2:231390528-231390550 TTAGGGAAGAGCTAGGGGCTGGG + Intergenic
947852498 2:233299648-233299670 TGAGAGCACAGCAAGGGGAACGG + Intergenic
948537220 2:238655164-238655186 AGAGGGAACAGCCAAGGGCAGGG - Intergenic
948675598 2:239594809-239594831 AGGGGGAACTGCAAAGGGCAAGG + Intergenic
948879815 2:240850964-240850986 TCAGGGGACAGCGAGGGGAAGGG - Intergenic
1168811251 20:706191-706213 GGAGGGAACAGCAAGTGCCAGGG + Intergenic
1169298992 20:4425813-4425835 AGAGGGAATACCAAGGGGCCAGG + Intergenic
1169729005 20:8766430-8766452 TGAGGAAACAGCAAGTGCAAAGG + Intronic
1169798964 20:9495855-9495877 GGAGGGAACAGCAAGAGCAAAGG + Intergenic
1170381520 20:15764979-15765001 AGAGGGAACAGCAAGTGAAAAGG - Intronic
1170413520 20:16115886-16115908 TGAGGAAACAGCAAGGGTAATGG - Intergenic
1171948650 20:31401264-31401286 AGAGGGAACAGCATGTAGCAAGG + Intergenic
1171956553 20:31468255-31468277 AGAGGGAGCATCAAGGGCCAAGG - Intronic
1172008226 20:31831674-31831696 GGAGGGGATAGCAGGGGGCAGGG - Intronic
1172096117 20:32461267-32461289 AGAGGGAACAGCAAGTACCAAGG - Intronic
1172114674 20:32566601-32566623 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1172324055 20:34020380-34020402 TTAGGGAACAGCATGAGGAATGG + Intronic
1172626328 20:36349551-36349573 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1172634148 20:36398361-36398383 AGAGGGAACAGCATGGGCAAAGG + Intronic
1173185949 20:40840413-40840435 AGAGGGAACAGCACGTGGAAAGG + Intergenic
1173494955 20:43511904-43511926 GGAGGGAACAGCAAGGGCAAAGG + Intronic
1173700871 20:45070446-45070468 TGAGGGAAAAGGAAGGATCAGGG + Intronic
1173849071 20:46206554-46206576 AGAGGGAACAGCAAGCAGAATGG - Intronic
1173880648 20:46409405-46409427 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1173919432 20:46732887-46732909 GGAGGGAACAGCAAGAGCAAAGG + Intronic
1173927626 20:46792514-46792536 AGAGGGAACAGCAAGGGCAAAGG - Intergenic
1174043257 20:47714830-47714852 TCAGGTAACAGCAAGGGCAAAGG - Intronic
1174090072 20:48039683-48039705 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1174111347 20:48200137-48200159 AGAGGGAATAGCAAGGGGAGAGG + Intergenic
1174193218 20:48754809-48754831 TCATGGAACAGCAAGGGCCTTGG + Intronic
1174205549 20:48835642-48835664 TCAAGGAACAGCAAGGGGGAAGG + Intergenic
1174273954 20:49390017-49390039 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1174336135 20:49862165-49862187 TGAGGGAACAGCATGTGCAAAGG - Intronic
1174391800 20:50222331-50222353 TGGAGGAATAGCAAGGGGCCCGG - Intergenic
1174428286 20:50448856-50448878 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1174436602 20:50511085-50511107 TGAATGAACAGAAAGGGGAAAGG - Intronic
1174743067 20:53034703-53034725 TGAGGGAACAGCAAGGGCAAAGG + Intronic
1175261113 20:57674711-57674733 TGAGGGAATAGGAAGGGAAAGGG - Intronic
1175575315 20:60056535-60056557 TGAGGGAACATGAATGGGCCAGG + Intronic
1175762162 20:61568642-61568664 AGAAGGAACAGCAAGTGCCAAGG - Intronic
1176101395 20:63366083-63366105 TGAGAGCACAGCCGGGGGCAGGG - Intronic
1178505475 21:33159234-33159256 GGAGGGAAAAGCTAGGGGCTAGG + Intergenic
1179143995 21:38751751-38751773 AGAGGGAACAGCCAGGGCCAGGG + Intergenic
1179481598 21:41682059-41682081 TGAGGGAACAGCAGGTGTCAAGG - Intergenic
