ID: 960072359

View in Genome Browser
Species Human (GRCh38)
Location 3:113445338-113445360
Sequence ATTGAGAAACAGAATGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 744}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960072359_960072360 -4 Left 960072359 3:113445338-113445360 CCTTCTTCATTCTGTTTCTCAAT 0: 1
1: 0
2: 4
3: 59
4: 744
Right 960072360 3:113445357-113445379 CAATCTGTTGAACAAAGACACGG 0: 1
1: 0
2: 0
3: 26
4: 197
960072359_960072361 11 Left 960072359 3:113445338-113445360 CCTTCTTCATTCTGTTTCTCAAT 0: 1
1: 0
2: 4
3: 59
4: 744
Right 960072361 3:113445372-113445394 AGACACGGAAAAAATTTAGATGG 0: 1
1: 0
2: 2
3: 25
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960072359 Original CRISPR ATTGAGAAACAGAATGAAGA AGG (reversed) Exonic
900356369 1:2266755-2266777 AATGAGATAGAAAATGAAGATGG + Intronic
900738118 1:4312353-4312375 ATTGAAAAAAAGAATAAAGTCGG - Intergenic
901260007 1:7864365-7864387 ATTGAGAGACAGGAGGGAGAGGG - Intergenic
901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG + Intergenic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901988424 1:13093293-13093315 ATTGAGCAATAGAATGGGGAAGG + Intergenic
901993388 1:13133474-13133496 ATTGAGCAATAGAATGGGGAAGG - Intergenic
902272063 1:15311737-15311759 ATTGAGAAAAAGTGAGAAGAAGG - Intronic
902958284 1:19942132-19942154 TTTGAGAACCAGATTGATGAGGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903105046 1:21070514-21070536 ATTTAGAACAAGAATGAAGTAGG - Intronic
904019398 1:27450846-27450868 ATTGAGGAAAGAAATGAAGAAGG - Intronic
904492013 1:30866867-30866889 TATGAGCAACAGAATCAAGAGGG - Intergenic
904895298 1:33812822-33812844 ATAGAGAAACAGAATAGACATGG - Intronic
906118739 1:43373267-43373289 CTTGAGAAAGAGGATGGAGACGG - Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906750526 1:48254896-48254918 ATTCTGACCCAGAATGAAGAGGG - Intergenic
906907301 1:49909888-49909910 ATTGAGAAACAGATTTGAAAGGG + Intronic
907226851 1:52955804-52955826 ATTGAGAACCGAAAGGAAGAAGG + Intronic
907575001 1:55518473-55518495 ATTAAGAAAGAGTATCAAGAAGG + Intergenic
907686877 1:56620440-56620462 ATTGAGAAAGAGACTGTAGGAGG + Intronic
907770500 1:57457787-57457809 AGTAAGAAAGAGAAAGAAGATGG + Intronic
907949887 1:59172428-59172450 ATAGAGAAAGAAAATGAAAATGG - Intergenic
908281053 1:62535351-62535373 AGTGAGAAACTTAGTGAAGAGGG + Intronic
908494772 1:64683471-64683493 ATTGAGGAACAGAGAGAAAAAGG - Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908910670 1:69069537-69069559 ATTGAGAAAGAAAATTAACAAGG - Intergenic
909314594 1:74199573-74199595 ATTGAGAAAGATGATAAAGAAGG - Intronic
909494113 1:76259024-76259046 ATAGGGAAACAGAATTGAGAAGG - Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909876417 1:80810042-80810064 ACTGATAAACAATATGAAGAAGG - Intergenic
910009730 1:82446559-82446581 CTTGAGAAATAGAAAGAAGCTGG - Intergenic
910039699 1:82834869-82834891 AGTGAGAAGCAGGAAGAAGAAGG - Intergenic
910043397 1:82882305-82882327 AGAGAGAAACAGAGGGAAGAAGG + Intergenic
910101060 1:83577597-83577619 GTTGAAAACAAGAATGAAGATGG - Intergenic
910113532 1:83707329-83707351 ATTGAACAATAAAATGAAGATGG + Intergenic
910119610 1:83772036-83772058 ATTCCCAAACAAAATGAAGATGG + Intergenic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
910623378 1:89280432-89280454 AATGAGAAATAGAATGAAACAGG - Intergenic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911396164 1:97313596-97313618 AATGAGAAACAGAATAGAGAAGG - Intronic
911407521 1:97461207-97461229 TTTGAGCTACAGAATGAAGTAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911825284 1:102476514-102476536 AGTGAGAAAGAGAGAGAAGAGGG - Intergenic
911984573 1:104604742-104604764 ATAGAAAGAAAGAATGAAGAGGG - Intergenic
912081076 1:105936795-105936817 ATTTTGAAACAGTATGGAGAAGG - Intergenic
912153983 1:106893245-106893267 ATTCACAAGCAGAATTAAGAAGG + Intergenic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913367271 1:118053884-118053906 ATTGGGAAGAAGCATGAAGATGG - Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915806604 1:158860017-158860039 AAAGAGAAAAAGAATTAAGAAGG + Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916965676 1:169939942-169939964 ATTGAGAAACAGGAAGCAGTTGG + Intronic
917014846 1:170518383-170518405 ATTCAGAAATAGTCTGAAGAAGG + Intergenic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917832015 1:178901107-178901129 AATGGGAAAAAGAATGAACATGG - Intronic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918601449 1:186367469-186367491 ATTTATAAACAGACTGAAGGAGG - Intronic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
919058852 1:192605950-192605972 ATAGAGAGAAAGAAAGAAGAGGG + Intergenic
919510027 1:198450606-198450628 AGTGTGAAACATAATGAAAATGG - Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920170335 1:204068183-204068205 GCTGAGAAACAGAATAAAGGTGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920545181 1:206810505-206810527 ATTAAGAAACACATTGACGAAGG + Intronic
921037599 1:211396893-211396915 ATTAAGAAACAGAATCTATAAGG + Intergenic
921223277 1:212990458-212990480 ATTGACAAACAGAAGGTATATGG - Exonic
921607985 1:217177522-217177544 AATGAGAAAGAGAAAGAAAATGG - Intergenic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922169206 1:223141063-223141085 ATTGTGGAAAAGAATGCAGAAGG - Intronic
922625115 1:227032608-227032630 TTTGACCAACAGAATGCAGAAGG + Intronic
922703960 1:227779211-227779233 CATGAGAAACAGTATGAAGGCGG - Intronic
923079215 1:230637743-230637765 ATCAAGAAACAAAATGAAGGAGG + Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
924744953 1:246823088-246823110 ATTTTGAAAGAGAATGAAGTTGG - Intergenic
924811167 1:247403595-247403617 ATTGAGACACAAAAAGTAGAAGG - Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1064753192 10:18553035-18553057 ATTGGGAAATGGAATGGAGAAGG - Intronic
1065214397 10:23436726-23436748 ATTGAGATACAGAGTGGACAAGG + Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066671962 10:37849721-37849743 TTTTAGAAATAGAATGAACATGG + Intronic
1067511287 10:46896988-46897010 GCTGGGAAACAGAAAGAAGAAGG + Intergenic
1068221751 10:54054053-54054075 ATTGAGGTACAGAATTCAGAAGG + Intronic
1068438245 10:57018397-57018419 ACTCAGAAAGAGAATGAAAAGGG + Intergenic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1069506883 10:69007059-69007081 GTTGCTAAACAGAATGAATAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071159034 10:82725159-82725181 AGTGAGATACAGAATGAAGCAGG + Intronic
1071581117 10:86771048-86771070 ATTGAGAATCAGAATGCATTTGG - Intronic
