ID: 960065035

View in Genome Browser
Species Human (GRCh38)
Location 3:113362385-113362407
Sequence CTGCAGCAGCTTGATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960065031_960065035 14 Left 960065031 3:113362348-113362370 CCTTTCTGCTGGTAGTAGCAGGC 0: 1
1: 1
2: 2
3: 23
4: 125
Right 960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 340
960065029_960065035 15 Left 960065029 3:113362347-113362369 CCCTTTCTGCTGGTAGTAGCAGG 0: 1
1: 1
2: 4
3: 15
4: 188
Right 960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 340
960065028_960065035 20 Left 960065028 3:113362342-113362364 CCACTCCCTTTCTGCTGGTAGTA 0: 1
1: 1
2: 2
3: 11
4: 204
Right 960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960065035 Original CRISPR CTGCAGCAGCTTGATGTGGA GGG Intronic
900103365 1:972094-972116 CTCCTCCAGGTTGATGTGGACGG - Exonic
900405109 1:2489574-2489596 CTGCAGCAGCGTGAAGGGAAAGG - Intronic
900593417 1:3469691-3469713 GCGCTGCACCTTGATGTGGATGG + Intronic
900671401 1:3857103-3857125 CCGCAGCAGCTTGGGGTGCAAGG - Exonic
900889129 1:5436675-5436697 TTTCAGGAGTTTGATGTGGAAGG - Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902990143 1:20181794-20181816 GTGCACTAGTTTGATGTGGATGG - Intergenic
903124683 1:21239639-21239661 CTGGTGCAGCTGGGTGTGGACGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
904269032 1:29337008-29337030 CTGCAGAAGAGTCATGTGGATGG + Intergenic
905770857 1:40637005-40637027 CTGGAGGAACTTGATGGGGAGGG + Intronic
906723625 1:48027556-48027578 CTGCATCAGCTGGATTTGGTGGG - Intergenic
907200737 1:52724734-52724756 CTGGAGCTTCTTGATGGGGATGG + Intergenic
907288828 1:53399616-53399638 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
907627998 1:56050117-56050139 CATCAGTAGCTTGATGGGGATGG - Intergenic
907883956 1:58576536-58576558 CTGCCGCAGCTCGATCTGGATGG + Exonic
907994438 1:59615098-59615120 CATCAGTAGCTTGATGGGGATGG - Intronic
908356105 1:63326057-63326079 ATGAAACATCTTGATGTGGAAGG + Intergenic
909043055 1:70676486-70676508 CTGAAGCATCCTGATGGGGAAGG + Intergenic
909110127 1:71464806-71464828 CTGCAGCGTCTTGGTGTTGAAGG + Intronic
910746472 1:90580319-90580341 CTGCAGCAGCTGCAGGGGGAGGG - Intergenic
911891884 1:103381779-103381801 CTGTGGTAGCTTGATGGGGATGG - Intergenic
913217238 1:116630915-116630937 CTGCAGCAGTTTGACATTGATGG + Intronic
913500962 1:119472251-119472273 CAGAAGCAGCTAGATGTTGAGGG - Intergenic
914992974 1:152514626-152514648 AGGCAGCAGATAGATGTGGAAGG + Intronic
915038347 1:152947210-152947232 CTGGAGCAGATAGGTGTGGAGGG - Intergenic
915233188 1:154461324-154461346 CTCCACCAGCTTCTTGTGGAAGG - Intronic
916660355 1:166917798-166917820 CTGCATCAGCTGGAAGTTGACGG + Exonic
919599600 1:199606266-199606288 CAGTAGTAGCTTGATGGGGATGG - Intergenic
919891507 1:201978721-201978743 GTTCTGCAGCTTGGTGTGGATGG - Intergenic
919963611 1:202498232-202498254 CTGTTGCAGTTTGATGTGAAAGG + Intronic
920147290 1:203872848-203872870 CTCCAGCAGCTTCATGTAGGTGG + Intergenic
920811574 1:209290901-209290923 CTGCTGCTGCTTGATGTGTCTGG - Intergenic
921828420 1:219700168-219700190 TTTCAGCAGCGTGATGGGGATGG - Intronic
922006619 1:221537336-221537358 CTGAAGCAGCATGATGTAGTAGG + Intergenic
922175527 1:223194224-223194246 CTGCAGCATCTCGTGGTGGAAGG + Intergenic
922861172 1:228818158-228818180 CTGCAGCAGGGAGGTGTGGATGG + Intergenic