1179628533 21:42662351-42662373 TGAGGAAACAGGTAGGGGGAGGG - Intronic
1180198648 21:46212066-46212088 GGAGGGGACAGGGAGGGGCAGGG + Intronic
1180969989 22:19810324-19810346 TGAGGGGACATCAAGGGCAAAGG + Intronic
1180978767 22:19868821-19868843 TGAGGGAACAGCATGGGCAAAGG + Intergenic
1181082332 22:20423845-20423867 TGTGGGGACAGCAGGGGCCATGG + Intergenic
1182127885 22:27829394-27829416 TGAGGGAACAGCATGAGGAAGGG + Intergenic
1182430151 22:30294468-30294490 TTAGGGGACAGCACGGGGAAGGG + Intronic
1182786903 22:32915597-32915619 TGAGGGAATAGCAAGTGCAAAGG + Intronic
1182921628 22:34085363-34085385 TCAGTGAACACCAAGGGCCAGGG - Intergenic
1183309015 22:37099237-37099259 AGAGGGAGCAGCATGGGGCACGG + Intronic
1183380310 22:37487349-37487371 GGTGGGAACAGCAAGTGCCAAGG - Intergenic
1183608272 22:38879773-38879795 AGAGGGAACAGCAAGGATCAAGG - Intergenic
1183666528 22:39249355-39249377 GGATGGGGCAGCAAGGGGCATGG - Intergenic
1183726818 22:39594535-39594557 TGAGGGGACGGGAAGGAGCAGGG + Intronic
1183853883 22:40616339-40616361 TGAGGGAAGAGGAAAGAGCATGG + Intronic
1183933961 22:41251231-41251253 TGAAGGGACAGCATGGGGTAAGG - Intronic
1184111663 22:42399099-42399121 AGAGGGAACAGCAGGTGCCAAGG + Intronic
1184387863 22:44186521-44186543 TGAGGGAATAGGAAGGAGGATGG - Intronic
1184499312 22:44862225-44862247 GGAGTGAACACCAAGGGGCACGG - Intronic
1184510279 22:44929402-44929424 GGAGGGACCAGCAAGGGCCACGG + Intronic
1184534928 22:45079985-45080007 TGTGGGAACAGCACGGGCCCAGG + Intergenic
1184717965 22:46292661-46292683 TGAGGGAACAGCAAGGGCCAAGG - Intronic
1184754519 22:46508441-46508463 CGAGGGGACAGCAAGGGGCGGGG - Intronic
1184890034 22:47373880-47373902 TGAGGGCATAGGAAGGGCCATGG - Intergenic
949265400 3:2151399-2151421 AGAAGGAACAGCATGGGCCAGGG + Intronic
949455277 3:4231470-4231492 TTGGGTAACAGCAAGGGACAAGG - Intronic
949520995 3:4853911-4853933 TGAGTGAAAAGGAAGGGGGAGGG - Intronic
950399706 3:12760469-12760491 AGAGGGAACAGCCAGGGCAAAGG - Intronic
950455954 3:13092886-13092908 AGAGGGAACAGCAAGGGCAAAGG - Intergenic
950466291 3:13156844-13156866 TGAGGGAACAGCACAGGCAAAGG + Intergenic
950530002 3:13548009-13548031 AGAGGGAACAGCAATGGCAAAGG + Intergenic
950581140 3:13862848-13862870 TGAGGGAACAGCATGTGCAAAGG - Intronic
950582550 3:13871964-13871986 TTAAGGAACAGCGAGGGGCTGGG - Intronic
950617371 3:14171921-14171943 AGAGGGCACAGGAAGGGACACGG - Intronic
950638628 3:14333588-14333610 TGTGGGAAGAGCACTGGGCAGGG - Intergenic
950649421 3:14397886-14397908 GGAGGGAGCAGCAAGGGTGAAGG + Intergenic
951945999 3:28137043-28137065 AGAGGTAACAGCAAGGGCAAAGG + Intergenic
952534363 3:34294573-34294595 TCAGGGACCAGCAAGGGGCTTGG + Intergenic
952845683 3:37686245-37686267 CGAGGGAGCAGGGAGGGGCAGGG + Intronic
953338903 3:42117515-42117537 TGAGAAAACAGCAAGGGGAGAGG - Intronic
953362320 3:42309057-42309079 TGAGGGAAGAGCCTTGGGCAAGG - Intergenic
953411814 3:42694708-42694730 AGAGGGAACAACAAGGGCAAAGG - Intronic
953451918 3:43013004-43013026 TGAAGCCACAGGAAGGGGCATGG + Intronic
953452406 3:43015792-43015814 TGAAGTAACAGGGAGGGGCAGGG + Intronic
954611811 3:51948286-51948308 GCAGGGCACAGCAAGGGCCAGGG - Intronic
954687267 3:52377675-52377697 AGAGGGGACAGCAAGGGCAAAGG - Intronic