1071817075 10:89243133-89243155 ATAGATAAAAAGAATGGAGAAGG - Intronic
1072076586 10:91980846-91980868 ATTGATAAACAGCAAGATGAGGG - Intronic
1072423526 10:95309728-95309750 ATCTAGAAAGAGGATGAAGAAGG + Intergenic
1072433607 10:95395847-95395869 ATTTAGAAACAGTTTGAACAGGG + Intronic
1072822245 10:98569543-98569565 AATGAGAATGAGAATGAATATGG - Intronic
1072880263 10:99219838-99219860 AGTTAGAAACAGACTAAAGAAGG - Intronic
1073002380 10:100295234-100295256 AATGAGACACATATTGAAGAAGG + Intronic
1073180886 10:101582529-101582551 ACTGAGAACCAGAATCTAGAGGG + Intronic
1073886551 10:108046493-108046515 ATTGATAGACTGAGTGAAGAAGG + Intergenic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1075894540 10:125983681-125983703 ATTGAGGAACAGAGGGAACAAGG + Intronic
1075944014 10:126416920-126416942 AGTGAGACACAGAGGGAAGAGGG + Intergenic
1076023431 10:127092817-127092839 GGTCAGAAACAGAATGAAAATGG + Intronic
1076148720 10:128145982-128146004 ATTGAGTAAATGAATGGAGAAGG + Intergenic
1076492192 10:130869443-130869465 AAACAGAAACAGAATGAAGTAGG - Intergenic
1076605606 10:131687318-131687340 ATTGGAAAACAAAATGAAGTAGG + Intergenic
1078117020 11:8463615-8463637 GGTGAGAAACAGAATTGAGATGG - Intronic
1078724178 11:13913912-13913934 CTACAGCAACAGAATGAAGAGGG - Intergenic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079340678 11:19609337-19609359 ATTGAGAAAGAGAGGAAAGAGGG + Intronic
1079752339 11:24214644-24214666 ATTGGAAAACAGAAAGAAGCAGG + Intergenic
1079757053 11:24277432-24277454 ATTGAGATACAGGATGAAACTGG + Intergenic
1079961893 11:26934514-26934536 AATGAGAAAGCTAATGAAGATGG - Intergenic
1080562858 11:33479787-33479809 ATTGAGAAACAGATTTTAAAAGG + Intergenic
1081215822 11:40396331-40396353 AATGATAAAAAGAATGGAGATGG - Intronic
1081717213 11:45258922-45258944 ATTGTGAAACAGTAGGATGAAGG - Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1086484840 11:87287924-87287946 ATTTAGGAACAGATTGAACAGGG - Intronic
1087141907 11:94772374-94772396 ATTTAGCAACAGAGTGAGGATGG - Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087579492 11:100034001-100034023 AGTAAGATACAGAATGAAGGTGG - Intronic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1087787066 11:102366924-102366946 ATCAAGAAACAGAAAGAAGGTGG - Intronic
1087933854 11:104008140-104008162 GTTGAGAAACAGAAGCCAGAGGG - Intronic
1088024977 11:105168576-105168598 CTTGTGAAATAGAATGAAGATGG - Intergenic
1088930658 11:114347976-114347998 ATTGAGAGTCAGAATGCAGAGGG + Intergenic
1089087374 11:115833812-115833834 TTTGAAAAAATGAATGAAGAGGG + Intergenic
1089259440 11:117213529-117213551 ATTTAGGAACAGAAAGATGATGG + Intronic
1089911056 11:122101106-122101128 AATGAAAAACAGAAAGAAAAAGG - Intergenic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1090125245 11:124077410-124077432 AGAGAGAAAAAGAAAGAAGATGG - Intergenic
1090132289 11:124157285-124157307 ATTGAGAAACAGTATCAGCAAGG - Intergenic
1090178841 11:124675634-124675656 CGTGAGAAATACAATGAAGACGG - Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090369088 11:126234743-126234765 CTTCAGAAACAGAAGCAAGATGG + Intronic
1090553838 11:127852489-127852511 ATTCAGCAAGAGCATGAAGATGG - Intergenic
1090894160 11:130954625-130954647 ATTCTGATACAGAATGAGGATGG - Intergenic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091924373 12:4332817-4332839 TTTGAAAAACAAAATCAAGAAGG - Intronic
1092234223 12:6796028-6796050 TTTTAGAAACAGAATTAATATGG + Intronic
1092617425 12:10228097-10228119 ATTCAGTAAAAGAATGATGATGG + Intergenic
1092656856 12:10694895-10694917 ATTGTGAAAAAGAATAAAGTGGG + Intergenic
1092719229 12:11424525-11424547 ATTGAGAATTAGAGTGAAAATGG - Intronic
1092897375 12:13025797-13025819 ATTGAGATATAAATTGAAGACGG + Intergenic
1092964003 12:13624374-13624396 GAAGAGAAACAGAATGAAGCAGG - Intronic
1093023007 12:14220312-14220334 ATTGAGAGTCAGGATGCAGAGGG - Intergenic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1093636849 12:21480854-21480876 ACTTAGAAACTTAATGAAGAGGG - Intronic
1093768174 12:22988816-22988838 ATTGAGTCACAGACTGTAGAGGG - Intergenic
1093772890 12:23038004-23038026 ACTGGAAAACACAATGAAGATGG - Intergenic
1093844509 12:23952137-23952159 ATAGAGAAAAAAAGTGAAGAAGG + Intergenic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1093962341 12:25287971-25287993 GTTGAGAAAAATAATGAAAATGG - Intergenic
1094128485 12:27049573-27049595 ACTGAGACACAGAGTGATGATGG - Intronic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095410265 12:41913766-41913788 TGTGAGAAACCGAAAGAAGATGG + Intergenic
1095712094 12:45300971-45300993 ATAGAGAAACCAAATCAAGAAGG - Intronic
1095798363 12:46245889-46245911 ATTAAAAAAGAGAAGGAAGAGGG - Intronic
1096311484 12:50525045-50525067 ATGGAGAAAAAGCATCAAGAGGG + Intronic
1097508072 12:60501409-60501431 CATGAGAAACAGAATGAATATGG + Intergenic
1097537105 12:60886040-60886062 ATTCAAAAAGAGAAAGAAGAAGG - Intergenic
1097924613 12:65113428-65113450 ATTTAGAATCAGAATAAATAGGG + Intronic
1098170565 12:67742679-67742701 ATTTAGAAATACAATTAAGAGGG + Intergenic
1098268399 12:68746451-68746473 GTTGAGGAACACAATGCAGATGG - Exonic
1098280257 12:68855257-68855279 ATTGAGAGAGAGAATGCAGCAGG + Exonic
1098832971 12:75385975-75385997 GTTCATAAATAGAATGAAGAAGG + Intronic
1098941697 12:76544267-76544289 ATTAAGGATCAAAATGAAGAAGG - Intronic
1099139144 12:78948541-78948563 ATTAATAAGCAGAATGAATATGG - Intronic
1099188117 12:79537906-79537928 AATGAGACACAGAAGGAAGTGGG + Intergenic
1099400861 12:82202430-82202452 ATTGAGAACCAGAATGTTTAAGG - Intergenic
1099539850 12:83894235-83894257 ATAGAGAAAGAGAGAGAAGAGGG - Intergenic
1100567007 12:95806291-95806313 ATTGAGAAAGGGAATGAAAGAGG - Intronic
1100879367 12:98999394-98999416 AATGGGAAACAGAATGACCAGGG - Intronic
1100908235 12:99326497-99326519 ATTCAAAAACAGAGAGAAGAAGG - Intronic
1101447477 12:104747609-104747631 ATTCTGAAACAGAAAGATGATGG + Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1101804695 12:108053155-108053177 ATTTAGAAAATGAATCAAGATGG + Intergenic
1102143973 12:110640402-110640424 ATTTAGAGACTGAATGACGATGG - Exonic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103112111 12:118289692-118289714 ATTTAGAAACAGAATGAACCTGG + Intronic
1103231791 12:119337287-119337309 AATGAGGGAAAGAATGAAGAGGG + Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1104046019 12:125163585-125163607 TTTGAAAAACAAAAAGAAGAAGG + Intergenic
1104204214 12:126621072-126621094 CTTGAGTAACATAATGAAAAAGG + Intergenic
1104519240 12:129457733-129457755 AGAGAGAAAGAGAGTGAAGAGGG + Intronic