924953916 1:248909482-248909504 CTGCAGCAGGTTGAGATGGACGG + Intronic
1062846664 10:712289-712311 CTGCAGGAGGCTGACGTGGAAGG + Intergenic
1063146607 10:3300698-3300720 CTGTAGCAACCTGCTGTGGACGG - Intergenic
1064618605 10:17191436-17191458 CTGCAGATGCTTTATCTGGAAGG + Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1066481281 10:35798101-35798123 CAGCAGGAGCCTGATGAGGAGGG + Intergenic
1066695576 10:38074787-38074809 CTTCCTCAGCTTGGTGTGGACGG + Intergenic
1067004361 10:42646947-42646969 CTCCAGCAGCTGCCTGTGGAGGG + Intergenic
1067053103 10:43036554-43036576 GTGGAGCAGCATGATCTGGAAGG + Intergenic
1067427028 10:46218210-46218232 CTGCAGCAGCCAGAGGTTGAAGG - Intergenic
1069078816 10:64066246-64066268 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1069914829 10:71781008-71781030 CTGCAGCAGGAGGTTGTGGAGGG + Intronic
1070170769 10:73931210-73931232 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1070586917 10:77773342-77773364 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1072205097 10:93196686-93196708 TTGCAGCAGCATCGTGTGGACGG - Intergenic
1072304938 10:94098014-94098036 CTGAAGTAGCCTGATTTGGAAGG + Intronic
1072818993 10:98537758-98537780 CTCCACCAGCTTCTTGTGGAAGG + Intronic
1072914125 10:99526810-99526832 CTGCAGATGTTTGATGTGAAGGG - Intergenic
1073342891 10:102759099-102759121 CTCCACCAGCTTCTTGTGGAAGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075902242 10:126052235-126052257 CTGCTGCAGCTGCCTGTGGAAGG + Intronic
1076422303 10:130340103-130340125 CTGCAGCAGCTGGAACTGGCTGG + Intergenic
1076607978 10:131701695-131701717 CTGCAGCAGTGTGAGCTGGAGGG + Intergenic
1076876758 10:133220040-133220062 CTCCAGCTGCTGGATGTGCATGG - Exonic
1077164624 11:1129508-1129530 CTGCAGCAGCTGGACGGGGTCGG - Intergenic
1077357339 11:2124535-2124557 CTGCAGCAGGAAGAGGTGGAGGG - Intergenic
1078555108 11:12318743-12318765 CTGCATCATGTTGATGTGTAGGG + Intronic
1078753688 11:14188653-14188675 TGGCAACAGCATGATGTGGAGGG + Intronic
1079237798 11:18702069-18702091 CTGCAGGAGCTGGATCAGGATGG + Exonic
1079825826 11:25191526-25191548 CATCAGTAGCTTGATGGGGATGG - Intergenic
1080070887 11:28085299-28085321 CTCCACCAGCTTCCTGTGGAAGG + Intronic
1080300465 11:30778998-30779020 CTGCAGAAGATTGATAGGGAAGG - Intergenic
1080608962 11:33887489-33887511 ATGCAGCATCTTATTGTGGAAGG + Intronic
1082080818 11:48011253-48011275 CTGCACAGGCTTGATCTGGATGG - Intronic
1083780095 11:64913308-64913330 CTGCAGCAGCTTGTGCAGGAAGG + Exonic
1083875564 11:65522347-65522369 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1085336905 11:75703324-75703346 CTGCAGGAGCTGGATGTGCCTGG - Intergenic
1087901491 11:103646448-103646470 CTTCAGCAGCTTTCTGTGGGGGG + Intergenic
1087911667 11:103761026-103761048 CATCAGTAGCTTGATGGGGATGG - Intergenic
1088430677 11:109755245-109755267 CTGGAGTACCTTGATGTGGCAGG + Intergenic
1088763789 11:112957579-112957601 CTCCAGCAGTGTGATGTTGAAGG - Intergenic
1089822697 11:121242108-121242130 CTGCAGCAGGGAGATGTGGCTGG - Intergenic
1091088985 11:132751356-132751378 CTGCAGCACCCTGCTGTAGATGG - Intronic
1094182119 12:27603219-27603241 CTGCTGCAGCTAGAAGTGGCAGG - Intronic
1094387839 12:29914487-29914509 CATCGGCAGCTTGATGGGGATGG - Intergenic
1095506026 12:42899274-42899296 CTGCAGAAAGTTGATGGGGAAGG - Intergenic