955040231 3:55309555-55309577 AGAGGCAACAGCAAGTGCCAGGG + Intergenic
955090974 3:55750111-55750133 TGAAGGATCAGCAATGGGTAAGG + Intronic
955238821 3:57162881-57162903 AGAAGGTAAAGCAAGGGGCATGG + Intronic
955533294 3:59897379-59897401 TTAGGGAACAGGAAGAGGAAGGG - Intronic
955886563 3:63605399-63605421 AGAGGGAACAGCAAGTGCAAAGG + Intronic
956037220 3:65107120-65107142 TGAGGGAGCTGCAAGGTGCTTGG + Intergenic
956058125 3:65322208-65322230 AGAGGGAACAGCAAAGGCAAAGG + Intergenic
956718254 3:72097191-72097213 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
958094419 3:88924147-88924169 TGAGGGAATAGAAAGGAGAAGGG + Intergenic
960057747 3:113287227-113287249 TGAGGGAACAGCAAGGGGCACGG + Exonic
960605858 3:119504409-119504431 AGAGGGAACATCAAGGGGGAAGG + Intronic
960740063 3:120823600-120823622 ATAAGGAACAGCAAGGGGGAGGG - Intergenic
960936955 3:122910334-122910356 TGAGGGAACACACAGGGGAAGGG + Intronic
961051624 3:123751896-123751918 AGAAGGAACAGCAAGGGTGAAGG + Intronic
961332311 3:126149787-126149809 AGAAGGAACAGCAAATGGCAAGG - Intronic
961346877 3:126268675-126268697 AGAGGGAACTGCAAGGAGAAAGG + Intergenic
961517328 3:127446078-127446100 AGAGGGAACAGCAGGATGCAAGG + Intergenic
961533058 3:127551606-127551628 AGAGGGGACAGCAAGGGCAAAGG - Intergenic
961744753 3:129057394-129057416 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
962345180 3:134613419-134613441 GGAGGAAGAAGCAAGGGGCAGGG + Intronic
962425401 3:135265048-135265070 AGAAGGAACAGCAAGGGCCAAGG + Intergenic
963115236 3:141723319-141723341 AGAAGGAACAGCAAGTGCCAAGG + Intergenic
963702683 3:148645746-148645768 TGAAGGGAAAGCAAGGGACAGGG - Intergenic
963909478 3:150803236-150803258 CGTGAGAACAGCAAGGGGGAAGG - Intergenic
963960636 3:151305238-151305260 TGAAGGAACAGTAGGTGGCAGGG - Intronic
964814456 3:160701752-160701774 AGAGGGTACAGTTAGGGGCAAGG - Intergenic
964931157 3:162025021-162025043 AGAAGGAACAGCAAGTGGCGAGG - Intergenic
966439649 3:179929705-179929727 TTAGGGAGCAGGAAGAGGCAGGG - Intronic
966908058 3:184542055-184542077 TGAGTGGACAGCAAGCCGCAGGG - Intronic
967135871 3:186512164-186512186 AGAGGGAACAGCAAGAGCCAAGG + Intergenic
968466108 4:752191-752213 GGAGGGAACAGCAAGGGCAGTGG - Intronic
968472956 4:790282-790304 TCAGAGAACAGCAGGTGGCAGGG - Intronic
968599015 4:1500452-1500474 TGAGGAACCACCAGGGGGCACGG + Intergenic
969253902 4:5989936-5989958 TGGGAGGACAGCTAGGGGCAAGG - Intergenic
969639602 4:8388913-8388935 GGAGGGAAAGGCAAGAGGCAAGG + Intronic
969860538 4:10032315-10032337 AGAAGGAGCAGCAAGGGCCAGGG + Intronic
970420355 4:15900187-15900209 TGCTGGAACAGTTAGGGGCAAGG - Intergenic
970493600 4:16602479-16602501 TGAGGTCACAGAAAGAGGCAGGG + Intronic
971313860 4:25550528-25550550 AGAGGGAACAGCAAGTGCAAGGG + Intergenic
971492170 4:27224619-27224641 AGAGGAAACAGCAAGTGGAAAGG - Intergenic
972397674 4:38671886-38671908 GGGGGGAACTGCAAGGGGAAGGG - Intronic
972999304 4:44925951-44925973 TGAGGGAAGAGTGAGGGGGAGGG + Intergenic
973111608 4:46404320-46404342 TTAGGGAACATCAAGAGGCCAGG - Intronic
973557281 4:52097002-52097024 TGAAGAAACAGCAAGTGGCCAGG - Exonic
974450031 4:62042536-62042558 TTAGAGAACAGCAAGGGGACAGG + Intronic
975610319 4:76196575-76196597 TGAGAGAATAACAAGGGGAAGGG + Intronic