1105030537 12:132880109-132880131 ATTTTGAAAAAGAATGAAGCTGG + Intronic
1105365647 13:19761921-19761943 CTTCAGAAACAGAATTAAGAGGG + Intronic
1105707268 13:22975884-22975906 CTTGAGAAACAAAATAAAGTAGG - Intergenic
1105832555 13:24177128-24177150 ATTAAGAAACAGAATTGACAAGG - Intronic
1106012315 13:25836649-25836671 ATTTACAAACAGAAGAAAGAAGG - Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106591576 13:31103058-31103080 AATGAAAAACTGAATGAATATGG - Intergenic
1106791995 13:33165060-33165082 AGTGAGAAAAAGAAAGAAGGAGG - Intronic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108878736 13:55082423-55082445 ATTAATAACCAGAATGCAGAAGG - Intergenic
1109015479 13:57006908-57006930 ATTGATGAAAAAAATGAAGAGGG + Intergenic
1109432169 13:62250283-62250305 ATTAGGAAACAGAATAAAGTGGG + Intergenic
1110939528 13:81331416-81331438 ATTGAGAGAAAAAATAAAGAAGG + Intergenic
1111724859 13:91994284-91994306 ATGGATAAACAAAATGAAGGGGG - Intronic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1111860498 13:93698824-93698846 ATTGAGAGAAAAAAGGAAGAAGG - Intronic
1112067102 13:95804500-95804522 ATTGTGAAAAAGAATGAAGTTGG + Intronic
1112443368 13:99441853-99441875 AGAGAGACACAGAGTGAAGACGG + Intergenic
1112667327 13:101590576-101590598 ATTGAAAACCAGATTGAAGAGGG - Intronic
1112674322 13:101681041-101681063 ATTGAGATACAAAAGAAAGAAGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112757973 13:102660935-102660957 ATATAGAAAAAGAATGAAGTTGG + Intronic
1113325901 13:109280935-109280957 TTAGAGAAACAGAATAAACAGGG + Intergenic
1113985199 13:114309211-114309233 ACTCAGACACAGAATGAACAAGG - Intergenic
1114135795 14:19848190-19848212 ATTCAGAAAGGGAGTGAAGATGG - Intergenic
1114737141 14:25053587-25053609 TTTGAGGAATATAATGAAGATGG - Intergenic
1114928264 14:27432933-27432955 AGAGAGAAACAGAATGATAAAGG + Intergenic
1114932813 14:27494916-27494938 TTTGAGAAAGAAATTGAAGAGGG + Intergenic
1115448255 14:33516933-33516955 ATCTAGATACAGAATGCAGAGGG - Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116762611 14:49033172-49033194 ATTGAGAATTAAAAGGAAGAGGG + Intergenic
1117289326 14:54317071-54317093 ATTCTGCAACAGAAGGAAGAAGG + Intergenic
1117410845 14:55449608-55449630 ACTGAGACACAGAGAGAAGAAGG + Intronic
1117609918 14:57472323-57472345 AATGAAAAAGACAATGAAGATGG - Intronic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119957511 14:78815033-78815055 TTTTAGAAAGATAATGAAGATGG - Intronic
1120085151 14:80263478-80263500 AGTGAGAAACTGAATGCAGGGGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120484623 14:85097058-85097080 ATTGACTAACAGAAAGAATATGG + Intergenic
1120625679 14:86823129-86823151 ATTGAGAAAGACACTGAAAATGG - Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1120934320 14:89878879-89878901 ATTAAAAAAAAGAATGAAAAAGG - Intronic
1121802791 14:96788821-96788843 AATGAGGAACAGAGAGAAGAAGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1123838760 15:24224824-24224846 ATTGACAAAGAGAATATAGATGG + Intergenic
1123848324 15:24327196-24327218 ATTGACAAAGAGAATATAGATGG + Intergenic
1123867383 15:24534719-24534741 ATTGACAAAGAGAATATAGATGG + Intergenic
1124079457 15:26477917-26477939 AAAGAGAAACAGAGTGAAAATGG + Intergenic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124210870 15:27764083-27764105 ACTGAGAAACAGAAGGGACAGGG + Intronic
1125262176 15:37839157-37839179 GCTGAGAAATAAAATGAAGAAGG + Intergenic
1125285682 15:38090175-38090197 AGAGAGAGACAGAATGAAGCGGG - Intergenic
1126259898 15:46677026-46677048 AATGATAAACATAATAAAGAGGG + Intergenic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126520018 15:49582300-49582322 ACTGAGAAACAGAAAAAAGCAGG + Intronic
1126552108 15:49943180-49943202 AAAGAGAAAAAGAATGAAAAAGG + Intronic
1126558270 15:50015237-50015259 ATAGAGAAAGAAAATGAAGAGGG + Intronic
1127018922 15:54723087-54723109 ATTGATAACCCGAATGTAGAAGG - Intergenic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127743351 15:61937053-61937075 AGAGAGAGACAGAATGGAGATGG - Intronic
1127755032 15:62083935-62083957 AGTGTGAAACAGACTGAAGAAGG + Intergenic
1128352446 15:66900149-66900171 ACTGAGGATAAGAATGAAGAAGG - Intergenic
1128359253 15:66949331-66949353 CTTGAGAAAGAGAAGGAAGGGGG - Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1129808326 15:78483289-78483311 AATGAGAAAGAGAAAGAACAAGG - Intronic
1129962042 15:79696081-79696103 TTACAGAAACAAAATGAAGAAGG - Intergenic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130515119 15:84620604-84620626 TTTGAGATACAGAGTGAAAATGG + Exonic
1130731488 15:86497879-86497901 ATTGAGAGACTGAAAGCAGATGG - Intronic
1131887875 15:96938191-96938213 ATTGAGAATCAGAATATATAAGG - Intergenic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133653855 16:7840174-7840196 ATTGATAAACAGAATGATTAGGG - Intergenic
1133741887 16:8658150-8658172 TTTGAGAACCACAGTGAAGATGG + Intergenic
1133950744 16:10390197-10390219 ATGGAGAAACCCAATGAAGCAGG + Intronic
1134773152 16:16828430-16828452 GTTGAACAACTGAATGAAGAAGG + Intergenic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1135657015 16:24259056-24259078 AGTGAGAAATTGAATCAAGAAGG + Intronic
1136292474 16:29284149-29284171 ATTGAGAAACAGAAAAATTATGG + Intergenic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137572517 16:49576074-49576096 TTTGAGAAACGGGATGAACAGGG - Intronic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142098367 16:88258168-88258190 ATTGAGAAACAGAAAAATTATGG + Intergenic
1142489156 17:266711-266733 AGTGAGAAACAGAATTCTGAGGG + Intronic
1142685049 17:1572733-1572755 ATTGAGAAACAGAATTGAGGGGG - Intronic
1142687842 17:1587959-1587981 ATTGAGAAACAGAATTAAGGGGG - Intronic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143276953 17:5718807-5718829 AGTGAGAAAGAGATTGAGGATGG + Intergenic
1143556066 17:7661384-7661406 AATAAGCAACAGAATGGAGAGGG - Intergenic
1145243139 17:21251322-21251344 ACTCAGAGACAGAAAGAAGAGGG - Intronic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1146610512 17:34300870-34300892 AATGAGAAACAGAAAGAAGCTGG + Intergenic
1147670280 17:42173087-42173109 ATTGATAACCACAATGCAGATGG - Intronic
1147891313 17:43719242-43719264 ATTGATTAACAGCCTGAAGAGGG - Intergenic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1150440163 17:65184696-65184718 AGGGAGAGACAGAATGAAGGAGG - Intronic
1150536208 17:66044683-66044705 AGTGAGGAACTGAATAAAGACGG + Intronic
1152027334 17:77819605-77819627 TTTCAGACACTGAATGAAGATGG + Intergenic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153042154 18:823274-823296 AATGTGAAACAGAATTCAGATGG + Intergenic