1096497642 12:52047636-52047658 CTGCAGCAGCTTGGGGAGGTGGG + Intronic
1097042793 12:56165637-56165659 CTTCAGCTGCTCCATGTGGAAGG + Exonic
1097277456 12:57823080-57823102 CTGCAGCAGCTGGCTGGAGAAGG + Exonic
1098012632 12:66071140-66071162 CAGCAGCATCCTGAGGTGGAGGG - Intergenic
1099720953 12:86360935-86360957 CATCAGTAGCTTGATGGGGATGG - Intronic
1100980128 12:100157044-100157066 CTCCAGCAGCTTCACCTGGAGGG + Intergenic
1101417435 12:104520668-104520690 CTGCACCAGCTTGATGCTCAGGG - Intronic
1105855605 13:24369208-24369230 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1107022799 13:35768330-35768352 CTGCAGCAGCAGCCTGTGGATGG + Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1107534465 13:41314562-41314584 CAGCAGGGGCTGGATGTGGAAGG - Intronic
1110459035 13:75723964-75723986 CTGCAACCTCTTGTTGTGGAAGG + Intronic
1111215274 13:85133128-85133150 CTCCAGCAGCTTCTTGTGGGAGG - Intergenic
1111261479 13:85746078-85746100 CTGCAGCAGTTTAATTAGGAAGG - Intergenic
1111374763 13:87364276-87364298 CATCAGTAGCTTGATGGGGATGG + Intergenic
1114693671 14:24607612-24607634 CTGCAGTAGCATGATGTCGTTGG + Exonic
1114696616 14:24632324-24632346 CTGCAGTAGCATGATGTCGTTGG + Exonic
1115086834 14:29525840-29525862 CTCCAGCAGCTTGTCTTGGAAGG + Intergenic
1116096589 14:40378102-40378124 CATCGGCAGCTTGATGGGGATGG + Intergenic
1118334008 14:64836348-64836370 GTGCAGCAGCTTTATGTGTTAGG - Intronic
1119309549 14:73634406-73634428 CTGCAGCGGCGTTAGGTGGATGG - Intergenic
1119427049 14:74542489-74542511 CTGCAGCAGGGAGATGTGAAAGG + Intronic
1119568442 14:75648564-75648586 ATGCATCAGCTTGCTGTGGCTGG + Intronic
1119718758 14:76876980-76877002 CTGCAGCTACTAGATGTGGCAGG - Intergenic
1120920022 14:89746212-89746234 CTGCAGAAGCCTCATATGGAGGG - Intergenic
1123473709 15:20572311-20572333 CTCCAGCAGCTTCACCTGGAGGG - Intergenic
1123644300 15:22428042-22428064 CTCCAGCAGCTTCACCTGGAGGG + Intergenic
1123665608 15:22607941-22607963 CTCCAGCAGCTTCACCTGGAGGG + Intergenic
1123734009 15:23167322-23167344 CTCCAGCAGCTTCACCTGGAGGG - Intergenic
1123752148 15:23364711-23364733 CTCCAGCAGCTTCATCTGGAGGG - Exonic
1124227163 15:27904262-27904284 CTGCAGCAGATTCAGGTGGACGG + Intronic
1124284512 15:28388633-28388655 CTCCAGCAGCTTCACCTGGAGGG - Exonic
1124298185 15:28522981-28523003 CTCCAGCAGCTTCACCTGGAGGG + Exonic
1124319433 15:28702355-28702377 CTCCAGCAGCTTCACCTGGAGGG + Exonic
1124483083 15:30093076-30093098 CTCCAGCAGCTTCACCTGGAGGG - Exonic
1124489531 15:30145144-30145166 CTCCAGCAGCTTCACCTGGAGGG - Exonic
1124520500 15:30404142-30404164 CTCCAGCAGCTTCACCTGGAGGG + Exonic
1124538157 15:30562077-30562099 CTCCAGCAGCTTCACCTGGAGGG - Exonic
1124544623 15:30614138-30614160 CTCCAGCAGCTTCACCTGGAGGG - Exonic
1124564578 15:30801567-30801589 CTCCAGCAGCTTCACCTGGAGGG - Intergenic
1124753996 15:32393183-32393205 CTCCAGCAGCTTCACCTGGAGGG + Exonic
1124760496 15:32445508-32445530 CTCCAGCAGCTTCACCTGGAGGG + Exonic
1124778140 15:32603554-32603576 CTCCAGCAGCTTCACCTGGAGGG - Exonic
1126207580 15:46062685-46062707 CTGCTGGAGCTTGATGTGCGTGG + Intergenic
1126804398 15:52331742-52331764 CTGCTGCAGCATGAGGTGGACGG - Intronic
1127417064 15:58768617-58768639 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
1127772527 15:62243166-62243188 CTCCAGCAGCTTCACCTGGAGGG + Intergenic