977869970 4:102079932-102079954 AGAGAGAACAGCAAGTGCCAAGG + Intergenic
978128766 4:105168401-105168423 AGAGGGAACAGCAAGTGCAAAGG - Intronic
978327814 4:107579189-107579211 CCAGGGAGCAGCATGGGGCAAGG + Intergenic
978710193 4:111770698-111770720 TGGGGGTAGGGCAAGGGGCAGGG + Intergenic
978811744 4:112856928-112856950 TGAGGAGACATCAAGGGTCAGGG + Intronic
979089642 4:116465724-116465746 AGAGGCATCACCAAGGGGCAGGG + Intergenic
979759492 4:124383519-124383541 TCAGGGAACAGGAAGGTGTAAGG + Intergenic
979944295 4:126807327-126807349 TCAGGGCACAGCAAAGGGCTTGG - Intergenic
980092962 4:128461419-128461441 AGATGGAACAGCAAGGGCAAGGG - Intergenic
980735893 4:136887756-136887778 AGAAGGAACAGCAAAGAGCAAGG - Intergenic
980800669 4:137745394-137745416 TGAGGTAACACCAAGAGGAATGG + Intergenic
981569309 4:146134638-146134660 AGAAGGAGCAGGAAGGGGCAAGG - Intergenic
982206752 4:153002252-153002274 CCAGGAGACAGCAAGGGGCAGGG - Intergenic
984242703 4:177236810-177236832 AGAGGGAACAGCAAGGGACTGGG + Intergenic
984591916 4:181626549-181626571 TGAGAGCACAGCAAGGGGGCGGG + Intergenic
984661898 4:182383331-182383353 TGTGGGCCCAGCAAGGGGAAGGG + Intronic
985644169 5:1077284-1077306 CGAGGGACCAGCGACGGGCAAGG + Intronic
985834666 5:2261586-2261608 TGGGGAAACAGCAAGGGATAAGG - Intergenic
986364401 5:7016397-7016419 TAAGGCAAGAGAAAGGGGCATGG - Intergenic
987039889 5:14052562-14052584 CAAGGGAACAGCAAGGGCAAAGG + Intergenic
987360917 5:17105715-17105737 AGAGGGAACAGCAAGTGCAAAGG + Intronic
988622114 5:32833688-32833710 TGAGGAAACAGGAGGGGGAAAGG - Intergenic
988792293 5:34619925-34619947 AGAGGCAACAGCGAGTGGCAAGG + Intergenic
993554678 5:89321227-89321249 TGAGGGAAGGGGAAGGGGAAAGG + Intergenic
994743460 5:103649474-103649496 AGAGGGAGCAGCAAGTGGAAGGG + Intergenic
994980239 5:106865448-106865470 GGAGGGAACAGGAAATGGCACGG - Intergenic
995332409 5:110959898-110959920 AGAGGGAACAGCAAGTGCCAAGG + Intergenic
995677539 5:114679951-114679973 TGAGGGAAAATCTAGGTGCAAGG - Intergenic
995817836 5:116191754-116191776 AGAGGGACCAGCAATGGGCAGGG - Intronic
996284796 5:121776842-121776864 AGAGGGAACAGCAAAGGCAAAGG - Intergenic
996378694 5:122842492-122842514 TGAGAGAACATCAAGGGGGAAGG - Intergenic
997791778 5:136768529-136768551 TGAGGGTACAGCAAGTGCAAAGG - Intergenic
997813329 5:136993401-136993423 TGAGGGAAGAGGGAGGGGCTAGG - Intronic
997887366 5:137642274-137642296 TCAGGGAACAGCATGTGGGAGGG - Intronic
997888858 5:137657560-137657582 TGAGGGAGCAGCCAGGGAAAGGG - Intronic
998167357 5:139851856-139851878 CGAGGGGTCAGGAAGGGGCAGGG + Intronic
998231697 5:140364996-140365018 AGAGGGGAGAGAAAGGGGCAGGG + Intronic
998369656 5:141652690-141652712 TGAGGGAACAGCAAAGAGGCTGG - Intergenic
998499737 5:142621816-142621838 AGAGGGAACAGCATGGGCAAAGG - Intronic
999190850 5:149746176-149746198 AGAGGGAACAGCAAGTGCAAAGG - Intronic
999250810 5:150181207-150181229 AGAGGGAACAGCAAGTGCAAAGG - Intronic
999324587 5:150635842-150635864 AGAGGGAACAGCAAGTGCTAAGG - Intronic
999490589 5:152046584-152046606 TGAGGAAACAGCCAGGGCAAGGG - Intergenic
999749916 5:154620135-154620157 AGTGGGAACAGCAATGTGCATGG + Intergenic
1001280334 5:170382038-170382060 TGATGGGACGGGAAGGGGCAGGG - Intronic
