ID: 960076478

View in Genome Browser
Species Human (GRCh38)
Location 3:113491328-113491350
Sequence TATCTATAGCAGGCCGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 893
Summary {0: 1, 1: 1, 2: 13, 3: 110, 4: 768}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960076478 Original CRISPR TATCTATAGCAGGCCGGGCG TGG Intronic
900253550 1:1684463-1684485 TAAGAATAGGAGGCCGGGCGCGG + Intronic
900331896 1:2139297-2139319 TAATTAAAGCCGGCCGGGCGTGG + Intronic
900694936 1:4004006-4004028 TATTGATAGCAGGCCAGGCCAGG + Intergenic
900781290 1:4618983-4619005 TAATTATGGCAGGCCAGGCGCGG - Intergenic
901256630 1:7834208-7834230 AACCTAGAGCAGGCTGGGCGTGG - Intronic
901288217 1:8099925-8099947 TTTCTTTAATAGGCCGGGCGTGG - Intergenic
901331700 1:8414254-8414276 TTTCAATAGTCGGCCGGGCGTGG + Intronic
901554022 1:10017483-10017505 TATCTTGAGCAGGCCGGTCGCGG - Intergenic
901728825 1:11263178-11263200 AATCAATAGCTGGCCCGGCGCGG + Intergenic
901821259 1:11831119-11831141 TATATAAACCAGGCTGGGCGTGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902186287 1:14727993-14728015 AATCTAATGCTGGCCGGGCGCGG + Intronic
903220730 1:21868326-21868348 TACACATAGCAGGCTGGGCGTGG - Intronic
903255353 1:22094585-22094607 AATCTATTTCTGGCCGGGCGCGG - Intergenic
903465938 1:23552872-23552894 TAGGTATAGGAGGCCGGGCGCGG + Intergenic
903565238 1:24260220-24260242 GTTCTAGAGCTGGCCGGGCGCGG + Intergenic
903753298 1:25643559-25643581 TATATATAAAAGGCCAGGCGTGG - Intronic
903840159 1:26233442-26233464 ATTGTATAGGAGGCCGGGCGCGG - Intergenic
903940286 1:26925248-26925270 TAAATTTAGAAGGCCGGGCGCGG + Intronic
904506006 1:30954770-30954792 AACATATAGCAGGCCAGGCGTGG + Intronic
905115407 1:35634967-35634989 TTTTTGTAGAAGGCCGGGCGTGG + Intronic
905708362 1:40079684-40079706 AGCCTATAGAAGGCCGGGCGTGG - Intronic
905782841 1:40727819-40727841 TATTCATGGCAGGCTGGGCGCGG - Intronic
905783651 1:40734649-40734671 TATATAAAGCAGGCCGGGCACGG - Intronic
906064567 1:42971156-42971178 TATCCATGTCAGGCCGGGTGGGG + Intergenic
906232838 1:44180288-44180310 TAGCTCAAGCAGGCCGGGCAGGG + Intergenic
906362609 1:45176553-45176575 AATGTAGACCAGGCCGGGCGCGG - Intronic
906606194 1:47174037-47174059 TATTGCAAGCAGGCCGGGCGCGG + Intergenic
907004691 1:50899738-50899760 TATTTAAAGGAGGCTGGGCGTGG - Intronic
907024194 1:51099211-51099233 AAGATATAGCCGGCCGGGCGCGG + Intergenic
907831110 1:58064998-58065020 TATCTATTGTTGGCCGGGCGCGG - Intronic
907925413 1:58951265-58951287 TTTGTATAGCAGGCCGGGTACGG + Intergenic
908506869 1:64812053-64812075 TATTGATAACAGGCCAGGCGCGG + Intronic
908862788 1:68508342-68508364 TCTTCATAGGAGGCCGGGCGCGG - Intergenic
909300369 1:74005300-74005322 TGGAAATAGCAGGCCGGGCGCGG - Intergenic
909484236 1:76155765-76155787 TAAAAATAGGAGGCCGGGCGCGG - Intronic
909891316 1:81010929-81010951 TAAGAATAGAAGGCCGGGCGCGG + Intergenic
910352560 1:86315454-86315476 TATATATGGCAGGCCAGGCATGG + Intergenic
910970056 1:92847032-92847054 TAATTATAAGAGGCCGGGCGTGG - Intronic
911019299 1:93371168-93371190 TATTTCAAGCAGGCCAGGCGCGG + Intergenic
911381780 1:97124211-97124233 TATTTAGAGCAGGGCGGGGGTGG - Intronic
911704312 1:100993260-100993282 TAGCCATTGCAGGCCAGGCGTGG + Intronic
911986635 1:104634660-104634682 TATTTGAACCAGGCCGGGCGTGG + Intergenic
912076114 1:105878468-105878490 TAGTCAGAGCAGGCCGGGCGTGG + Intergenic
912357168 1:109063865-109063887 CAGCTATAGTAGGCCAGGCGCGG + Intronic
912415231 1:109503787-109503809 TATATAAACTAGGCCGGGCGCGG - Intergenic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912929954 1:113949126-113949148 TAGCGATAACAGGCCAGGCGCGG - Intronic
913288153 1:117246509-117246531 TATCTATGGCTGGACGGGCAAGG + Intergenic
914397891 1:147288401-147288423 GATCTATGGGAAGCCGGGCGTGG + Intronic
914706635 1:150175519-150175541 TAACATCAGCAGGCCGGGCGCGG - Intergenic
914935890 1:151979919-151979941 TAGATAAAGCAGGCCAGGCGCGG - Intergenic
914936123 1:151981874-151981896 TAAATATTCCAGGCCGGGCGCGG + Intergenic