1128631180 15:69269129-69269151 CTGCAACTGATTGATGTGGGTGG - Exonic
1129539811 15:76340513-76340535 CTGCAGCTGCTTCATGAGAATGG - Exonic
1131831598 15:96358268-96358290 GTGCAGCGGCTGCATGTGGAAGG - Intergenic
1132019906 15:98351879-98351901 CTGCAGCTGGGTGATGTGGCTGG - Intergenic
1132184654 15:99792561-99792583 CTCCAGCAGCTTCACCTGGAGGG - Intergenic
1132432328 15:101772094-101772116 CTCCAGCAGCTTCACCTGGAAGG + Intergenic
1132495510 16:261446-261468 CTGCAGGTGCCTGATGTGGACGG + Exonic
1132510447 16:338331-338353 CTGCAGCAGCTGTTTCTGGAGGG - Intronic
1132846597 16:2003672-2003694 CTGCAGCTGGTGGATGGGGATGG + Exonic
1135198869 16:20419366-20419388 CACCAGCAGCTTGGTCTGGAGGG - Exonic
1136367220 16:29814345-29814367 CTGCAGCAGGGGGACGTGGACGG + Exonic
1138470908 16:57235381-57235403 AAGCAGCTGCTTGATGTGGAAGG + Intronic
1139205686 16:65026263-65026285 CTGCAGCATCTTGATGAGGTGGG + Intronic
1139476057 16:67203143-67203165 CTGCAGCAGCTTGTGGTTGGGGG - Exonic
1139604070 16:68005447-68005469 AGGCAGCAGCTGGAAGTGGAGGG - Intronic
1140665044 16:77219684-77219706 TTCCATCAGCTTGATGTGGCAGG - Intergenic
1140761319 16:78111606-78111628 CTCCACCAGCTTCTTGTGGAAGG + Intronic
1141536496 16:84684721-84684743 CTGCAGCATCCTGTTCTGGATGG + Intergenic
1142397432 16:89840166-89840188 CTCCAGCAGCTTCAAGAGGAAGG - Intronic
1143271406 17:5678228-5678250 CTGGAGCACCTTGCTATGGAAGG - Intergenic
1143452980 17:7047285-7047307 CTCCAGCAGCTTCTTGTGGAAGG - Intergenic
1143459428 17:7091850-7091872 CTCCATCAGCTTCTTGTGGAAGG - Intergenic
1143499990 17:7333096-7333118 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1144783826 17:17821059-17821081 GTCCTGTAGCTTGATGTGGATGG + Intronic
1147055781 17:37833760-37833782 CAGCAGCAGCTCAATTTGGAGGG + Intergenic
1148002481 17:44397918-44397940 CTGCGGCAGCATGATGTTGTAGG + Exonic
1151209553 17:72534129-72534151 TTGCAGGAGATGGATGTGGAAGG - Intergenic
1151750930 17:76037156-76037178 CTGCAGCATCGTGAGGGGGACGG - Intergenic
1151906481 17:77052684-77052706 CTGCAGCAGGTTGGTTGGGAGGG + Intergenic
1152206838 17:78978702-78978724 CTGCAGCAGAGTGAAGTGGCTGG - Intronic
1153112442 18:1608304-1608326 CAGTAGTAGCTTGATGGGGATGG + Intergenic
1154285919 18:13056469-13056491 CTGCAACAGCTGGATAGGGAAGG - Exonic
1156658215 18:39312736-39312758 TTGAAGCAGCTTAATGTTGAAGG + Intergenic
1161588092 19:5116457-5116479 CTGCAGCAGCTTCCTGAGAAAGG - Intronic
1161698603 19:5783542-5783564 CTGCAGCTCCTTGACGGGGAAGG + Exonic
1161699752 19:5788087-5788109 CTGCAGCAGGTTGGTGCAGACGG + Exonic
1161870932 19:6869381-6869403 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
1162254117 19:9473907-9473929 GTGCATCAAATTGATGTGGAAGG + Intronic
1162403788 19:10461583-10461605 CTGCAGCAGCTTGAAGCCCACGG - Exonic
1163232580 19:16014563-16014585 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1163235936 19:16030620-16030642 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1164522104 19:28987521-28987543 GTGCAGTAGCCTGATGTGCAGGG + Intergenic
1165370487 19:35402591-35402613 CTGCAGCAGGTTGAACTGTAAGG + Intergenic
1166251313 19:41572914-41572936 CTTCACCAGATTGATGTTGAGGG - Intronic
1167697960 19:51026038-51026060 CCCCAGCAGCTTGGGGTGGAAGG + Intronic
1168058600 19:53877835-53877857 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1168084724 19:54037178-54037200 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