1153175053 18:2362335-2362357 TTTGAGAAACAAAAAGAAAAAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1154384699 18:13882460-13882482 TCTAAGAAACAAAATGAAGATGG - Exonic
1154459885 18:14571670-14571692 ATTCAGAAAGGGAGTGAAGATGG - Intergenic
1154505650 18:15038245-15038267 CTTGAGAAACAGAAGGACCAAGG - Intergenic
1155793202 18:29999100-29999122 GTTGAGAAAACCAATGAAGACGG + Intergenic
1156011072 18:32498606-32498628 AGTCAGAAACAAAATGAAGATGG - Intergenic
1156051020 18:32934272-32934294 ATTGAGAAACAAAAGATAGATGG - Intergenic
1156129522 18:33953504-33953526 TTTGGGAAACAGAATAAAGGAGG + Intronic
1156236912 18:35214496-35214518 TTTGAGAAACAGAAAGAAAAAGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156615488 18:38778725-38778747 ATTGTGAAAAAGAATGAGCATGG + Intergenic
1157007360 18:43599583-43599605 ATACAGAAAAAGAAGGAAGAAGG + Intergenic
1157116038 18:44863736-44863758 GTAGAGAGACAGAGTGAAGATGG - Intronic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157543793 18:48533441-48533463 ATTTATAAACTGACTGAAGAGGG + Intergenic
1158021798 18:52851393-52851415 ATTCACAAACAGAATTAAGTAGG - Intronic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1159352809 18:67298044-67298066 ACAGAGAAAGAGAATAAAGATGG - Intergenic
1159359831 18:67385697-67385719 GATAAGAGACAGAATGAAGAGGG - Intergenic
1161931740 19:7345192-7345214 TTTGAGGAACAGAAGGAAGCAGG - Intergenic
1162398572 19:10431707-10431729 ATTGAGGCACAGACTGAAGGAGG + Intronic
1162705987 19:12555272-12555294 AGAGAGAAAGAGAAAGAAGAAGG + Intronic
1163430340 19:17263514-17263536 GCTGAGAAACAGAGTGAAGTTGG + Intronic
1164249279 19:23462930-23462952 AGGGAGAAAGTGAATGAAGAAGG + Intergenic
1164336798 19:24331495-24331517 ATTGAGGCACAGAGTGAAAAAGG + Intergenic
1164702083 19:30292730-30292752 ATTGAGGGAGAGAATGAAGATGG + Intronic
1165370192 19:35400569-35400591 AGAGAGAGACAGAAAGAAGAAGG + Intergenic
1165397713 19:35575956-35575978 ATTAAGAAAGAGAAGGAATAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166233815 19:41441755-41441777 ATTGAGAAACTAAAAGCAGACGG + Intergenic
1166265030 19:41675964-41675986 GTTGAGAAACAGAAGCGAGATGG - Intronic
1167368556 19:49067086-49067108 ATTTAGGGACAGAATGGAGACGG - Intergenic
925258084 2:2506940-2506962 ATTGTGAAATAGGATGAAGTTGG - Intergenic
926364054 2:12116664-12116686 GCTGAGAAACAGATGGAAGAAGG + Intergenic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926770943 2:16374751-16374773 ATTGACCAACATAATGAAGGAGG - Intergenic
927011113 2:18905383-18905405 CTTGAGAAACAGAACAAAGCAGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927379661 2:22464476-22464498 ATTGATAAACAGTAAGATGATGG + Intergenic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928299320 2:30111592-30111614 TTTCAGAAACAAAATGATGAAGG - Intergenic
928354036 2:30592122-30592144 TATGGGAAACAGATTGAAGAGGG - Intronic
928459259 2:31455406-31455428 ATTGAGAAAAATAATGCAGTTGG + Intergenic
928461091 2:31473340-31473362 TTTGAGAAAGAGAATGAAGGAGG + Intergenic
928589496 2:32799747-32799769 ATTCAGAAACAGATTCAAGTAGG + Intronic
928594618 2:32848079-32848101 ATTTACAAACAAAATGATGAGGG - Intergenic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
928919112 2:36507537-36507559 ATTGGGAAGCTGAATGTAGATGG + Intronic
929246772 2:39710808-39710830 GTTCAGGCACAGAATGAAGATGG - Intronic
930316049 2:49798130-49798152 AGTGAGGAAGAGAATGAAGGAGG - Intergenic
930550549 2:52829627-52829649 ATTGAGAAAAAGGAGGAATAAGG - Intergenic
931260659 2:60615544-60615566 ATTGAGAGTGAGAAGGAAGATGG + Intergenic
931571274 2:63671509-63671531 CTTGTGAAAGAAAATGAAGAGGG - Intronic
931896772 2:66740409-66740431 GTTGAGGAATAGAAGGAAGAGGG + Intergenic
931940837 2:67250312-67250334 ATTGATAACCAGAATGTATAAGG - Intergenic
931984477 2:67728292-67728314 TTTCAGAAACACAATAAAGATGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932882789 2:75519269-75519291 ATTGAGTCACAGAGTGTAGAAGG + Intronic
932917843 2:75876591-75876613 ATTGAGAATCAGGATGTACAGGG - Intergenic
933175085 2:79165618-79165640 ATTGAGAGTCAGAATGTACAGGG + Intergenic
933211649 2:79577239-79577261 ATTTATTCACAGAATGAAGAAGG - Intronic
934960904 2:98671847-98671869 ATGGAACAACAGAATCAAGAGGG + Intronic
935304848 2:101727660-101727682 ACTGTGAAACAGAAAGAAGGTGG + Intronic
935425485 2:102914323-102914345 ACTGAGGAACATAATGAAGCTGG - Intergenic
935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG + Intergenic
935791059 2:106590591-106590613 GATGAGAAAGAGAAAGAAGAGGG - Intergenic
937461991 2:122097348-122097370 ACTGAGAAACTGAATGGAGGGGG - Intergenic
937650860 2:124317517-124317539 TTTGAGAAAGATAATGTAGATGG - Intronic
938167896 2:129048239-129048261 AATGAGAAAGAAAATGAATAAGG - Intergenic
938504840 2:131868513-131868535 TTTGAGAAACAGAAGGACCAAGG - Intergenic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939139387 2:138335536-138335558 AATGAGGAACAGAATGGACATGG - Intergenic
939493479 2:142902916-142902938 ATTGAGAATCAGAATGTACAGGG + Intronic
939519090 2:143206542-143206564 ATTGAGAGACAGATCAAAGAAGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939610228 2:144301023-144301045 ATTGAAAAAAAGAAAGAAAATGG + Intronic
939619443 2:144400136-144400158 AATGAGAAACAATATCAAGACGG - Exonic
939935074 2:148281184-148281206 TTTTAGAAATAGAATGTAGAAGG - Intronic
939975965 2:148718065-148718087 AATGGGAAACAGAACGAAGCAGG - Intronic
940268077 2:151861268-151861290 TTTGATAATCAAAATGAAGAGGG - Intronic
941440092 2:165523868-165523890 AAAGAGCAATAGAATGAAGATGG - Intronic
941457352 2:165725090-165725112 ATTGAGAAAAAGAAGGAGGGAGG + Intergenic
941876623 2:170440225-170440247 AGTGAGAAAAAGAATAAAGCTGG - Intronic
942039693 2:172047409-172047431 ATTTAGTAACAGAATAAAAAAGG + Intronic
942058814 2:172208997-172209019 ATTGTGAAACAGCCTAAAGAAGG + Intergenic
942311192 2:174658466-174658488 GGTGAGAAACAGGATGGAGAGGG + Intronic
942689454 2:178570089-178570111 CTTGAGAAACGGGATAAAGAAGG - Exonic
942909259 2:181222152-181222174 CTTGAGCAAAAGAATGAAGTTGG - Intergenic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
943271954 2:185816945-185816967 AGAGAGAAACAAAAGGAAGAAGG + Intronic
943479498 2:188400225-188400247 ATAGAGAAACACAGGGAAGAAGG - Intronic
944247068 2:197542047-197542069 ATTAGGAAACTGAATCAAGAAGG + Intronic
944481990 2:200166723-200166745 ATTGGGAAAGAGAGTGAAGCAGG + Intergenic
944955753 2:204806751-204806773 ATTAAGAACCAGAATGTATAAGG + Intronic