915501055 1:156318000-156318022 TAACTGGAGCTGGCCGGGCGTGG - Intronic
915750744 1:158207568-158207590 TATCTTGAGGCGGCCGGGCGCGG - Intergenic
916054845 1:161061441-161061463 TATATAAAGCAGGTCAGGCGCGG - Intronic
916279447 1:163032830-163032852 TATTCATAGCTGGCCGGGCTCGG - Intergenic
916340028 1:163723148-163723170 TAGCTATTGAAGGCTGGGCGCGG + Intergenic
916828957 1:168471633-168471655 AATATATAAAAGGCCGGGCGCGG + Intergenic
917330524 1:173875615-173875637 TATATAATGCAGGCCGGGCGCGG - Intronic
917390833 1:174534484-174534506 TAACTAGAGCAGGCCAGGCAAGG + Intronic
917403815 1:174681988-174682010 TATATTTGGCAGGCCGGGCATGG + Intronic
918068899 1:181120691-181120713 TACTTAAAGGAGGCCGGGCGTGG - Intergenic
918077847 1:181183872-181183894 GATGTATAGGAGGCCGGGTGTGG - Intergenic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
919693404 1:200547775-200547797 TGTATATAGTAGGCCAGGCGCGG + Intergenic
920015779 1:202906950-202906972 TATATGTAACAGGCCGGGCACGG - Intronic
920162502 1:204010172-204010194 AAACTATATGAGGCCGGGCGTGG - Intergenic
920290217 1:204916924-204916946 TATCTATATCAGGCTGGGCACGG + Intronic
921131084 1:212220616-212220638 TACCTACCTCAGGCCGGGCGTGG + Intergenic
921480200 1:215656022-215656044 TAACTAGCACAGGCCGGGCGCGG - Intronic
921610751 1:217209612-217209634 TATCTATGTCAGGCTGGGCATGG - Intergenic
921717512 1:218433352-218433374 TATTTATCTCAGGCTGGGCGTGG - Intronic
923263431 1:232289174-232289196 TACATATGTCAGGCCGGGCGCGG - Intergenic
923946848 1:238897993-238898015 TATGTAAATCAGGCTGGGCGTGG + Intergenic
924473201 1:244361517-244361539 AATGTAGAACAGGCCGGGCGCGG - Intronic
924788957 1:247226232-247226254 AATCAATATCTGGCCGGGCGCGG - Intergenic
1063244084 10:4200801-4200823 TAGACAAAGCAGGCCGGGCGTGG + Intergenic
1063444246 10:6099173-6099195 AATCTATATGAGGCCGGGCACGG - Intronic
1063616368 10:7603871-7603893 TACCCATATCAGGCCGGGCGTGG - Intronic
1063778519 10:9292857-9292879 TATTTTGAGCAGGCCAGGCGAGG - Intergenic
1064018638 10:11791958-11791980 TATTTAAAGGGGGCCGGGCGAGG + Intergenic
1064659990 10:17597426-17597448 TATCCATTGCAGGCTGGGCGTGG - Intronic
1064818292 10:19292600-19292622 TAAATAATGCAGGCCGGGCGGGG + Intronic
1064910934 10:20401087-20401109 TACCTATAACAGGCTGGGCATGG + Intergenic
1065618152 10:27550105-27550127 TATCTATTCAAGGCCGGGCGCGG - Intergenic
1065708168 10:28490093-28490115 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1065781102 10:29168541-29168563 TATCTAAATCAGGCCAGGTGTGG + Intergenic
1067361081 10:45579721-45579743 TATCCACACCAGGCCAGGCGTGG + Intronic
1068452271 10:57207126-57207148 AAACCATAGCAGGCTGGGCGCGG + Intergenic
1068845346 10:61665595-61665617 TATCTAGGGAAGGCCGGGCGCGG + Intronic
1069166275 10:65164257-65164279 TATCTGTAGTTGGCCAGGCGCGG - Intergenic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1071348586 10:84716585-84716607 TATATTATGCAGGCCGGGCGCGG - Intergenic
1071364930 10:84889945-84889967 AATATACAGAAGGCCGGGCGCGG + Intergenic
1071577960 10:86743707-86743729 GTTATAGAGCAGGCCGGGCGAGG - Intergenic
1071581243 10:86772418-86772440 GATCTATCTCTGGCCGGGCGCGG - Intronic
1072063344 10:91839154-91839176 TATCTATCTTAGGCCGGGCACGG - Intronic
1072510374 10:96117709-96117731 TGTGTTTTGCAGGCCGGGCGCGG + Intergenic
1072545791 10:96436974-96436996 AATGTATAGCAGGCCAGGTGCGG - Intronic
1072708349 10:97698506-97698528 TGTGAATACCAGGCCGGGCGTGG + Intergenic
1072713377 10:97733059-97733081 TATAAAAATCAGGCCGGGCGCGG - Intergenic
1072819727 10:98544418-98544440 GAACTAGAGAAGGCCGGGCGCGG + Intronic
1072933912 10:99693625-99693647 TACATATAGCAGGCCGGGCACGG + Intronic
1073026989 10:100495114-100495136 TAGCTACAGTAGGCCTGGCGTGG - Intronic
1073183227 10:101598908-101598930 CATCTACTCCAGGCCGGGCGTGG - Intronic
1073261462 10:102193761-102193783 TAGCTGTTTCAGGCCGGGCGCGG + Intergenic
1073372862 10:103006494-103006516 AATCTAAAGCAGGCCAGGAGTGG - Intronic