1168249939 19:55136231-55136253 CAGCAGCAGCTTCCTGTGGAGGG - Intronic
1168726377 19:58584627-58584649 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
926000937 2:9331915-9331937 CTGCAGAAGCTTGCAGAGGAGGG + Intronic
927173115 2:20387015-20387037 CTGCAGCATCATGTGGTGGAAGG - Intergenic
927865327 2:26584227-26584249 CTGCAGCACCAGGAAGTGGAAGG + Intronic
931085233 2:58822884-58822906 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
931845488 2:66199581-66199603 CTGCTGCAGCTTCAGTTGGAGGG - Intergenic
933693407 2:85196953-85196975 CTGCGGCAGGTTGGTGTGGCTGG - Intronic
938408518 2:131045812-131045834 CTGCAGCAGCCTGAAGAGGGGGG - Intronic
939439352 2:142224235-142224257 TGGCAGAAGCTTGAGGTGGAGGG - Intergenic
939635956 2:144582852-144582874 CTGCCGAAGGTTGATATGGACGG + Intergenic
939820471 2:146950659-146950681 CTGGAGCTGCTTGATTTGGAAGG + Intergenic
939940406 2:148343072-148343094 CTGCAGCAACATGATGTAGCTGG - Intronic
940286484 2:152037946-152037968 CTGCAACAGCTGGATGCAGAAGG + Intronic
941664608 2:168231878-168231900 CTGCAGCAGCTTGATGTGGGGGG + Intronic
942276032 2:174324708-174324730 CTGCAGCTGCCTGATTTGGAAGG - Intergenic
942480695 2:176385240-176385262 CTGAAACATCTGGATGTGGAAGG - Intergenic
942964044 2:181867820-181867842 CTCCAGCAACTAGATGTGGGAGG + Intergenic
943115402 2:183663618-183663640 CTGAAACAGCTTGATGGAGAGGG + Intergenic
943243364 2:185415872-185415894 CAACTGCAGCTTGATGTAGATGG + Intergenic
944000087 2:194823652-194823674 CTGCTAAAGCTTGATGGGGAGGG - Intergenic
944763424 2:202840595-202840617 CTCCAGCAGCTTCCTGTAGATGG + Intronic
944932361 2:204532736-204532758 CTGTAGGAGATAGATGTGGAAGG + Intergenic
945491133 2:210456659-210456681 CTGCAGATGCGTGATATGGATGG - Intronic
946161433 2:217838343-217838365 CTGCAGCAGCTTGGGGTGCAGGG + Intronic
946240891 2:218354989-218355011 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
946366136 2:219250223-219250245 CAGCAGCAGCATGAAGGGGAAGG + Exonic
947530453 2:230905814-230905836 CTCCAGGAGCTTGAAGTGGAAGG - Intergenic
947974348 2:234352174-234352196 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948481456 2:238253038-238253060 CTGCAGCAGGTTGAGCTGCAGGG + Exonic
1171184683 20:23116896-23116918 GAGCAGCAGCCTGATTTGGAGGG - Intergenic
1171560312 20:26118746-26118768 CTGCAACTGCTTCAGGTGGAAGG + Intergenic
1171877708 20:30593827-30593849 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1172062062 20:32193440-32193462 CTGCATCATCTTGAGGTGGGAGG - Exonic
1172754434 20:37273301-37273323 CTGCAGTAGATGGATGAGGAAGG + Intergenic
1174627753 20:51929171-51929193 CTGCAGCCGCTTCCCGTGGAGGG - Intergenic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1178179691 21:30145478-30145500 CAGCAGTAGCTGGATCTGGATGG + Intergenic
1178888270 21:36499205-36499227 CTTCAGCACTTTGATGTGAATGG + Intronic
1179245701 21:39632445-39632467 TTGCAGAAGCTTGATTTGGAAGG + Intronic
1179275986 21:39892010-39892032 CTCCACCAGCTTCTTGTGGAAGG - Intronic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179970233 21:44832780-44832802 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
1180818598 22:18809315-18809337 CTGCAGCAGTTTGACATTGATGG + Intergenic
1181204821 22:21243770-21243792 CTGCAGCAGTTTGACATTGATGG + Intergenic