945669361 2:212784787-212784809 ACTGGGAAACAGAATGAATTTGG + Intergenic
945773465 2:214075439-214075461 ATTGAGAAAGGGCATGAAGGAGG + Intronic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946129584 2:217595822-217595844 ATTGAGAAACACTGGGAAGATGG - Intronic
946581364 2:221131408-221131430 ATTGGGAAACACAATATAGAAGG + Intergenic
946758247 2:222967855-222967877 ACTCAGAAACAGAATAATGAAGG - Intergenic
947057997 2:226129330-226129352 ACTGAGAGACAGAATGAATCTGG - Intergenic
947293596 2:228605132-228605154 GTTGAGAAACACAATCCAGAAGG - Intergenic
947946628 2:234109299-234109321 AATGAGAAACATACAGAAGAGGG - Intergenic
948204381 2:236155341-236155363 AAAGAGACACATAATGAAGAGGG - Intergenic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1168838939 20:896519-896541 TTTGAGGATCAAAATGAAGATGG + Intronic
1169314632 20:4579687-4579709 ATTGAGAAACAAAATCATGAAGG - Intergenic
1169825464 20:9763591-9763613 ATTAAGCAACAGAATGAAGTTGG + Intronic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170524839 20:17227168-17227190 ATAGAGAAAGAGACTGAACAGGG - Exonic
1170902239 20:20475749-20475771 ATTAAGAGAAAGAAAGAAGAAGG + Intronic
1172174331 20:32962987-32963009 ATTGGGATACAGACTGCAGATGG - Intergenic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1173619535 20:44426206-44426228 ACAGAGAAACAGAAAGAAGCGGG + Intronic
1173925359 20:46777165-46777187 ATTGAAAAACAGATTGAAGTTGG + Intergenic
1173993741 20:47322238-47322260 ATTGAGAAACTGATTACAGATGG + Intronic
1174283280 20:49454598-49454620 GTGGAGAAAAAGAATGAAGCAGG + Intronic
1174464416 20:50706263-50706285 CTAGAGAGACAGAATGTAGAGGG + Intergenic
1174749158 20:53094942-53094964 ATTGAAAAACAAAAATAAGAAGG - Intronic
1175560449 20:59924053-59924075 TTTAGGAAACAGAATGAAGGTGG - Intronic
1176792211 21:13330871-13330893 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1176814231 21:13581156-13581178 ATTCAGAAAGGGAGTGAAGATGG + Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1177805970 21:25875142-25875164 ATTTACAAAGAGAATGAACAAGG + Intergenic
1177809819 21:25914195-25914217 ATTCAGAAATAGAATGCAAAAGG - Intronic
1177908419 21:26999794-26999816 AAAGAGAAAGAGAATGAAGGGGG + Intergenic
1177972117 21:27803037-27803059 CTAGAGAAAGAGAATGGAGAGGG - Intergenic
1177991606 21:28041735-28041757 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1178006189 21:28222658-28222680 ATTGAGAAACTGAATAAAACAGG + Intergenic
1179148064 21:38786347-38786369 ATCCAGAAACAGACTGCAGAAGG - Intergenic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1180969625 22:19808350-19808372 ACAGAGCAACATAATGAAGAGGG + Intronic
1181320050 22:21997621-21997643 AGTTAGAAACAAGATGAAGATGG + Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183607907 22:38877483-38877505 TTTGACCAACAGAATGCAGAGGG - Intergenic
1184110698 22:42392454-42392476 AGAGAGAAACAGAAAGGAGAGGG + Intronic
1184395921 22:44240229-44240251 ATTTTGAAACAGAATAAAGTGGG - Intergenic
949104774 3:190814-190836 AGTGAGAAACAGAAAGGATATGG + Intergenic
949159498 3:863001-863023 ATTGAAAAACAAAACGAATAGGG + Intergenic
949856253 3:8464017-8464039 AGTGAGATAGAGAATGAAGGTGG - Intergenic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
950322825 3:12072712-12072734 ATAGAAAAACAGGATGAATATGG - Intronic
950920074 3:16685180-16685202 ATTGAGAAACACATATAAGAAGG - Intergenic
950939365 3:16877935-16877957 TTTGAGAAATAGATTGAAGTTGG + Intronic
951074496 3:18373150-18373172 CTTTAGAAAGTGAATGAAGAAGG + Intronic
951572240 3:24076650-24076672 AGTCAAAAACAAAATGAAGATGG - Intergenic
951838817 3:27011516-27011538 ATATAGGAACAGAAGGAAGAGGG - Intergenic
952061776 3:29519441-29519463 ATTGAGAAACAAAATATAAAAGG + Intronic
952184373 3:30953089-30953111 CTTGACAAACAGAATACAGAAGG - Intergenic
952287607 3:31983217-31983239 ATTGACATACAGACTGAAGGTGG + Intronic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
952997917 3:38903334-38903356 AATGAGAAACATATTGAAGCAGG + Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954245046 3:49324732-49324754 ATTGAGCCTCAAAATGAAGATGG - Exonic
954857399 3:53657748-53657770 ATTGAGATACAGACTGTAGTTGG - Intronic
956822705 3:72968402-72968424 ATTGAGTAACAGATTGGAGTTGG - Intronic
957200329 3:77126671-77126693 ATTGAGAAAAAGAAGGAATATGG + Intronic
957514281 3:81230865-81230887 ACTGAGGAAAACAATGAAGAGGG - Intergenic
958058340 3:88443577-88443599 ATAGAGAAACAGAAATTAGATGG + Intergenic
958144907 3:89612199-89612221 AGAGAGAAACAGAAGGAAGGAGG - Intergenic
958494678 3:94829475-94829497 ATTAAGCAACAGAAAGGAGAGGG + Intergenic
958883669 3:99701650-99701672 ATTCAGAAACAGACTGGAAAAGG - Intronic
959367949 3:105487527-105487549 ATAGAGAAAAAAAATGAAAATGG + Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960307589 3:116080958-116080980 ATTAAGAAAGGGAAGGAAGAAGG + Intronic
960380565 3:116955367-116955389 ATTGGAAAATAGAATAAAGAAGG + Intronic
960539409 3:118847253-118847275 ATTGAGAGTCAGGATGCAGAGGG - Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
961474774 3:127139883-127139905 ATTAAGAAAGAGGATCAAGAGGG - Intergenic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962751325 3:138436327-138436349 ATTAGGACACAGAAGGAAGACGG - Intronic
963738417 3:149048873-149048895 ACTTAGAATCAGAAAGAAGATGG - Exonic
964036097 3:152198696-152198718 ATTGAGACACAGAAGGTATATGG + Intergenic
964137341 3:153359611-153359633 ATTGATCAACAGAATGTAGCCGG + Intergenic
964161240 3:153648258-153648280 AATGAGAAAAATAATGAAAATGG + Intergenic
964468784 3:157029390-157029412 AATGAGGAAGAGACTGAAGAAGG + Intronic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964798399 3:160525258-160525280 ACTGAGAAATAGAATAAAAATGG + Intronic
964977590 3:162638795-162638817 ATGAAGAAACATAATGAAGTTGG - Intergenic
965046237 3:163581661-163581683 AGAGAGAAAGAGAATTAAGAGGG + Intergenic
965232013 3:166066236-166066258 TTTGTGAACCAGAGTGAAGAAGG + Intergenic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
965869047 3:173244668-173244690 ATTGAAATACAGAAGGAAAAAGG - Intergenic
966270966 3:178105047-178105069 ATTGGGAGATAGAATGAATAGGG - Intergenic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
967234441 3:187370636-187370658 ATTGATAAACAGGAACAAGAAGG - Intronic
967348128 3:188481560-188481582 TTAGAGAAACAGAGTAAAGAAGG + Intronic
967691568 3:192479979-192480001 ATTGAGAAAGAGAAGAAAGAAGG + Intronic
968335144 3:197907193-197907215 ATTGAGAAATAGAATAGTGAGGG - Intronic
968865072 4:3204099-3204121 ATAGAGAAATAGTACGAAGAGGG + Exonic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970363849 4:15337987-15338009 ATTTATAAACAGAAATAAGAGGG - Intergenic