1001288959 5:170443037-170443059 TGAGGGAAGGGAAAGGGCCAAGG - Intronic
1002307730 5:178293659-178293681 TGAGGGAGGAGGGAGGGGCAGGG + Intronic
1002644752 5:180647680-180647702 AGGGGGTACAGCAAGGTGCAGGG + Intronic
1004631658 6:17427172-17427194 AGAGGGAACAGCAAGAGCGAAGG + Intronic
1004804133 6:19183582-19183604 GGAGGGAACAGCAGGAGGCCTGG + Intergenic
1005354544 6:24969751-24969773 TGGGGGTACAGTAAGGGGCAGGG - Intronic
1005676755 6:28162774-28162796 AGAGGGAACAGCACTGGCCAGGG + Intergenic
1005724541 6:28635669-28635691 GAGGGGTACAGCAAGGGGCAGGG - Intergenic
1005788338 6:29270436-29270458 TGAGGGAACAGCAAGTGAAAAGG - Intergenic
1005821118 6:29600069-29600091 TCAGGGAAAAGCAGGGGACATGG + Intronic
1006094062 6:31644860-31644882 TGAGGGAACAGGGTGGGGAAGGG - Intronic
1006362899 6:33597069-33597091 CGAGCGAACAGCAAGGGCAAAGG - Intergenic
1006454395 6:34123645-34123667 TGCGTGCACAGCAAGGGCCAGGG - Intronic
1006678782 6:35782187-35782209 GGAGGGAACAGCCAGGGCAAAGG + Intronic
1006809977 6:36813739-36813761 GGAGGGAACAGCAAGTGCAAAGG - Intronic
1006844817 6:37054901-37054923 TGAGGGAAGAGAGAGGGGCCAGG - Intergenic
1007343530 6:41209293-41209315 TTAGGAGACAGGAAGGGGCAGGG - Intergenic
1007346774 6:41236899-41236921 TTAGGAGACAGGAAGGGGCAGGG + Intronic
1007370753 6:41425685-41425707 GGAGGGAACAGCAAGTGCAAAGG + Intergenic
1007416071 6:41691952-41691974 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1007582137 6:42966020-42966042 TGAGTGAGCAGGGAGGGGCAGGG - Intronic
1007744023 6:44031200-44031222 GGACTGAACAGCAGGGGGCAGGG - Intergenic
1010614620 6:77997014-77997036 TGAGGGAAGCGCAAGGGGTCAGG - Intergenic
1012304151 6:97629406-97629428 TGAGGAAACAGCAGGGAGAAAGG + Intergenic
1013025958 6:106271915-106271937 AGAGGGAACAGCAAGAGCAAAGG - Intronic
1013597674 6:111674663-111674685 AGAGGGCACTGCAATGGGCATGG + Intronic
1014397915 6:120949382-120949404 AGAGGGAACAGAAAGGGCAAAGG - Intergenic
1014432072 6:121382735-121382757 TGAGGGAGCAGCAAGAGACGAGG - Intergenic
1014738799 6:125124569-125124591 AGAGGGACCAGCAGTGGGCAGGG - Intronic
1014773638 6:125484666-125484688 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1016901315 6:149105772-149105794 GGAGGGAACAGGAAGGGACAGGG - Intergenic
1017539879 6:155390148-155390170 TGAGAGAACAGCAGCTGGCATGG - Intergenic
1017543451 6:155426604-155426626 GGAGGGAACAGCAATGGCAAAGG + Intronic
1017924081 6:158895829-158895851 TGAATGGACAGGAAGGGGCAGGG + Intronic
1018486546 6:164246272-164246294 AGAGGGCACAGCAAGCGCCAAGG - Intergenic
1019297364 7:285191-285213 CGTGGGGACAGAAAGGGGCAGGG + Intergenic
1019420677 7:949318-949340 TGAGGAAACAGGAAGGGACTTGG - Intronic
1019625063 7:2011746-2011768 TCAGGGAACAGCCAGGGGCCTGG + Intronic
1020147922 7:5659399-5659421 AGAGGGAAGAGCAAGGGTGAAGG + Intronic
1020513153 7:9084751-9084773 TGGGAGCACAGGAAGGGGCAGGG - Intergenic
1022355933 7:29614466-29614488 TGGGGGAACAGCAAGTGCAAAGG - Intergenic
1022563403 7:31373179-31373201 TGGAGCATCAGCAAGGGGCAGGG - Intergenic
1022603950 7:31790082-31790104 TGAGGGAAGGCCAAGGGTCAGGG + Intronic
1024050853 7:45622362-45622384 TGAGGGGTCAGCATGGGGGATGG + Intronic
1024274591 7:47667580-47667602 TGTGGGAGCAGCAAAGGGGAGGG - Intergenic