1182165429 22:28168270-28168292 CTGTGGTAGCTTGATGGGGATGG - Intronic
1182179819 22:28335397-28335419 CTGTGGTAGCTTGATGGGGATGG + Intronic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1183968801 22:41460354-41460376 CTGCAGCAGACTGATGTTGGGGG + Exonic
1185112452 22:48908181-48908203 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1203222104 22_KI270731v1_random:51645-51667 CTGCAGCAGTTTGACATTGATGG - Intergenic
1203268727 22_KI270734v1_random:35168-35190 CTGCAGCAGTTTGACATTGATGG + Intergenic
949450420 3:4179134-4179156 CAGCGGTAGCTTGATGGGGATGG - Intronic
950200357 3:11037945-11037967 CGGCAGCAGCTTGGGGTGGGTGG - Exonic
950242707 3:11386054-11386076 CTGCAGCAGGGTGGTGTGGAGGG + Intronic
950396665 3:12738765-12738787 CTACAGCAGCTTTCTGTGGCTGG - Intronic
950971749 3:17196203-17196225 CAGCAGCATCTTGAGATGGAGGG - Intronic
952651273 3:35729475-35729497 CTGTTGCAGCTTCAAGTGGAAGG - Exonic
953422373 3:42764511-42764533 CTGCAGCATCTGGAGGTGGCAGG - Intronic
953454191 3:43029124-43029146 CAGCAGCAGCTTCAGGTGGATGG + Intronic
954311866 3:49775636-49775658 CTGCAGCAGCTTGATGTTGTGGG - Intronic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
955082709 3:55672825-55672847 CTGCAGGAGCTTTATGTAGCTGG - Intronic
955216075 3:56985926-56985948 CAGCAGCAGCCTGTTGTAGAGGG - Intronic
958039154 3:88205804-88205826 CTGCAGCAGATTAGTGTAGATGG - Intergenic
958459546 3:94377509-94377531 ATGCATCAGCATTATGTGGAGGG + Intergenic
959679010 3:109071522-109071544 CTGCAGCACTGTGATGTCGAAGG - Intronic
960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG + Intronic
962434649 3:135355208-135355230 CTGCAGCAGCTTGGAGAGGGTGG + Intergenic
962691274 3:137901194-137901216 CATTAGCAGCTTGATGGGGATGG - Intergenic
962906783 3:139810850-139810872 CTGCAGCAGCCTGATGGCCAGGG - Intergenic
963405162 3:144854109-144854131 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
965867148 3:173217656-173217678 CTGCTGCAGGGTGATGGGGAGGG + Intergenic
966223776 3:177576520-177576542 CTGCAGGATATTGATGTGAATGG + Intergenic
966962627 3:184955143-184955165 CTCCACCAGCTTCTTGTGGAAGG + Intronic
967585054 3:191203200-191203222 ATGGAGCAGCCTTATGTGGAAGG - Intronic
969474841 4:7416006-7416028 ATGTAGCAGCCTGGTGTGGAGGG + Intronic
969963069 4:10965585-10965607 CTGGAGCAACTTCATTTGGAAGG + Intergenic
969997048 4:11324030-11324052 CTGCAGTGGCTGGATGTGCATGG - Intergenic
971876974 4:32319485-32319507 TTGCAGCAGCTTGCTCTAGATGG + Intergenic
974566915 4:63590005-63590027 ATGCTGCAGCTTGATGGGGGAGG + Intergenic
974897414 4:67956204-67956226 TTGCTACAGCTTGATGTGGTAGG + Intronic
975496123 4:75037675-75037697 CAGCAGCAGTGTGGTGTGGAGGG + Intronic
975939497 4:79625426-79625448 CAGAAGCAGCTTCATGTTGATGG - Intergenic
976367569 4:84247222-84247244 CTGCATCATCTTGAGGTGGGAGG + Intergenic
976827253 4:89274707-89274729 GTGCAGCAGAATGATCTGGAAGG + Intronic
976845214 4:89481253-89481275 CTGCATCAGTTTGCTGAGGATGG - Intergenic
976991925 4:91378292-91378314 CAGTGGTAGCTTGATGTGGATGG + Intronic
978293445 4:107174445-107174467 CTGGACAAGCTTGATGTAGAAGG - Intronic
979116046 4:116825903-116825925 CTGTAGCATGTTGATGTGGTAGG - Intergenic
979729746 4:124009931-124009953 CATCAGTAGCTTGATGGGGATGG + Intergenic
980062836 4:128150534-128150556 CTTCAGGAGGCTGATGTGGAAGG - Intronic
