ID: 960057748

View in Genome Browser
Species Human (GRCh38)
Location 3:113287240-113287262
Sequence AGGGGCACGGTATCACAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960057741_960057748 15 Left 960057741 3:113287202-113287224 CCAGGCACATGGTTCATCACGAG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 960057748 3:113287240-113287262 AGGGGCACGGTATCACAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 76
960057740_960057748 16 Left 960057740 3:113287201-113287223 CCCAGGCACATGGTTCATCACGA 0: 1
1: 0
2: 0
3: 7
4: 70
Right 960057748 3:113287240-113287262 AGGGGCACGGTATCACAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960057748 Original CRISPR AGGGGCACGGTATCACAGCC TGG Exonic
902572073 1:17353321-17353343 AGGTGCATGCTATCACAACCTGG - Intronic
907460331 1:54601892-54601914 AGGGGCACGGGAAGACAGTCAGG + Intronic
917180190 1:172287864-172287886 AGTGCCACTGTACCACAGCCTGG - Intronic
920371774 1:205483602-205483624 AGGGGCATGGTCTTGCAGCCGGG - Intergenic
922987496 1:229877295-229877317 AGGCGCACGACACCACAGCCCGG - Intergenic
1062809407 10:451067-451089 AGGGGCTGGGGAGCACAGCCCGG - Intronic
1064053248 10:12076552-12076574 AGGTGCACGTCATCACACCCAGG - Intronic
1065286018 10:24188405-24188427 AGGGGTAGAGGATCACAGCCAGG + Intronic
1065707192 10:28481305-28481327 AGTGGCACGGTACCCCAGCCTGG - Intergenic
1069822211 10:71235040-71235062 AGGGGCCCGGCATTGCAGCCAGG - Intronic
1070167217 10:73907915-73907937 AGGGGCAGGGTATCCAAACCTGG - Intergenic
1072735408 10:97875799-97875821 AGGGTCTGGGTATCACACCCAGG - Intronic
1074761316 10:116669421-116669443 TGGGACATGGTCTCACAGCCAGG - Intronic
1076666775 10:132097622-132097644 AGCGGGACAGTATCACAGCCAGG - Intergenic
1101134877 12:101732808-101732830 AGGCACACGCCATCACAGCCCGG + Intronic
1107716099 13:43200919-43200941 AGGGTGATGGTCTCACAGCCAGG - Intergenic
1113580720 13:111426741-111426763 AGGGCCACGGTTACACAGCTTGG - Intergenic
1114066258 14:19061977-19061999 AGGGGCAGGGGAGCACACCCTGG + Intergenic
1114096010 14:19338047-19338069 AGGGGCAGGGGAGCACACCCTGG - Intergenic
1121638579 14:95470269-95470291 AGGGGCAGGGTTCCACAGCATGG + Intronic
1128927788 15:71674578-71674600 AGGGGCACAGCCTGACAGCCTGG + Intronic
1132764781 16:1528864-1528886 AGGGGCTCGGGAGGACAGCCAGG + Intronic
1133339032 16:5025039-5025061 AGGGGTCCCGTGTCACAGCCAGG + Exonic
1134052858 16:11149122-11149144 AGGGGCCAGGCTTCACAGCCAGG + Intronic
1136465766 16:30442588-30442610 AGGGGCACGCCATCACACCTGGG + Intergenic
1139430175 16:66906977-66906999 AGGGGCAGGGAATCCCTGCCTGG + Intergenic
1140664396 16:77214393-77214415 TGGGGCAGGGGACCACAGCCTGG - Intergenic
1147187158 17:38719339-38719361 AGGGGCAGGGTTTCCAAGCCAGG + Intronic
1147663214 17:42128708-42128730 ACAGGAGCGGTATCACAGCCTGG - Exonic
1153999399 18:10471225-10471247 AGGAGCACAGCATCAGAGCCAGG + Intronic
1157316532 18:46594448-46594470 AGGGGCACAGAATCACCACCTGG + Intronic
1157823115 18:50788307-50788329 AGGGGCACAGTGCCCCAGCCTGG + Intergenic
1166008987 19:39927286-39927308 AGGGCCACGCCCTCACAGCCTGG + Exonic
1166222570 19:41375171-41375193 AGGGCCACAGGAACACAGCCCGG + Intronic
1166258011 19:41619752-41619774 AGGGTCACGGAAGCCCAGCCTGG + Intronic