1025253743 7:57369244-57369266 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1025851547 7:65248703-65248725 TGAGGGAAAGAAAAGGGGCAAGG + Intergenic
1025950682 7:66143054-66143076 TGAGGGAACAGATAGAGTCAAGG - Intronic
1026483930 7:70801501-70801523 GGAGGAGGCAGCAAGGGGCAGGG - Intergenic
1026537942 7:71255763-71255785 TGAGGGAACAGCATGAGTAAAGG + Intronic
1026879163 7:73897786-73897808 AGAAGGACCAGCAAGGAGCATGG - Intergenic
1027361583 7:77415915-77415937 TGAGGGAACCGCCAGCGGCCCGG + Intronic
1027652289 7:80883639-80883661 GGAAGGAACAGCAAGAAGCATGG - Intronic
1028202827 7:87982392-87982414 AGAGGGAACAGCAAGGGTCTGGG + Intronic
1028747076 7:94339112-94339134 TGAGATAACAGCAAGGGACTAGG + Intergenic
1029638720 7:101804342-101804364 ACAGGGGACAGCAAGGGGTAGGG + Intergenic
1030443259 7:109615810-109615832 TGAGGGAGTAGCATGGGGCAAGG - Intergenic
1030641697 7:112013565-112013587 GGAGGGAAAAGCAATGGGAAAGG - Intronic
1030804497 7:113898441-113898463 AGATGGAATATCAAGGGGCATGG + Intronic
1031870256 7:127083277-127083299 TGAGGGAGAAGGAAGAGGCAGGG - Intronic
1031947669 7:127858302-127858324 AAAGGGAGCAGCAAGGGGCCTGG - Intronic
1033061769 7:138116286-138116308 CAAGGGAACAGAAAGGGGGAAGG + Intronic
1033303139 7:140204109-140204131 TGAGGAAACAACCAGGGGCTGGG - Intergenic
1033596073 7:142859189-142859211 TGAGAGAGGAGCAAGGGGCCTGG + Intronic
1033596586 7:142863733-142863755 CCAGGGAACAGGGAGGGGCAGGG - Intronic
1033761502 7:144441124-144441146 AGAGGGAACAGCTAGTGCCAAGG + Intergenic
1033952763 7:146805573-146805595 GGAAGGAACAGCAAGAGGGAGGG + Intronic
1034211873 7:149370916-149370938 AGAGGGAAGAGGGAGGGGCAGGG + Intergenic
1034316730 7:150139832-150139854 TGAGGGGACAGCAAAGGAAAAGG + Intergenic
1034346305 7:150387403-150387425 TGAGGGGACAGCCAGGGCAAAGG + Intronic
1034790133 7:153960850-153960872 TGAGGGGACAGCAAAGGAAAAGG - Intronic
1034897668 7:154887829-154887851 TGAGGGAGAAGCATGGGGCTGGG - Intronic
1035024498 7:155817122-155817144 TGGGGGAGCAGCAGGGGGCTTGG - Intergenic
1035262366 7:157670077-157670099 TGGGGGAGCAGCAAGGGGCACGG + Intronic
1035268308 7:157704544-157704566 AGCGGGAGCAGCATGGGGCAGGG - Intronic
1036184820 8:6613822-6613844 TGAGGTGGCAGCCAGGGGCAGGG + Intronic
1036678092 8:10851575-10851597 GGAGGCAACAGAAAGGGGCAGGG + Intergenic
1037013179 8:13870239-13870261 AGAGGGAACAGGAAAGGGAATGG + Intergenic
1037752548 8:21692341-21692363 TGAGGAAAGAGAAAGGGGAAAGG + Exonic
1038394133 8:27234349-27234371 TGAGGGAACTGCATGGGCAAAGG + Intergenic
1039793102 8:40891232-40891254 TGAGAGGAGAGCAAGGGGGAAGG + Intronic
1039793403 8:40892883-40892905 GGAGGGAAAGGCAAGGGCCATGG - Intronic
1040887610 8:52282781-52282803 TTAGGGAACAGCAAGGGAAGAGG + Intronic
1041229711 8:55736887-55736909 CCAGGTAACAGTAAGGGGCATGG + Intronic
1042088632 8:65134073-65134095 AGAGGGATCAGCAGTGGGCAGGG - Intergenic
1042150966 8:65783452-65783474 TGAGGGAACAGCACTTGGAAAGG - Intronic
1042603339 8:70521848-70521870 TGAGGGCAGAGCAAAGGGGATGG + Intergenic
1042635706 8:70871658-70871680 TCAGGGAACAGGAAGGCCCAAGG - Intergenic
1042689724 8:71484608-71484630 TGAGGGCTCAGCCAGGGGTAGGG - Intronic
1044727471 8:95205083-95205105 AGAGGGAACAGCATGTGGCAAGG - Intergenic