970548383 4:17153603-17153625 ATTGAGAAAAAGAGGGGAGAGGG + Intergenic
971138404 4:23896630-23896652 ATTGAGAAACAAAGGGAAGATGG - Intronic
971219853 4:24694981-24695003 ATTGAGAAACAAGAAGAAAAGGG - Intergenic
971499370 4:27301631-27301653 GTTGAGAACCAGAATAAAGGTGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971788748 4:31139787-31139809 ATTTAGAAAAATAATCAAGAAGG - Intronic
971825096 4:31610899-31610921 AATAAGGAATAGAATGAAGAAGG - Intergenic
972205244 4:36763893-36763915 GTTGAGAAACTAAATGAAAAAGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972598253 4:40549047-40549069 ATTGATAAAAAGAATGAGTAAGG - Intronic
972711746 4:41603682-41603704 ATTAGGAAACAAAATGTAGAAGG - Intronic
972974394 4:44615747-44615769 CTTGTGAGACAGATTGAAGATGG - Intergenic
973207772 4:47579637-47579659 TTTGAGGAAAAGAATGAAAAAGG + Intronic
974676302 4:65093795-65093817 ATTGAGAAAGAGAAGGCAGAAGG + Intergenic
975134532 4:70861754-70861776 ATAAAGAAACAAAATGAAGGAGG + Intergenic
975333981 4:73154014-73154036 ATTGAGGACCATAATGAAAATGG - Exonic
975760335 4:77613891-77613913 ACTGAGAAACTGAATGAAGGAGG + Intergenic
976361899 4:84189518-84189540 ACTGAAAAACAGAATACAGATGG + Intergenic
976575743 4:86668943-86668965 AGTGAGAAACAGAATTACCAAGG - Intronic
977102199 4:92831053-92831075 ATTGAGAAACAGAAGGGACTAGG + Intronic
977280875 4:95038224-95038246 TTTGAGGAACAGGATGAAGAAGG + Intronic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
979119382 4:116876473-116876495 AGTGAGAAAGAGAATGAGGGGGG - Intergenic
979865049 4:125744084-125744106 ATGGAAAGATAGAATGAAGAAGG + Intergenic
979909773 4:126348419-126348441 ATTGAGAAAAAACATGAAAAAGG - Intergenic
980094249 4:128473188-128473210 GAAGAGAAACAGATTGAAGATGG + Intergenic
980418427 4:132524091-132524113 ATGGAGGAACAGAGTGAAGGAGG - Intergenic
980742371 4:136969259-136969281 AGTGAGAAAATGAATAAAGAGGG - Intergenic
981409782 4:144416215-144416237 AGAGAAAAACAGAATAAAGAAGG + Intergenic
982264460 4:153525639-153525661 ATTAAGAAACTGAAAGAAAAAGG - Intronic
982270906 4:153587018-153587040 AGTGAGAAAAAAAATAAAGATGG - Intronic
983853349 4:172611005-172611027 AATGAAAAACAGAAAGAAGCAGG - Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984021501 4:174489098-174489120 ATTGTGAAACACAGTGAAAAAGG - Intergenic
984351739 4:178603183-178603205 ATAAGGAATCAGAATGAAGATGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985047773 4:185957686-185957708 ATTTAGAAAAAGAAAGCAGATGG + Intergenic
985236863 4:187884654-187884676 ATTAAAAAACAGAAAAAAGAAGG - Intergenic
985769944 5:1803050-1803072 AGTGGGAAAAAGAATGAATAAGG - Intronic
985993634 5:3584218-3584240 ATTGTGCAGCAGAATGTAGAAGG + Intergenic
986169100 5:5301524-5301546 AGTGAGAGACAGAAAGGAGAAGG - Intronic
987186713 5:15428546-15428568 ATTTAGAAAAAGAATAAAGTAGG - Intergenic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987424428 5:17756556-17756578 ATTGAGATCCAGAAAAAAGAGGG - Intergenic
987504025 5:18746860-18746882 ATTAAGGAACATAATGAAGTTGG + Intergenic
987517048 5:18924083-18924105 AATGAGAGAGAGAAAGAAGAAGG + Intergenic
987741264 5:21912267-21912289 AATGAGAAACAGAATGGAAATGG + Intronic
987915761 5:24211761-24211783 ATTGAATAACAGAAAGCAGAAGG - Intergenic
988292650 5:29309338-29309360 GATGTGAAACAGAATGATGATGG - Intergenic
988307461 5:29511216-29511238 ATTAAGAATAAGAATAAAGATGG - Intergenic
988600714 5:32637382-32637404 ATTGAAAAAAAGAAGGAACAAGG - Intergenic
988901373 5:35736244-35736266 ATTAAGAAAAAGAAGAAAGATGG + Intronic
989346223 5:40432863-40432885 ATTAGGAAACAGAATTAAGGAGG - Intergenic
989411912 5:41129308-41129330 ATAGAGAGAGAGAAAGAAGAAGG - Intergenic
989998983 5:50870580-50870602 ACAGAGAAACAGAATCAATAAGG + Intergenic
990122034 5:52466782-52466804 AGAGAGAAAGAGAAAGAAGATGG - Intergenic
990429863 5:55724143-55724165 ATTGAGATTGAGAATAAAGAGGG + Intronic
990616568 5:57514580-57514602 ATTGAGAAAGATAATGAAACAGG - Intergenic
990644362 5:57826990-57827012 ATTGAGTTAGAGAATGAAAAAGG - Intergenic
990743092 5:58932329-58932351 ATTGATGAATAGTATGAAGAGGG - Intergenic
990817800 5:59805087-59805109 ATTAAGAAACAGAATGTGGCAGG - Intronic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
991559740 5:67937231-67937253 ATTTAGAGACAGAAGGCAGATGG + Intergenic
991561651 5:67959889-67959911 AGTGTGAAACAGAATAAAAAGGG - Intergenic
991665060 5:68991366-68991388 AATGAGAAAAAGAAGAAAGAAGG - Intergenic
991995988 5:72387240-72387262 AATGAGAAACAAAATGAACATGG + Intergenic
992528520 5:77633734-77633756 ACTGAGAAATAGAAAAAAGAGGG + Intronic
992587892 5:78260231-78260253 ATTTAGGAAGAGAATGTAGATGG - Intronic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993073293 5:83193039-83193061 GTTGTGAGACAGAATAAAGATGG + Intronic
993245736 5:85450817-85450839 ATAGAAAAAAAGAATGAAAAAGG - Intergenic
993525633 5:88962144-88962166 AATGAGTAACAGAAAGAAAAGGG - Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994720350 5:103372921-103372943 CTTGAGAGACAGAATGAAATGGG - Intergenic
995143272 5:108758018-108758040 ATTTTGAAAGAGGATGAAGATGG + Intronic
995817343 5:116186071-116186093 AGGGAGAAAGATAATGAAGATGG - Intronic
996119909 5:119659761-119659783 AATAAGAAACAATATGAAGAAGG + Intergenic
996618176 5:125467186-125467208 AATGTGAAACACAAAGAAGAAGG - Intergenic
996857053 5:128020000-128020022 ATTGAGAATAACACTGAAGATGG - Intergenic
998776352 5:145608075-145608097 ATTGGGAAACAGAACAAAGCAGG - Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
998876101 5:146600985-146601007 AATGAGAATCAGAAAGTAGATGG - Intronic
999504868 5:152184170-152184192 AGAAAGAAAAAGAATGAAGAGGG + Intergenic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999955190 5:156693449-156693471 ATTGTGAAAGAGCATAAAGAAGG - Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000299979 5:159947590-159947612 ATTGAAAAAAAGAATGTAAAAGG - Intronic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000615414 5:163420421-163420443 GTTCAAAAACAGCATGAAGAAGG + Intergenic
1000738962 5:164940610-164940632 ACTGAGAAACAGAATCATGCTGG - Intergenic
1000774674 5:165404328-165404350 ATTGAGTACCTAAATGAAGATGG + Intergenic
1000831982 5:166113583-166113605 ACTTAGAAACAGAAGGATGAAGG + Intergenic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001149005 5:169210468-169210490 ATTGACAAAAACCATGAAGAAGG + Intronic
1001857064 5:175022114-175022136 TTTGAGAAACAGAAAGAAGCGGG + Intergenic