1073771434 10:106739516-106739538 AATTTAAACCAGGCCGGGCGTGG + Intronic
1073992341 10:109276626-109276648 TACCTACATTAGGCCGGGCGCGG + Intergenic
1074484127 10:113855787-113855809 TGTGTGTGGCAGGCCGGGCGCGG - Intronic
1075825552 10:125354677-125354699 TAGCTAGACGAGGCCGGGCGCGG + Intergenic
1075865791 10:125718601-125718623 TAAATTTAACAGGCCGGGCGCGG - Intergenic
1076036892 10:127206432-127206454 AATATACAGTAGGCCGGGCGCGG - Intronic
1076315737 10:129539794-129539816 GATGTATCACAGGCCGGGCGCGG - Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1077071970 11:679020-679042 TATAAAAATCAGGCCGGGCGCGG + Intronic
1077647456 11:3938226-3938248 TTTCTCTAACAGGCCGGGCGCGG - Intronic
1077815962 11:5685580-5685602 TATCTGGAGAGGGCCGGGCGCGG + Intronic
1078276877 11:9857075-9857097 CATCTATGTTAGGCCGGGCGCGG - Intronic
1078299821 11:10117148-10117170 GATATGTATCAGGCCGGGCGTGG + Intronic
1078830125 11:14970607-14970629 AATTTATAATAGGCCGGGCGCGG + Intronic
1079037726 11:17035536-17035558 TATATATGGCTGGCTGGGCGTGG + Intergenic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079221966 11:18571060-18571082 TGTCTATTGAAGGCCGGGCGTGG + Intronic
1079222856 11:18579155-18579177 TATTAACTGCAGGCCGGGCGTGG - Intronic
1079642155 11:22819479-22819501 TAGCCAATGCAGGCCGGGCGCGG + Exonic
1079789457 11:24717703-24717725 TAACTATTGGGGGCCGGGCGCGG - Intronic
1079980279 11:27143841-27143863 TTTCTAATACAGGCCGGGCGCGG + Intergenic
1080524205 11:33097655-33097677 CATGTATTGCAGGCTGGGCGCGG - Intronic
1080660427 11:34291784-34291806 TAAACATATCAGGCCGGGCGTGG - Intronic
1081095578 11:38930100-38930122 CATAAGTAGCAGGCCGGGCGAGG + Intergenic
1081985337 11:47298076-47298098 TATGTAAAGAAGGCCGGGCGCGG - Intronic
1082045193 11:47720276-47720298 TCTATAAAGCAGGCCAGGCGCGG + Intronic
1082717771 11:56635747-56635769 AGACTATCGCAGGCCGGGCGCGG - Intergenic
1083320630 11:61843949-61843971 AACATATTGCAGGCCGGGCGTGG - Intronic
1083441816 11:62681658-62681680 ATTCTCTAGCAGGCCGGGCACGG - Intergenic
1084002367 11:66303510-66303532 TATTTACTTCAGGCCGGGCGCGG + Intergenic
1084134121 11:67162694-67162716 TAAAAATCGCAGGCCGGGCGCGG - Intronic
1084203741 11:67578790-67578812 TATCTTAAGCTGGCCGGGCACGG + Intergenic
1084322821 11:68383166-68383188 TCACTAAAGTAGGCCGGGCGCGG - Intronic
1084600015 11:70139612-70139634 TATTTGGTGCAGGCCGGGCGTGG - Intronic
1085097375 11:73772338-73772360 TACCCATATCTGGCCGGGCGCGG - Intergenic
1085281277 11:75332604-75332626 TACCTATAGCTGGCCAGGCGCGG + Intronic
1085985953 11:81788590-81788612 AATAGACAGCAGGCCGGGCGCGG - Intergenic
1086440381 11:86823714-86823736 AATTCAGAGCAGGCCGGGCGCGG + Intronic
1087043765 11:93827091-93827113 AATCTATAACAGGCCGGACACGG + Intronic
1088075673 11:105845590-105845612 TACCTATCCCAGGCCGGGCACGG + Intronic
1088333231 11:108674802-108674824 GATCTATTGTAGGCCAGGCGTGG - Intronic
1089819290 11:121209111-121209133 ATACAATAGCAGGCCGGGCGCGG - Intergenic
1090003136 11:122979092-122979114 TACCTACACCTGGCCGGGCGCGG - Intronic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1091510804 12:1123702-1123724 TACATAAAGCGGGCCGGGCGCGG + Intronic
1091872812 12:3909194-3909216 TACCTGAAGAAGGCCGGGCGCGG + Intergenic
1091941952 12:4493800-4493822 TGTCTACAGCTGGCCGGGAGTGG + Intronic
1091964410 12:4725842-4725864 CTTCAAAAGCAGGCCGGGCGTGG - Intronic
1092369435 12:7904337-7904359 TGTTAATAGCAGGCCGGGTGCGG - Intergenic
1092475405 12:8814776-8814798 TATATATTATAGGCCGGGCGTGG + Intergenic
1094588943 12:31803043-31803065 TATATATGCTAGGCCGGGCGCGG + Intergenic
1094613338 12:32014525-32014547 TATATATTGTAGGCCGGGCACGG + Intergenic
1095807623 12:46337785-46337807 TATCTATTTCTGGCCAGGCGTGG + Intergenic
1096276730 12:50215761-50215783 AAAATAAAGCAGGCCGGGCGCGG - Intronic
1096682063 12:53262467-53262489 TATATATATAAGGCTGGGCGCGG - Intergenic
1096732122 12:53622328-53622350 TAGAAATAGCTGGCCGGGCGTGG + Intronic