1044781639 8:95749889-95749911 TGAGGGCAGAGCGAAGGGCATGG - Intergenic
1045102566 8:98860395-98860417 AGAGGGAACAGCAAGTGTGAAGG + Intronic
1045384241 8:101655956-101655978 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1045772545 8:105760159-105760181 AGAGGGAACAGCAGGGGTTAAGG + Intronic
1046664126 8:116980358-116980380 TGAGGTAGCAGGAAAGGGCAGGG + Intronic
1047183883 8:122614616-122614638 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1047355541 8:124118315-124118337 TGAGGGAACAGGAAGAGGGAGGG + Intronic
1047360490 8:124164547-124164569 TGGGAGTACAGCAAGGGGCTAGG - Intergenic
1047981868 8:130191837-130191859 TGAGGGAGCAGAGAGGGGCGGGG + Intronic
1048006409 8:130422727-130422749 CCAGGGAACAGCAAGAGGCTTGG + Intronic
1048008020 8:130434797-130434819 TGAGGGAACTTCTAGGGGAAAGG + Intronic
1048383997 8:133894217-133894239 TGATGGAACAGCTAGGGTAAGGG - Intergenic
1048810753 8:138283904-138283926 AGAGGGAACAGCATGGGCGAAGG + Intronic
1048810848 8:138284616-138284638 AGAGGGAACAGCATGGGCAAAGG - Intronic
1049072461 8:140367208-140367230 TGAGTAAATATCAAGGGGCATGG - Intronic
1049203256 8:141351897-141351919 TGAGGGACCATCCAGGGGGAGGG + Intergenic
1049358994 8:142202922-142202944 GGAGGGAACAGCACGGAGAAGGG - Intergenic
1049642506 8:143721932-143721954 GGAGGGAAAAGCAGGGGGGAAGG - Intronic
1050673798 9:8028743-8028765 TTAGGGAACAGCAAGTGGAAAGG + Intergenic
1051219188 9:14830772-14830794 TGAAGGAACACCAAGGGTCTTGG - Intronic
1051351360 9:16200936-16200958 GGAGGGGTCAGCATGGGGCATGG - Intergenic
1055000948 9:71447836-71447858 TGAAAGAACAACAAGGTGCAGGG - Intergenic
1055399913 9:75912269-75912291 TGAGGGAACAGCCAGTGCAAAGG + Intronic
1055639924 9:78311458-78311480 TCAGGGTACAGCTTGGGGCAGGG + Intronic
1055896427 9:81181570-81181592 TGTGGGCAGAGCAAGTGGCATGG + Intergenic
1056150896 9:83787124-83787146 TGAGGTAACAGAAAGGGATATGG + Intronic
1056544102 9:87599029-87599051 TGAGGGGAAAGCAAAGGGCAGGG - Intronic
1056760602 9:89411982-89412004 AGAGGGAGCAGCAAGTGCCAAGG - Intronic
1056822102 9:89850319-89850341 TGAGGGAAAAGCAAAGGCCCAGG - Intergenic
1057286972 9:93764537-93764559 AGAGGGGACAGCAAGGGCAAAGG - Intergenic
1057738220 9:97687486-97687508 AAAGGGAACAGCAAGGGAAAAGG + Intronic
1057782118 9:98058209-98058231 CGAAGGAACAGCAAGGGCCGAGG - Intronic
1057786552 9:98092393-98092415 AGAGGGCACAGCAAGTGCCAAGG - Intronic
1057960704 9:99454011-99454033 TGTGGGAACAACAATGAGCAGGG + Intergenic
1058100410 9:100913328-100913350 ACAGGAAACAGCAAGGGGAAAGG - Intergenic
1058111524 9:101035475-101035497 AGAGGGAACAGCATGGCGAAAGG - Intronic
1058304074 9:103414808-103414830 TGAGGGAACAGCAAGTGAAAAGG + Intergenic
1059422772 9:114202726-114202748 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1059441627 9:114310730-114310752 GGAGGGAAGAGGAAGAGGCAAGG + Exonic
1059984987 9:119813028-119813050 AGAGGGAACTGCATGTGGCAAGG + Intergenic
1060494137 9:124105541-124105563 AATGGGAACAGCAAGGGCCAAGG - Intergenic
1060745961 9:126131097-126131119 TGAGGGAGCTGAAAGAGGCATGG + Intergenic
1060861041 9:126954996-126955018 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1060975596 9:127763088-127763110 AGAGGGAACAGCAAGTGCGAAGG - Intronic