1001908634 5:175495255-175495277 ATTCAGAGACAGAAAGTAGAGGG + Intronic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1003604940 6:7551168-7551190 ATTGAGTTACAGAATGAATGAGG + Intronic
1004483619 6:16044616-16044638 ATTGAAAAACAGTGTCAAGATGG + Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005132261 6:22522812-22522834 ATTCAGAAACAGCAAGAAAATGG + Intergenic
1005588634 6:27301827-27301849 ACTGTGAAACAGAGTGAATAGGG - Intronic
1005706252 6:28456609-28456631 ATTATGCAAAAGAATGAAGAAGG + Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006292929 6:33154208-33154230 ACTGACAAACAGGATAAAGAAGG + Intergenic
1006343282 6:33459126-33459148 ATTGGGAAAGGGGATGAAGAGGG + Intergenic
1007543444 6:42671657-42671679 ATTGAGTTTCAGAATGAAGAAGG - Intronic
1007590920 6:43020631-43020653 AATAAGAGACAGAAAGAAGAGGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008505347 6:52224682-52224704 AAAGAGAGACAGAAAGAAGAGGG - Intergenic
1009265425 6:61548698-61548720 ATTGAAAAACAGAAAACAGACGG + Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009350257 6:62666781-62666803 AGAGAGACACAGAAAGAAGAAGG + Intergenic
1009661521 6:66618140-66618162 TTTGAGAAACAAAAAGAAAATGG - Intergenic
1009698913 6:67148914-67148936 ACAGAGAAACAAAATGAAAAAGG - Intergenic
1009803658 6:68574192-68574214 ATTGATAACCAGAATATAGAAGG + Intergenic
1009976275 6:70674469-70674491 ATTGAGAAACTGAACTAAAATGG - Intronic
1010844607 6:80689385-80689407 ATTGAGAAAAAGAAAAAACAAGG - Intergenic
1010966327 6:82213545-82213567 ATTGAGAAACTGAAGTAAGAAGG + Intronic
1011039753 6:83016268-83016290 ATTAAGGAACATAATGAAGTTGG - Intronic
1011608701 6:89129568-89129590 AATTAGAAACAGAGAGAAGAGGG - Intergenic
1011813036 6:91155062-91155084 ATTAAGATACAGTATGATGAGGG + Intergenic
1012006956 6:93725204-93725226 ATTATGACACAGGATGAAGATGG - Intergenic
1012647619 6:101707052-101707074 ATTAGGTAAGAGAATGAAGATGG + Intronic
1012879366 6:104767127-104767149 AATGAGAAACATAAAGAACATGG + Intronic
1013394594 6:109722646-109722668 AATGAAAGCCAGAATGAAGAGGG - Intronic
1013866173 6:114698917-114698939 ATTGAGACATAGAAAGAACATGG + Intergenic
1014257920 6:119182677-119182699 AATGAGAACCAGATTGCAGATGG - Intronic
1014486770 6:122008740-122008762 AATGTGATACAGAATGAAGCTGG - Intergenic
1014989163 6:128052843-128052865 CTTGAGAATCAAAATAAAGATGG - Intronic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015739600 6:136439657-136439679 AGTGGGAAACAAAATGTAGAGGG - Intronic
1017271076 6:152506134-152506156 ATTAAGAAACTGAATCAAGTTGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017827075 6:158089566-158089588 ATTGAAAAAAAGATAGAAGATGG + Intronic
1018549234 6:164975955-164975977 ATTGAGAAAGCAAATGAAGCTGG - Intergenic
1019190336 6:170247172-170247194 AGTGACAAACAGAAAGAACAGGG - Intergenic
1019412727 7:913592-913614 TTTGAGCAACAAAAGGAAGATGG - Intronic
1020053772 7:5102367-5102389 AGTGGGAAACAGAATGAAGGAGG - Intergenic
1020178348 7:5900873-5900895 ATTGAAAAACAGAGTAAAGATGG + Exonic
1020304577 7:6824126-6824148 ATTGAAAAACAGAGTAAAGATGG - Exonic
1020825112 7:13017136-13017158 AGTGAGAAACAGCTTGAAAATGG - Intergenic
1021141483 7:17030827-17030849 ATTGAAAAACTGGTTGAAGAGGG + Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021937064 7:25641472-25641494 TTTGAGCAAAAGAATGGAGAGGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022521365 7:31009398-31009420 AATGAGAAACTTAATGGAGAAGG - Intergenic
1022600611 7:31755668-31755690 ATTGAGCAACAAAATAAACAAGG + Intronic
1022778756 7:33556455-33556477 TTTGAGAAACAGTATAAAGAAGG - Intronic
1022845744 7:34207998-34208020 TTTAAGAAACAGAGGGAAGATGG + Intergenic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1023595221 7:41822608-41822630 TTGGAAAAACAGAATGAAAAGGG - Intergenic
1023660270 7:42463852-42463874 GTTGAGATATAGAAAGAAGATGG + Intergenic
1024846755 7:53653566-53653588 ATAGACATACAGAAGGAAGAAGG - Intergenic
1025836562 7:65099602-65099624 ATTCAGAAACAGAATTGAGCTGG + Intergenic
1025906334 7:65789036-65789058 ATTCAGAAACAGAATTGAGCTGG + Intergenic
1025989018 7:66481008-66481030 ATTCAGAAACAGAATTGAGCTGG - Intergenic
1026135571 7:67657742-67657764 ACTGAGAGACAGGATGGAGATGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026456661 7:70578642-70578664 GTTGGGAAAAATAATGAAGAGGG - Intronic
1026500755 7:70941569-70941591 ATTTAGAAAAAAAAAGAAGAAGG + Intergenic
1026769320 7:73184396-73184418 ATTCAGAAACAGAATTGAGCTGG + Intergenic
1027010190 7:74737779-74737801 ATTCAGAAACAGAATTGAGCTGG + Intronic
1027077852 7:75208258-75208280 ATTCAGAAACAGAATTGAGCTGG - Intergenic
1027211983 7:76157025-76157047 ATTCAGAAACAGAATTGAGCTGG - Intergenic
1028591357 7:92499062-92499084 ATTGAGAAACATAATGGTGTTGG + Intronic
1028675889 7:93460090-93460112 ACTTGGCAACAGAATGAAGAGGG + Intronic
1028713833 7:93941146-93941168 TTTGACCAACAGAGTGAAGAAGG - Intergenic
1028841972 7:95438265-95438287 ATTCAGAAAGAGAAAGAATATGG - Intergenic
1029401393 7:100349085-100349107 ATTGAAAAAAAAAATGAAAATGG + Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031196009 7:118614682-118614704 ATTAAGGAACATGATGAAGAGGG + Intergenic
1031426725 7:121614636-121614658 ATTCAGAAAAACAAAGAAGAGGG - Intergenic
1031458274 7:122011545-122011567 TTTGAGAAACTGTATGCAGATGG - Exonic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031837404 7:126694941-126694963 ATGGAGAAACAGAATGTAAGTGG + Intronic
1033528951 7:142244232-142244254 AGAGAGAAACAGAGAGAAGAGGG - Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1034495435 7:151418383-151418405 AATGAAAAACAGAAAGAAAAAGG + Intergenic
1035168239 7:157004000-157004022 AGTGACAAACAGAAGGAAGGAGG + Intronic
1035766260 8:2108132-2108154 AATTAGAATCAGAAAGAAGATGG - Intronic
1035818388 8:2564865-2564887 ATTGAGAAACAGAGAGAAGGTGG + Intergenic
1035827750 8:2662423-2662445 ATTGCAAAACAGTATAAAGAAGG - Intergenic
1036464054 8:8979779-8979801 AATGAGAAACAAAATAAAGGTGG - Intergenic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037338885 8:17820712-17820734 ATTGAGTAAGGGAATGAAGACGG - Intergenic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1038603271 8:28970755-28970777 TTTGATAAACAGAATGGAAAAGG - Intronic
1038890186 8:31712908-31712930 ATAGACAGACAGATTGAAGAAGG - Intronic
1038918992 8:32061375-32061397 ATTGAGAAACAGTTTTATGAGGG - Intronic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1039526656 8:38222593-38222615 TTTGAGCAACAAAATGAATAAGG - Intergenic
1039756729 8:40531268-40531290 AGTGAGAAACAGAAGAAATAGGG + Exonic
1040944339 8:52867505-52867527 TTTGAGAAAAAGAATAAAGTAGG - Intergenic