1096855239 12:54476718-54476740 AATCTATAGGAGGCTGGGGGTGG - Intergenic
1097064269 12:56309258-56309280 TAGCCAGTGCAGGCCGGGCGCGG + Intronic
1097126602 12:56781511-56781533 TATATTTAGCAGGCTGGGCGTGG + Intronic
1097868473 12:64579639-64579661 TGGCTATTGCTGGCCGGGCGCGG - Intergenic
1097873830 12:64624955-64624977 TAACTATTGCTGGCCAGGCGCGG - Intronic
1097883255 12:64705130-64705152 TAACAATGGCAGGCCAGGCGCGG + Intergenic
1097977134 12:65698719-65698741 AATCTATAAGTGGCCGGGCGTGG + Intergenic
1098058350 12:66533353-66533375 CATAAATATCAGGCCGGGCGTGG + Intronic
1098390388 12:69963836-69963858 CATCTAGTGAAGGCCGGGCGCGG + Intergenic
1098535238 12:71586694-71586716 CTTAAATAGCAGGCCGGGCGCGG - Intergenic
1099915522 12:88887861-88887883 AATAAAAAGCAGGCCGGGCGCGG + Intergenic
1100251939 12:92835169-92835191 GATTTATAGCTGGCCAGGCGCGG - Intronic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100362024 12:93888133-93888155 TAGAGATGGCAGGCCGGGCGCGG + Intronic
1100422010 12:94444106-94444128 TTTCTACCTCAGGCCGGGCGTGG + Intronic
1100543164 12:95577042-95577064 AAACTGAAGCAGGCCGGGCGTGG - Intergenic
1100968591 12:100041723-100041745 TGACAATAGCAGGCCGGGCGCGG - Intronic
1101105031 12:101432291-101432313 TCTTTATAGCTGGCCGGGCGCGG + Intergenic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1101981280 12:109409079-109409101 TATTTATTTCAGGCCAGGCGTGG - Intronic
1102125716 12:110478896-110478918 TATATATTTAAGGCCGGGCGCGG + Intronic
1102130659 12:110526124-110526146 AATCCACAGCAGGCCAGGCGGGG - Intronic
1102842298 12:116138144-116138166 AATTTATGTCAGGCCGGGCGTGG - Intronic
1103246891 12:119465465-119465487 TGTATAAAGCAGACCGGGCGAGG + Intronic
1104095551 12:125554131-125554153 TATCAACAGTAGGCCGGGCGCGG + Intronic
1104119201 12:125782715-125782737 TGTCAACAGCAGGCCAGGCGCGG - Intergenic
1104452362 12:128880932-128880954 TATTTGTAGTCGGCCGGGCGCGG + Intronic
1104839196 12:131812925-131812947 TATCTTTGGCGGGCCGGGCACGG - Intergenic
1105012172 12:132762896-132762918 TATCTAAATTAGGCGGGGCGCGG - Intergenic
1105016628 12:132789683-132789705 AAAATACAGCAGGCCGGGCGCGG + Intronic
1105016636 12:132789741-132789763 AAAATACAGCAGGCCGGGCGCGG + Intronic
1105367281 13:19776795-19776817 TACATATAGTAGGCCGGGCGCGG - Intronic
1105808763 13:23975045-23975067 GAACTATTACAGGCCGGGCGCGG - Intergenic
1106053610 13:26216662-26216684 TAGCTATTATAGGCCGGGCGCGG + Intronic
1106185920 13:27409540-27409562 TATCTGTATCAGGCCTGGCATGG - Intergenic
1106390685 13:29332923-29332945 GAACTAGAGAAGGCCGGGCGCGG - Intronic
1106566453 13:30888721-30888743 AATATGTAACAGGCCGGGCGTGG - Intergenic
1106664420 13:31836691-31836713 TATATAAAGAGGGCCGGGCGTGG + Intergenic
1107817742 13:44259276-44259298 CATCTATAGCAGGCAGGGGTGGG - Intergenic
1107870936 13:44745972-44745994 TATCTACCGAAGGCTGGGCGCGG - Intergenic
1108583973 13:51851811-51851833 AATATATAACAGGCTGGGCGCGG - Intergenic
1109146024 13:58780741-58780763 AATCCATTGCAGGCCAGGCGCGG - Intergenic
1109430085 13:62220800-62220822 TATGTGTAGCTGGCCGGGTGCGG + Intergenic
1109582104 13:64354432-64354454 TATCTCAAGAAGGCCGGACGCGG + Intergenic
1111054242 13:82926812-82926834 TATCTATGATAGGCCGGGAGCGG - Intergenic
1111752553 13:92352968-92352990 AATGTGTATCAGGCCGGGCGCGG + Intronic
1111801788 13:92989924-92989946 TGTCTATAGCAGCCTGGGTGTGG + Intergenic
1112570663 13:100590116-100590138 TATTAATATGAGGCCGGGCGCGG - Intergenic
1114235413 14:20819594-20819616 TGTTTACTGCAGGCCGGGCGCGG + Intergenic
1114695135 14:24620195-24620217 TGTTTATAGTAGGCCGGGCGCGG + Intergenic
1115030847 14:28792280-28792302 TATATGTTTCAGGCCGGGCGCGG + Exonic
1115110521 14:29815927-29815949 TAGTCATATCAGGCCGGGCGCGG + Intronic
1115133386 14:30080147-30080169 TACATATAGCAGGCTGGGTGCGG + Intronic
1115311311 14:31981019-31981041 AATGTAGAGAAGGCCGGGCGCGG - Intergenic
1115971495 14:38949527-38949549 TATCAGTTGTAGGCCGGGCGCGG - Intergenic
1115994105 14:39177400-39177422 TTTCTATGACAGGCTGGGCGGGG + Exonic