981038003 4:140192083-140192105 CTTCAGGAGCTTGATGAGGTTGG + Intergenic
982278979 4:153664824-153664846 CTGCAGCAGATGCATCTGGATGG + Intergenic
984131204 4:175878072-175878094 TTGCACCAGTGTGATGTGGATGG - Intronic
984414168 4:179435697-179435719 CTGCATCATCGTGACGTGGAAGG - Intergenic
986309432 5:6541237-6541259 CTGCAGCAAATGGAAGTGGAGGG + Intergenic
986912661 5:12575938-12575960 CATCAGTAGCTTGATGGGGATGG - Intergenic
989344886 5:40418743-40418765 CATCAGTAGCTTGATGGGGACGG + Intergenic
992517109 5:77505476-77505498 CATCAGTAGCTTGATGGGGATGG - Intronic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
999001904 5:147932836-147932858 TTGAAGCAGCTTTATGTGGTAGG - Intergenic
999055177 5:148567166-148567188 TTGTAGCAGCTTCAGGTGGATGG - Intronic
999325838 5:150642779-150642801 CTGCAGGAGCTTGCCTTGGAGGG + Intronic
999864909 5:155690573-155690595 CTTAAGCAGCTTTATGTGTAAGG - Intergenic
1000574748 5:162964405-162964427 ATGCTGCAGCTTGGTGTGGGGGG - Intergenic
1001226340 5:169947578-169947600 AAGCATCAGCTTAATGTGGAGGG - Intronic
1001559081 5:172657737-172657759 CTCCACCAGCTTCTTGTGGAAGG + Intronic
1002058475 5:176612142-176612164 CGGCACCAGCTGGAGGTGGATGG - Intergenic
1005836247 6:29711595-29711617 CTGAGGCAGCTTGATCTGCAGGG + Intergenic
1006313078 6:33275145-33275167 CTGCATCAGCTTGGAGTGGCAGG + Intronic
1006368729 6:33631682-33631704 CTCCACCAGCTTCTTGTGGAAGG - Intronic
1006735473 6:36269960-36269982 CCGCAGCAGCATGTTGGGGAGGG + Intronic
1007597944 6:43063115-43063137 CTGCGGCAGTATGATGAGGATGG + Exonic
1007656525 6:43454475-43454497 CTGCAAGAGATTGATGTGGGAGG + Intronic
1011283071 6:85696328-85696350 CATCAGTAGCTTGATGGGGATGG + Intergenic
1011298528 6:85849435-85849457 CATCAGTAGCTTGATGGGGATGG + Intergenic
1011559915 6:88603801-88603823 CTGCAGAAGCATGATAGGGATGG - Intergenic
1011932389 6:92730457-92730479 CCTCAGTAGCTTGATGGGGATGG + Intergenic
1012245403 6:96920478-96920500 GTCCAGCACCTTGATGTGTATGG + Intergenic
1013650018 6:112185481-112185503 CTGCTGCAGCCTGATATGAAGGG + Intronic
1018280413 6:162179496-162179518 CTGCAGCAGGCTGAAGGGGAAGG - Intronic
1018717044 6:166541383-166541405 CTTCAGCAGCTCTTTGTGGAGGG + Intronic
1019052939 6:169198360-169198382 CTGCAGCAGCGTGATGGAGCTGG + Intergenic
1019218292 6:170457515-170457537 CAGCAGCTGCTGGGTGTGGAGGG - Intergenic
1019423217 7:961199-961221 CTCCACCAGCTTCTTGTGGAAGG - Intronic
1020131886 7:5563298-5563320 CTGCCCCAGCCTGAGGTGGAGGG - Intronic
1021808369 7:24378855-24378877 GAGCAGCAGCTTGATTTAGAGGG + Intergenic
1023788740 7:43735123-43735145 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1024456538 7:49614883-49614905 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
1024934381 7:54698111-54698133 CTGCAGAGGCTTGGGGTGGACGG + Intergenic
1024953006 7:54884587-54884609 CTGCAGGAGGCTGATGTGGGAGG + Intergenic
1024985639 7:55191322-55191344 TTGCACCAGCTTGGTGAGGAGGG + Intronic
1026177972 7:68014443-68014465 CTGCAGCAGATGGATGTCGACGG + Intergenic
1026870109 7:73845806-73845828 CTCCAGCAGCTTCTTGTGGAAGG + Intergenic
1027046393 7:74994094-74994116 CTGCGGCTGCCTGTTGTGGACGG - Intronic
1028348069 7:89808125-89808147 CTCCAGTAGATTCATGTGGATGG - Intergenic
1029386588 7:100247514-100247536 CTGCTGCTGCCTGTTGTGGATGG + Intronic
1029485320 7:100836548-100836570 GGGCAGCAGCTGGATGTGGAAGG - Intronic