1061205474 9:129160714-129160736 AGAGGGAACAGCAAGTACCAAGG + Intergenic
1061250161 9:129421790-129421812 GGAAGGGAGAGCAAGGGGCAGGG + Intergenic
1061273392 9:129556638-129556660 TGAGAGAACAGCATGTGCCAGGG + Intergenic
1061414003 9:130436148-130436170 AGAGGGGACAGCAAGTGTCAGGG + Intergenic
1061519919 9:131111902-131111924 TGAGGGGAGAGAGAGGGGCAGGG - Intronic
1061590624 9:131595258-131595280 TGAGGGAACAGTGAAGGGGAGGG + Intronic
1061749941 9:132770534-132770556 TCAGGTTACAGCCAGGGGCAGGG - Intronic
1061772044 9:132932740-132932762 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1061889038 9:133608093-133608115 TGAGGGAAATGCAAGGGAGAAGG + Intergenic
1062048721 9:134436425-134436447 TGAGGGCCGGGCAAGGGGCATGG - Intronic
1062395375 9:136350607-136350629 TGAGGGGACAGCAAGGGGCTAGG + Intronic
1062481793 9:136755746-136755768 GCAGGGAACAGCATGGGGAACGG + Intronic
1186092304 X:6062968-6062990 AGAGGGAACAGCCAGTGCCAAGG - Intronic
1186141110 X:6574951-6574973 GGAGGGACCAGCAGGGGGCACGG - Intergenic
1186515578 X:10164238-10164260 TGAGGGAACAGCCAGTGCAAAGG + Intronic
1186517444 X:10176523-10176545 CGAGGAAACAGGAAGGAGCAAGG + Intronic
1187244191 X:17539149-17539171 AGAGGGAACAGCAAGGGCAAAGG - Intronic
1187366613 X:18670716-18670738 TGAGGAAAGAGGAGGGGGCAAGG + Intronic
1187452553 X:19411725-19411747 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1187536329 X:20144721-20144743 AGAGAGAACAGCAAGGGCAAAGG + Intergenic
1188497910 X:30798224-30798246 TGAGGGGAAAGCAAGGCACAAGG - Intergenic
1189241652 X:39529235-39529257 AGAGTGAACAGCAAGGGCAAAGG - Intergenic
1189785192 X:44553089-44553111 TGAGAGAAAAGGAAGGGGAAGGG - Intergenic
1189834539 X:45006236-45006258 TGAGGTGACCACAAGGGGCAGGG + Intronic
1189857549 X:45238456-45238478 AGAGGAAACAGAACGGGGCAGGG + Intergenic
1189975681 X:46459836-46459858 TGAGGGAACAGCCTGGGGCCTGG - Intronic
1190258711 X:48784894-48784916 TGAGGGTTCAGCATGGGGCGTGG + Intergenic
1190630571 X:52381481-52381503 TGGGGAACCAGGAAGGGGCAGGG + Intergenic
1191782634 X:64885260-64885282 TGAGTGAACAACAAGGAGGACGG + Intergenic
1192178268 X:68899302-68899324 TGAGGGATCAGGGAGGGGGAGGG - Intergenic
1192218154 X:69178200-69178222 TGATGGAGCAGCCAGAGGCAGGG - Intergenic
1192551982 X:72061796-72061818 AGAGGGAACAGAAAGTGCCAAGG - Intergenic
1192612441 X:72580882-72580904 GGATGGGACAGAAAGGGGCAGGG + Exonic
1195658149 X:107352882-107352904 TGAGGGAGCAGGAAGGAGCCCGG + Intergenic
1196302798 X:114065710-114065732 AGCAGGATCAGCAAGGGGCAGGG + Intergenic
1196655188 X:118210744-118210766 TGAAGGAACAAGAAGGGGCTGGG - Intergenic
1196847209 X:119905683-119905705 AGAGGGAACAGCAAGAGCAAGGG - Intronic
1196971618 X:121115777-121115799 TCAGGGAACAGGGAGGGCCAAGG + Intergenic
1198245536 X:134827717-134827739 TCAGGGAACAGAAAGGTTCAGGG - Intronic
1199076626 X:143533306-143533328 AGAAGGAACAGCACGGGGGAAGG + Intergenic
1199259863 X:145759858-145759880 AGAGGGAACACCAAGTGCCAAGG + Intergenic
1199403306 X:147426103-147426125 TGAGGGAGCTGCAAGGTACATGG + Intergenic
1199685080 X:150258414-150258436 GGAGGGCAGAGCAAGCGGCAGGG - Intergenic
1199936289 X:152576851-152576873 GGAGGGAACAGCATGGCCCAGGG - Intergenic
1201622200 Y:15972468-15972490 GGAGGGACCAGCATGGGGCATGG + Intergenic