1116830708 14:49716672-49716694 AAGGTATAGCAAGCCGGGCGTGG - Intronic
1117500495 14:56346435-56346457 TATTTACAGTTGGCCGGGCGTGG + Intergenic
1117516522 14:56507406-56507428 TATCTATATTAGGCCAGGTGTGG + Intronic
1118360230 14:65050303-65050325 TAACTAAAGCTGGCCGGGCGTGG + Intronic
1118690175 14:68331071-68331093 GAACAATAGCTGGCCGGGCGCGG + Intronic
1119036462 14:71233786-71233808 TATGAATAACAGGCCGGGTGTGG + Intergenic
1119276793 14:73364208-73364230 AATATATAGCAGGCCAGGCATGG + Intronic
1119554960 14:75546150-75546172 TAGCAATTTCAGGCCGGGCGCGG - Intronic
1119875321 14:78054415-78054437 TACCTGGAACAGGCCGGGCGCGG - Intergenic
1120002891 14:79323567-79323589 TTTATATAGTAGGCCGGGCGTGG + Intronic
1120120427 14:80673351-80673373 GCACTAAAGCAGGCCGGGCGCGG + Intronic
1120315755 14:82890575-82890597 TATATAGAGGAGGCCAGGCGTGG - Intergenic
1121055794 14:90851326-90851348 TATCTTTACCAGGCCAGGTGCGG - Exonic
1121122727 14:91386151-91386173 AAAGTAGAGCAGGCCGGGCGCGG + Intronic
1121198191 14:92094228-92094250 AACCTATAGCCGGCTGGGCGTGG - Intronic
1121855077 14:97261123-97261145 AATAAATAACAGGCCGGGCGCGG + Intergenic
1122159253 14:99771072-99771094 TATCAGTGGGAGGCCGGGCGCGG - Intronic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1123184125 14:106498430-106498452 TATATATATATGGCCGGGCGCGG + Intergenic
1124042126 15:26115221-26115243 TATCTATAATAGGCCAGGCGCGG - Intergenic
1124059183 15:26272759-26272781 AATATAAACCAGGCCGGGCGCGG - Intergenic
1124945375 15:34260546-34260568 TAACTAAACAAGGCCGGGCGCGG - Intronic
1125503794 15:40255195-40255217 AATCTAGGGTAGGCCGGGCGCGG + Intronic
1125632460 15:41158448-41158470 AAGCTACAGTAGGCCGGGCGCGG + Intergenic
1125805755 15:42492199-42492221 TAAATATAGGCGGCCGGGCGCGG - Intronic
1125961541 15:43833923-43833945 TATAAATGGCAGGCCGGGTGTGG - Intronic
1126102659 15:45129313-45129335 TCTCTGTACCAGGCCGGGAGAGG - Intronic
1126624028 15:50668796-50668818 TATCTATTGTAGGCCAGGCATGG - Intronic
1126662306 15:51045208-51045230 TACCTATAGCCGGCCAGGCAGGG + Intergenic
1127098404 15:55536137-55536159 GAAATATAGCAGGCCGGGTGCGG - Intergenic
1127120669 15:55769118-55769140 TGTCTAATGAAGGCCGGGCGCGG + Intergenic
1127784270 15:62342305-62342327 TAAGAAAAGCAGGCCGGGCGCGG + Intergenic
1127823179 15:62678538-62678560 AATCTATAACAGGCTGGGCATGG + Intronic
1128030689 15:64477428-64477450 TAAGTAAAGCAGGCCAGGCGTGG - Intronic
1128208572 15:65874529-65874551 TATCTCAACTAGGCCGGGCGTGG - Intronic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128960895 15:72003404-72003426 ACTCAAAAGCAGGCCGGGCGCGG + Intronic
1128968411 15:72085102-72085124 TACCTGCAGCTGGCCGGGCGTGG + Intronic
1129201497 15:74004587-74004609 GATCTTTAGCAGGCTGGGCATGG - Intronic
1129512268 15:76133141-76133163 TAAATAAATCAGGCCGGGCGCGG + Intronic
1129536853 15:76320304-76320326 TGTCCATAGCAGGCTGGGCGTGG + Intergenic
1129673308 15:77618883-77618905 TAAGAATAACAGGCCGGGCGCGG - Intronic
1129873718 15:78958462-78958484 ATTCTAGAGCAGGCCGGGCGTGG - Intergenic
1131130287 15:89894682-89894704 AATATATAACAGTCCGGGCGCGG + Intronic
1131494163 15:92890494-92890516 GAAATATAGCAGGCCGGGCGCGG - Intronic
1131554522 15:93385676-93385698 GAATTAGAGCAGGCCGGGCGCGG + Intergenic
1131563352 15:93463196-93463218 TATTCAGAGCTGGCCGGGCGTGG + Intergenic
1132364710 15:101249091-101249113 AATGTAATGCAGGCCGGGCGCGG - Intronic
1132520576 16:385912-385934 TATTCAGAGTAGGCCGGGCGCGG - Intronic
1132818747 16:1850286-1850308 TAAAAATAACAGGCCGGGCGTGG + Intronic
1133201881 16:4208799-4208821 TATCTAAAACAGGCCGGGCCTGG + Intronic
1134048029 16:11115661-11115683 TACTTAAAACAGGCCGGGCGTGG - Intronic
1134503274 16:14785635-14785657 TTTTTATAGTGGGCCGGGCGTGG + Intronic
1134507118 16:14817005-14817027 TATATATATCAGGCCGGGCGCGG - Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134577293 16:15343263-15343285 TTTTTATAGTGGGCCGGGCGTGG - Intergenic