1167353231 19:48988756-48988778 AGGCACAAGGTATCACATCCCGG + Intronic
928028838 2:27761706-27761728 AGGGGCCAGGTCTCATAGCCAGG - Intergenic
937869785 2:126778713-126778735 AGAGGCACAGGATCCCAGCCAGG + Intergenic
940853050 2:158706322-158706344 AGGGGCACAGCATCACAGGAAGG + Intergenic
942193199 2:173491955-173491977 TGGGGCATGGTGGCACAGCCAGG + Intergenic
947860210 2:233353251-233353273 AGGGGCATGGGCTCACGGCCAGG - Intergenic
948840571 2:240646920-240646942 AGGGTCACGGGAGCTCAGCCTGG - Intergenic
1172343510 20:34178468-34178490 AGAGACAGGGTCTCACAGCCAGG - Intergenic
1173625210 20:44467368-44467390 AGGGGCCCTGGATCCCAGCCTGG - Intergenic
1174111527 20:48201101-48201123 AGGGTCAGGGTGGCACAGCCTGG - Intergenic
1175180285 20:57142038-57142060 AGGGGCTCGGTCACTCAGCCTGG + Intergenic
1177950560 21:27530564-27530586 AGGGGCACAGAAGCTCAGCCTGG + Intergenic
1178303995 21:31475194-31475216 AGGTGCACATTATCACATCCAGG + Intronic
1180246078 21:46548228-46548250 AGGGGGAGGGTGGCACAGCCAGG + Intronic
1180484736 22:15784568-15784590 AGGGGCAGGGGAGCACACCCTGG + Intergenic
1181513111 22:23397607-23397629 TGGGGCACGCTCTCTCAGCCAGG - Intergenic
950490332 3:13300756-13300778 TTGGGCACAGTATCTCAGCCAGG + Intergenic
954075225 3:48173590-48173612 TGGGGCACTGTATGACAGCTGGG - Intronic
957246445 3:77722521-77722543 AAGGGCACTGTAGCACACCCTGG - Intergenic
960057748 3:113287240-113287262 AGGGGCACGGTATCACAGCCTGG + Exonic
967115741 3:186336121-186336143 AGTGGTACGGTATAAAAGCCTGG + Intronic
968814153 4:2813016-2813038 AGGGGCAGGGTGGCCCAGCCTGG - Intronic
973140399 4:46760526-46760548 AGGGGCAGGGTATCACACACTGG + Intronic
978202988 4:106045100-106045122 AGGGCCACTGTACCCCAGCCTGG - Exonic
978514895 4:109559739-109559761 AGGGGCCCGGCACCGCAGCCCGG + Intergenic
998152421 5:139764931-139764953 AGGGGCACTGAGGCACAGCCAGG + Intergenic
998913745 5:146992587-146992609 AGGGGCACCTTATCACCGCCAGG + Intronic
1006180413 6:32150609-32150631 CGGGGCAAGGTAGCGCAGCCGGG + Exonic
1007277740 6:40687969-40687991 AGAGGCACTGCATCACAGACGGG - Intergenic
1007663784 6:43502689-43502711 AGGGGCACAGGGTAACAGCCAGG - Intronic
1012177725 6:96109874-96109896 AGGGGAAGGGTAAGACAGCCAGG - Intronic
1017066739 6:150536046-150536068 AGGGGCACTGGGTCACATCCTGG + Intergenic
1019140710 6:169940594-169940616 AGGGGCCCGGGGTCAGAGCCTGG + Intergenic
1021294666 7:18889838-18889860 TTGGGCATGGTATCACAGGCCGG - Intronic
1026849637 7:73716889-73716911 AGGGCCAGGGTCACACAGCCAGG - Intronic
1032202153 7:129829650-129829672 CGGGGCACTGTTTCGCAGCCTGG + Intergenic
1032834028 7:135656933-135656955 AGGCGCACATCATCACAGCCAGG + Intergenic
1048265712 8:132983902-132983924 AGGTGCCCGGTAACATAGCCTGG + Intronic
1049381698 8:142319506-142319528 AGGGCAACGGTACCCCAGCCCGG + Intronic
1053593539 9:39535290-39535312 AGGGCCACGGTACTCCAGCCTGG + Intergenic
1061424688 9:130491597-130491619 AGGGGCACGGCGGCACAGACAGG + Intronic
1061758572 9:132833672-132833694 AGGGGTATGGTATCACAGGAGGG + Intronic
1190029670 X:46959798-46959820 AGGGGCAGAGTATCACAGGTAGG + Intronic
1190839436 X:54130666-54130688 AGGGGCACCTCATTACAGCCTGG + Intronic
1196719772 X:118842556-118842578 AGAGACAGGGTTTCACAGCCAGG + Intergenic
1200391253 X:155949158-155949180 AGGGGCACTGGAACAAAGCCTGG - Intergenic