1041181754 8:55256609-55256631 ATTGAGAGAGAGAATGCTGATGG + Intronic
1041318311 8:56587380-56587402 CTTGAGGAACAGCCTGAAGATGG + Intergenic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041581773 8:59469013-59469035 ATTGAGATATAGAATTAACAAGG - Intergenic
1041635100 8:60134039-60134061 ATTAAAAAATAGATTGAAGAGGG + Intergenic
1041767501 8:61434259-61434281 ATTCAGACACAGAATTTAGAAGG + Intronic
1041869858 8:62620364-62620386 TTTGAGAAACAGAATGTGCATGG - Intronic
1042724197 8:71854686-71854708 CTAGAGAAACACAATGAATAAGG - Intronic
1043224525 8:77707857-77707879 AATGAGAAACAGAAAGAAAAAGG - Intergenic
1043493242 8:80771147-80771169 ATTTTGAAACAGAATAAAGTAGG - Intronic
1043783247 8:84363323-84363345 ACTCAGAAACAGAAGGGAGATGG + Intronic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1044073354 8:87789300-87789322 GCTGTTAAACAGAATGAAGAAGG - Intergenic
1044089202 8:87978326-87978348 AATGTGAAACAGTTTGAAGAGGG - Intergenic
1044140794 8:88649082-88649104 AAACAGAAACAGAATGAATAGGG - Intergenic
1044476059 8:92627852-92627874 ATTGAGAAACACAAAGTAAAGGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046713474 8:117540974-117540996 GTTGAGGATCAGAATTAAGAAGG + Intergenic
1046728085 8:117695813-117695835 ATTGAGGAATAGAATGGAAAGGG + Intergenic
1046867562 8:119167751-119167773 ATTTAGAAACAGTATAGAGAGGG + Intronic
1047460914 8:125064515-125064537 ATTAATAAACAGAATTAAGGCGG - Intronic
1047603415 8:126450297-126450319 AGTGAGAAACACATTGAACATGG - Intergenic
1047628472 8:126680664-126680686 CTAAAGAAACAGAATGAAGTGGG - Intergenic
1047796974 8:128267651-128267673 TGTGAGTAACAGAATGAAGGAGG + Intergenic
1048038742 8:130704673-130704695 TTTGAAAAATAGAATAAAGATGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048728991 8:137416958-137416980 GTTGAGAAAAACAATGTAGAGGG + Intergenic
1048790403 8:138098442-138098464 AATGAGGCACAGATTGAAGATGG - Intergenic
1049210776 8:141385478-141385500 AGCGAGGAACAGAAGGAAGAAGG - Intergenic
1049860981 8:144898700-144898722 ATTAATAACCAGAATGCAGAAGG + Intronic
1050218705 9:3361166-3361188 AATGTGAAACAGAAGGAAAAAGG + Intronic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1050346642 9:4695376-4695398 TCTGAGAAACAGAATGATTATGG - Intronic
1050452861 9:5802326-5802348 GTAGAGAAATAAAATGAAGAAGG - Intronic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1050814508 9:9792706-9792728 ATTGAAAATCAGAATGCAAATGG + Intronic
1051159762 9:14193937-14193959 ATTGAGAGAGAGGATGTAGAGGG - Intronic
1051491586 9:17672859-17672881 ATTCTGAAACAGAATGAGGCTGG - Intronic
1052779628 9:32767294-32767316 ATTGAGGAACAGAACAAAGGAGG - Intergenic
1052844229 9:33320894-33320916 ATTGAGAAAAAGGATTAAGTAGG - Intronic
1052929152 9:34042107-34042129 ATTGAGAATAAGACTGAAAATGG + Intronic
1053092950 9:35296478-35296500 ATTATGAAACAGGAAGAAGATGG - Intronic
1054763471 9:69023712-69023734 ATAGAGGAACAGAAGGAAAAAGG + Intergenic
1055001460 9:71454464-71454486 ACTGCAAAACAGAATGAAAAGGG + Intergenic
1055235803 9:74121617-74121639 ATTGAAATATTGAATGAAGAAGG - Intergenic
1056937949 9:90932152-90932174 ATTCAGGAACAGAATGAAGAGGG + Intergenic
1057860138 9:98634480-98634502 ACAGAGACACAAAATGAAGAAGG + Intronic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058805792 9:108590378-108590400 ATTGAGCAACAGCATGAAGAAGG - Intergenic
1059201378 9:112420367-112420389 AATGATAAACAGTATGCAGAGGG + Intronic
1059229825 9:112709377-112709399 ATGGGAAAACAGAATGAATAAGG + Intronic
1059468466 9:114484907-114484929 AGTGAGAAATAGACTGGAGAGGG + Intronic
1059540380 9:115124647-115124669 CCTGAGAAACAGAATGTACAAGG - Intergenic
1059571372 9:115440045-115440067 AGTGAGAAACAATATGTAGAAGG - Intergenic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1059664716 9:116435665-116435687 GTTTAGAAACAGAATGAAGAAGG - Intronic
1059940831 9:119358162-119358184 AATGAGAATAAGGATGAAGAGGG + Intronic
1061387157 9:130297104-130297126 TTTGACAAAAAGAAAGAAGAAGG - Intronic
1061525640 9:131159264-131159286 ATTAAGAACCATAATGAACAAGG - Intronic
1061769447 9:132906730-132906752 ATTGAAAAAGATAAAGAAGAAGG - Exonic
1186192755 X:7082442-7082464 AGTGAGCAACAGAATCAAGTGGG + Intronic
1186193378 X:7087577-7087599 TTTGAGAAAGATAATTAAGATGG - Intronic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186618458 X:11214369-11214391 ATTGATAAAAAGAATGCAGTTGG + Intronic
1186852122 X:13590926-13590948 ATTGAGAACCAGACTGACGTGGG + Intronic
1186901986 X:14066309-14066331 ATTGAGAGAAACAGTGAAGAAGG + Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1187638320 X:21258842-21258864 ATTGTGAAACTGAAGGAAGATGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188310461 X:28610878-28610900 ATTGAGCAGCAGGATGTAGAGGG + Intronic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1189365777 X:40387474-40387496 ATTGAGGAACAGGAAGGAGATGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189806959 X:44744846-44744868 ATTAAGAGACAGAGTTAAGAAGG + Intergenic
1189838467 X:45044400-45044422 TTTCAGTAACAGAATGAAAAGGG - Intronic
1189878907 X:45468710-45468732 AGTCAAAAACAAAATGAAGATGG - Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1190937609 X:55010512-55010534 TTTGAGGAACAGTAAGAAGATGG - Intronic
1191013693 X:55787991-55788013 AGTGAGAAATAGACTGAAAAAGG + Intergenic
1192023639 X:67424952-67424974 AATGAGAAAGAAAATTAAGAAGG - Intergenic
1192254108 X:69441049-69441071 AATGAGAAACAGAAAAAAGCAGG - Intergenic
1193765829 X:85528095-85528117 AGTGGGGAACAGTATGAAGAGGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194551445 X:95305882-95305904 ATTGAAAAACAATATTAAGATGG + Intergenic
1195542912 X:106083845-106083867 ATTGAAAAAGAGAATCAAGTGGG - Intergenic
1196028345 X:111067223-111067245 AATGAGAAACAAGATAAAGATGG - Intronic
1196141102 X:112264674-112264696 AATGAGGAAGAGAAGGAAGATGG - Intergenic
1196392787 X:115226162-115226184 AGTGAGAAAGTGAATAAAGATGG + Intronic
1196555127 X:117076931-117076953 ATTGAGAAACAAAATGACTATGG + Intergenic
1197283974 X:124573208-124573230 CTTTAGAAACATAATGATGAAGG + Intronic
1197705312 X:129630473-129630495 ATTGAGGTACAGAATGGGGAGGG + Intergenic
1197711547 X:129674690-129674712 ATGGAGAAAAAGAAAGAAAAGGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1200369570 X:155709542-155709564 ATTGATAATCAGAATAAATAAGG - Intergenic
1201490208 Y:14532809-14532831 ATAGAGAAAAAGAAGGAAGGAGG - Intronic
1201501713 Y:14650744-14650766 CTTGAGAAATATAATAAAGATGG + Intronic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1201693837 Y:16800944-16800966 ATTCAGAGAGAGAAAGAAGAGGG - Intergenic