1134694818 16:16215762-16215784 TATATATATCAGGCCGGGCGCGG - Intronic
1134725151 16:16413230-16413252 TTTTTATAGTGGGCCGGGCGTGG + Intergenic
1134906177 16:17981752-17981774 AATCTATTGCTGGCCGGGCGTGG + Intergenic
1134942279 16:18298628-18298650 TTTTTATAGTGGGCCGGGCGTGG - Intergenic
1135031684 16:19043860-19043882 AAACAAAAGCAGGCCGGGCGCGG - Intronic
1135140275 16:19915471-19915493 TAAATATAGTGGGCCGGGCGCGG - Intergenic
1136220927 16:28828294-28828316 TAACAGTTGCAGGCCGGGCGCGG + Intronic
1136502843 16:30682052-30682074 TACGTATAGGAGGCCGGGTGCGG + Intergenic
1136549029 16:30972344-30972366 AATACATAGGAGGCCGGGCGCGG + Intronic
1137656487 16:50163687-50163709 AAATTATATCAGGCCGGGCGCGG - Intronic
1137759348 16:50927867-50927889 TGTTTTTAGCCGGCCGGGCGCGG - Intergenic
1138686010 16:58726469-58726491 TAAATAAAGCAGGCCGGGGGCGG - Intronic
1138724703 16:59123235-59123257 TATATATTGCAGGCCAGGAGTGG - Intergenic
1138905109 16:61322522-61322544 TATCTGTAGGTGGCCGGGCGCGG + Intergenic
1139332195 16:66201957-66201979 AAACTAAAGCAGGCCTGGCGTGG - Intergenic
1139541604 16:67622064-67622086 TATTTAGTGTAGGCCGGGCGCGG + Intronic
1139718223 16:68831378-68831400 AAGCTAAAGCAGTCCGGGCGTGG - Intronic
1139895054 16:70281859-70281881 TAATAATAGCTGGCCGGGCGTGG + Intronic
1140392395 16:74598600-74598622 TATATAAATAAGGCCGGGCGCGG + Intronic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142520431 17:500774-500796 TGTCGCTAGCTGGCCGGGCGTGG - Intergenic
1142523995 17:525396-525418 GATCTAAAGCAGGCAGGGTGTGG + Intronic
1142655754 17:1392557-1392579 TGTCTATATCTGGCCGGGTGCGG + Intronic
1142836245 17:2589746-2589768 TAGATCTATCAGGCCGGGCGTGG + Intergenic
1142859744 17:2754174-2754196 TATATATATACGGCCGGGCGCGG - Intergenic
1143000575 17:3792405-3792427 TATAGATATCAGGCCGGGCGCGG - Intronic
1143060187 17:4194075-4194097 TATATATATATGGCCGGGCGTGG - Intronic
1143523335 17:7458495-7458517 AAACTATAGTAGTCCGGGCGTGG + Intergenic
1144296404 17:13879132-13879154 TAAGAATAGCTGGCCGGGCGCGG + Intergenic
1144597681 17:16584746-16584768 TGTCTATCGCTGGCGGGGCGCGG + Intergenic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1144922190 17:18773221-18773243 TAGCTCTTGCAGGCCGGGCACGG - Intronic
1145037189 17:19549482-19549504 TTGCTGGAGCAGGCCGGGCGCGG - Intronic
1145045363 17:19610201-19610223 TATATATTCTAGGCCGGGCGCGG - Intergenic
1146087462 17:29843242-29843264 TTACTATAGCAGGCTGGGCGCGG + Intronic
1146367822 17:32243013-32243035 TATCTATTGCTGGCGGGGTGTGG + Intronic
1146374113 17:32282910-32282932 TCTCCACAGAAGGCCGGGCGCGG - Intronic
1146762252 17:35488777-35488799 AGTATATAGCTGGCCGGGCGCGG + Intronic
1146852808 17:36238099-36238121 TATCTAATACAGGCCGGGCACGG + Intronic
1146868718 17:36361991-36362013 TATCTAATACAGGCCAGGCGCGG + Intronic
1147071593 17:37962615-37962637 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147083119 17:38042139-38042161 TATCTAATACAGGCCGGGCGCGG + Intronic
1147099062 17:38166112-38166134 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147127742 17:38383832-38383854 AATATAGAGCAGGCTGGGCGCGG - Intronic
1147185781 17:38712473-38712495 TATTTTTAGCAGGCGGGGCCGGG + Intronic
1147257205 17:39188750-39188772 TAATAATAGCAGGCCGGGCACGG + Intronic
1147283315 17:39380867-39380889 TAAAACTAGCAGGCCGGGCGTGG + Intronic
1147634375 17:41954275-41954297 TACATATGTCAGGCCGGGCGTGG - Intronic
1147697360 17:42365942-42365964 TAGCTTTAACAGGCCGGGCACGG - Intronic
1148261307 17:46186083-46186105 ATTCTAAAGGAGGCCGGGCGCGG + Intronic
1148696322 17:49561790-49561812 TTTCCATTTCAGGCCGGGCGCGG + Intergenic
1148831642 17:50436417-50436439 TAACAACAACAGGCCGGGCGTGG - Intronic
1148878046 17:50704222-50704244 AATCTACAAGAGGCCGGGCGCGG + Intronic
1149618542 17:58022999-58023021 TACCTACAGTAGGCAGGGCGAGG - Intergenic
1149802336 17:59581482-59581504 TATGTATTGTAGGCCGGGTGCGG + Intronic
1149844156 17:59994008-59994030 TATGTATTGTAGGCCGGGTGCGG - Intergenic