1034091515 7:148368559-148368581 CTGCAGCACCTTGCTATGGCTGG - Intronic
1034574860 7:151988045-151988067 CTGCAGCAGGTTCTTGTGAAGGG + Intronic
1034820954 7:154215838-154215860 CTGCAGCTGACTGATATGGAGGG + Intronic
1035990687 8:4486990-4487012 CCTCAGCACCTCGATGTGGAAGG - Intronic
1036601040 8:10260356-10260378 CTGCAGGAGCCTGAGATGGATGG + Intronic
1038484150 8:27921749-27921771 CTGCAGCCGCGTGCGGTGGAGGG + Exonic
1039342628 8:36667943-36667965 CAGCGGTAGCTTGATGGGGACGG + Intergenic
1044440424 8:92217607-92217629 CACCGGCAGCTTGATGGGGATGG + Intergenic
1046292194 8:112177678-112177700 CAGCAGCAGTTTGATGTGCTAGG + Intergenic
1046881299 8:119311366-119311388 CATCAGTAGCTTGATGGGGATGG - Intergenic
1047655738 8:126974976-126974998 CTGCAGCAGGTCAATGAGGAAGG - Intergenic
1049140595 8:140950469-140950491 CTACAGCAGCTGGCTGTGCAAGG + Intronic
1049687505 8:143944795-143944817 CAGCAGCAGCTTGTGGGGGAGGG + Intronic
1049768251 8:144365757-144365779 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
1051830804 9:21274006-21274028 CATCAGTAGCTTGATGGGGATGG - Intergenic
1052492343 9:29185749-29185771 ATGAAGCAGCAAGATGTGGAAGG - Intergenic
1053208357 9:36206963-36206985 CTGCAGTAGCTAGATGTTAAGGG + Intronic
1056386542 9:86101563-86101585 CTGCATCAGCCTGTGGTGGAAGG + Intergenic
1056792104 9:89632769-89632791 ATGCAGCAGCGTCTTGTGGATGG + Intergenic
1057221384 9:93259572-93259594 CTGGAGCAGCTTGTTCAGGAAGG - Exonic
1058294940 9:103294576-103294598 CTCCACCAGCTTCTTGTGGAAGG - Intergenic
1059743804 9:117180915-117180937 GTTCTGCAGCTTGGTGTGGATGG + Intronic
1060552722 9:124493123-124493145 CTGCAGCAGCGTCATCTGGTCGG + Exonic
1061062459 9:128257511-128257533 CTCCAGCAGCTTCACCTGGAGGG + Exonic
1061958523 9:133976266-133976288 CTGCAGCAGCTAGGTTAGGATGG + Intronic
1062282983 9:135760193-135760215 CTGCTGCACCTGGCTGTGGATGG - Intronic
1203492339 Un_GL000224v1:118981-119003 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203504962 Un_KI270741v1:60853-60875 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1186008116 X:5096815-5096837 CTGCAGCAGCTTGGTTTGCTGGG - Intergenic
1187209325 X:17213612-17213634 ATGCAGGAGGTTGAGGTGGAAGG - Intergenic
1187672967 X:21686861-21686883 CTCCACCAGCTTCTTGTGGAAGG + Intergenic
1188053219 X:25511890-25511912 AAGCAGCAGCTAGAAGTGGAAGG - Intergenic
1189078278 X:37941252-37941274 CTGCACAAGCTGGATGTGGTGGG - Intronic
1190051900 X:47156778-47156800 CTGCAGCAGCATGATGGGCCAGG - Intronic
1190650514 X:52564135-52564157 AGGCAGCAGCTTGAGGAGGATGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191968773 X:66790580-66790602 CATCAGTAGCTTGATGGGGATGG + Intergenic
1192041591 X:67628179-67628201 CATCAGTAGCTTGATGGGGATGG + Intronic
1194110109 X:89823741-89823763 CTGCTGCTGGTTGATGTGGTAGG - Intergenic
1195867227 X:109446223-109446245 CATCAGTAGCTTGATGGGGATGG - Intronic
1196711816 X:118770703-118770725 CTTCAGCAGCATCTTGTGGATGG + Intronic
1198685098 X:139220521-139220543 GTGCATAAGATTGATGTGGAAGG - Intronic
1199460140 X:148075127-148075149 CTACAGTACCTGGATGTGGAAGG + Intergenic
1199677477 X:150200277-150200299 AAGCAGCACCTTGATGTGGTTGG - Intergenic
1200462768 Y:3478482-3478504 CTGCTGCTGGTTGATGTGGTAGG - Intergenic
1201684687 Y:16687808-16687830 CTGTGGTAGCTTGATGGGGATGG - Intergenic