1149888092 17:60360836-60360858 TACATAAAGTAGGCCGGGCGCGG + Intronic
1149897705 17:60441866-60441888 TAAATATGGCAGGCCAGGCGTGG - Intergenic
1150066806 17:62117214-62117236 AACATATAACAGGCCGGGCGAGG + Intergenic
1150068080 17:62128385-62128407 TATCTATTCCCGGCCGGGTGTGG + Intergenic
1150080599 17:62235155-62235177 TATCTAATACAGGCCGGGCGCGG + Intergenic
1150106478 17:62466034-62466056 TATCTAATACAGGCCAGGCGTGG - Intronic
1150163556 17:62919817-62919839 GATCTATAACTGGCTGGGCGCGG + Intergenic
1150279926 17:63923846-63923868 TATATATACCTGGCCGGGCGCGG - Intergenic
1151174007 17:72272149-72272171 TTTATATTTCAGGCCGGGCGTGG + Intergenic
1151482817 17:74380216-74380238 TATATTTAGCAGGCGGGGCGGGG + Intergenic
1151791619 17:76309035-76309057 AATTTATGGCAGGCTGGGCGCGG - Intergenic
1151812758 17:76454184-76454206 TATAAAAAGTAGGCCGGGCGCGG + Intronic
1152018241 17:77766071-77766093 GATTTAGAGCAGGCCGGGCGCGG + Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152273283 17:79338227-79338249 TATCTGGAGAAGGCCAGGCGCGG - Intronic
1152775506 17:82199185-82199207 AAGCTATAGCAGGCTGGGTGTGG + Intronic
1152853678 17:82651536-82651558 AATCTACAGTAGGCCGGGCGCGG + Intergenic
1152868136 17:82736243-82736265 AATGTATGGAAGGCCGGGCGCGG + Intronic
1153048561 18:879536-879558 TATCCATCATAGGCCGGGCGCGG - Intergenic
1153579734 18:6560799-6560821 TATCTAAAGCAGGCTGGGCGTGG - Intronic
1153670374 18:7406186-7406208 TATCAATTGAAGGCCGGGCGCGG - Intergenic
1154240929 18:12653655-12653677 AAAATATATCAGGCCGGGCGTGG + Intronic
1154272901 18:12935271-12935293 TAACTACTGCAGGCTGGGCGCGG + Intergenic
1154951534 18:21214942-21214964 AAGCAATAGCAGGCCGGGCCCGG - Intergenic
1155136186 18:22995015-22995037 TAAAGATAGCAGGCTGGGCGTGG - Intronic
1155530390 18:26760642-26760664 AATGACTAGCAGGCCGGGCGTGG - Intergenic
1155814744 18:30292610-30292632 TATATTTATCTGGCCGGGCGCGG + Intergenic
1157462851 18:47916677-47916699 TACCTATACCAGGCGGGGCATGG - Intronic
1159352678 18:67296091-67296113 TATCTATCTCTGGCCGGGTGCGG + Intergenic
1160728763 19:630865-630887 AATCTATTGCTGGCCGGGCATGG + Intronic
1160906663 19:1454855-1454877 TAAAAATAGCCGGCCGGGCGCGG - Intronic
1161205884 19:3041315-3041337 TAGCAATGGCAGGCTGGGCGCGG - Intronic
1161207481 19:3048803-3048825 AAACAAAAGCAGGCCGGGCGCGG - Intergenic
1161263493 19:3351243-3351265 TATATATGGTTGGCCGGGCGCGG + Intergenic
1161416677 19:4151065-4151087 AATATAAACCAGGCCGGGCGTGG + Intergenic
1161531059 19:4789966-4789988 TATCTCATGCCGGCCGGGCGCGG - Intergenic
1161795807 19:6386093-6386115 AAACTAAAACAGGCCGGGCGTGG + Intronic
1162324359 19:9990101-9990123 TAACTAAAAGAGGCCGGGCGTGG + Intronic
1162380833 19:10330771-10330793 TACCTTTAGCTGGCTGGGCGGGG + Intronic
1162749408 19:12819415-12819437 TAACATTTGCAGGCCGGGCGCGG - Intronic
1162946979 19:14049896-14049918 TATATATAGAAGGCCCGGCATGG + Intronic
1163450015 19:17371461-17371483 TAAAAATAGCTGGCCGGGCGTGG - Intronic
1163604794 19:18268086-18268108 TTTGAAAAGCAGGCCGGGCGCGG - Intronic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1164000874 19:21097154-21097176 TATCCTGAACAGGCCGGGCGTGG - Intronic
1164096566 19:22015317-22015339 CATCTATGACAGGCCAGGCGTGG - Intergenic
1164116069 19:22219943-22219965 CATCTATGACAGGCTGGGCGTGG - Intergenic
1164183352 19:22839035-22839057 CATTTCTAGAAGGCCGGGCGTGG - Intergenic
1164199766 19:23007443-23007465 CATCTATGACAGGCTGGGCGCGG - Intergenic
1165557844 19:36650939-36650961 TTCCTAGAGCTGGCCGGGCGTGG + Intronic
1165988807 19:39793864-39793886 TATCTATTGAAGGCAGGGCACGG + Intergenic
1166144116 19:40822529-40822551 TAGCTAGAGCTGGCCGGGCGCGG + Intronic
1166183496 19:41124551-41124573 TAGCTAGAGCTGGCCGGGCGCGG - Intronic
1166396121 19:42442522-42442544 TATCTGCAACTGGCCGGGCGCGG - Intronic
1166614771 19:44233604-44233626 GGTGTATGGCAGGCCGGGCGTGG + Intronic
1166639678 19:44484868-44484890 GATGTTTAGCAGGCCGGGTGCGG + Intronic
1166721686 19:45000863-45000885 TGTTTATTGGAGGCCGGGCGCGG - Intergenic
1166865333 19:45832717-45832739 AATGTACAGCAGGCTGGGCGTGG + Intronic
1167020265 19:46869299-46869321 TATATATAGTTGGCCAGGCGTGG + Intergenic
1167111796 19:47466775-47466797 TGTTCATAGCAGGCCGGGTGCGG + Intronic
1167378191 19:49123317-49123339 CAACGATAACAGGCCGGGCGTGG - Intronic
1167396231 19:49231235-49231257 AAACTAAAACAGGCCGGGCGTGG - Intergenic
1168050750 19:53827837-53827859 TATATATAGAAGGCTGGGTGTGG + Intergenic
1168243965 19:55100900-55100922 GATCTGTTGCAGGCTGGGCGTGG - Intronic
1168362335 19:55752529-55752551 TAACTAAAAGAGGCCGGGCGCGG - Intergenic
1168399776 19:56078833-56078855 TATATATATCAGGCCAGGTGCGG + Intergenic
1168437013 19:56326225-56326247 TACGTATATCAGGCCAGGCGTGG - Intronic
1168495516 19:56844883-56844905 AAGCAATAGCAGGCCGGGTGCGG - Intergenic
925858014 2:8149324-8149346 TATATATACCTGGCCGGGCATGG + Intergenic
926035948 2:9635796-9635818 TATCCATATCTGGCCAGGCGTGG - Intergenic
926878226 2:17509767-17509789 TATGTATATCCAGCCGGGCGCGG + Intergenic
927369424 2:22337511-22337533 AATCTTTATTAGGCCGGGCGCGG + Intergenic
927500553 2:23580078-23580100 AATCTAGACCAGGCCGGGCGCGG + Intronic
927644022 2:24863994-24864016 GCTCTATAGGAGGCCGGACGTGG + Intronic
927663060 2:25009057-25009079 TTTATATATGAGGCCGGGCGTGG + Intergenic
927741325 2:25572175-25572197 TATCTGCACCAGGCCGGGCGCGG + Intronic
927892747 2:26762680-26762702 TCTCTATTACCGGCCGGGCGTGG + Intergenic
927901563 2:26823202-26823224 TATCTTTAGGCAGCCGGGCGTGG + Intergenic
927931292 2:27046712-27046734 TATGTGTAGTAGGCTGGGCGTGG - Intronic
928043314 2:27900751-27900773 AAATTATAGTAGGCCGGGCGCGG + Intronic
928517056 2:32053611-32053633 AATCTATAGTGGGCCGGGCGAGG - Intergenic
928952565 2:36826133-36826155 AACCTATAGCTGGCCGGGAGTGG + Intergenic
929185549 2:39090403-39090425 AATCTTTAGCAGGCCTGGTGTGG + Intronic
929205753 2:39290778-39290800 TAACAATAACGGGCCGGGCGTGG + Intronic
929222312 2:39477239-39477261 TATCTATAACAGGCTGGGCATGG - Intergenic
929378757 2:41324040-41324062 AATAAAAAGCAGGCCGGGCGCGG + Intergenic
930204729 2:48576763-48576785 TACCGTTTGCAGGCCGGGCGCGG + Intronic
930352992 2:50281012-50281034 AATCCATAATAGGCCGGGCGCGG + Intronic
930406990 2:50971292-50971314 AAACAATAACAGGCCGGGCGTGG + Intronic
930709164 2:54533839-54533861 TTACTACAGCAGGCCGGGCGTGG - Intronic
930780062 2:55215982-55216004 TATCTGTAAAAGGCCGGGCACGG + Intronic
930804895 2:55480415-55480437 TATATATATATGGCCGGGCGAGG + Intergenic
930808447 2:55516636-55516658 TATGTATAACAGGCCGGGTGCGG - Intergenic
930822550 2:55661383-55661405 TCTTTATTGCAGGCCGGGCGTGG - Intronic
930864719 2:56111176-56111198 TATGGAAGGCAGGCCGGGCGTGG - Intergenic
930938866 2:56989003-56989025 TTTCTTTCCCAGGCCGGGCGCGG - Intergenic
931210058 2:60184608-60184630 AATCTACACCTGGCCGGGCGCGG + Intergenic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
931753161 2:65348510-65348532 TATCTATAGCAGGCTGGAAGCGG + Intronic
932224251 2:70026958-70026980 AAGCTATAGCAGGCTGGGTGTGG + Intergenic
933715797 2:85359561-85359583 TATTTTTAGCACACCGGGCGTGG - Intronic
934081521 2:88472429-88472451 TCTCTATCTCAGGCCAGGCGCGG - Intergenic
935527390 2:104187433-104187455 TAGACCTAGCAGGCCGGGCGCGG - Intergenic
935717257 2:105950231-105950253 TATAGAAAGCAGGCCGGGCATGG + Intergenic
935998889 2:108805433-108805455 TAAGTATTGCAGGCCAGGCGCGG + Intronic
936054340 2:109249972-109249994 GATCTGGTGCAGGCCGGGCGCGG - Intronic
936778630 2:116004379-116004401 TACTTATAACTGGCCGGGCGTGG - Intergenic
937405625 2:121625722-121625744 TTTCTCAAGCAGGCTGGGCGCGG - Intronic
937417223 2:121725396-121725418 TGTCTATAGCTGGCTGGGGGTGG + Intergenic
937720410 2:125088710-125088732 TATTTATATCAGGCCAGGCGTGG - Intergenic
938375362 2:130801823-130801845 AAGGTACAGCAGGCCGGGCGCGG + Intergenic
938546754 2:132340178-132340200 TACTGATAGCAGGCCAGGCGCGG + Intergenic
940563511 2:155331904-155331926 TCTCTACAATAGGCCGGGCGCGG - Intergenic
940893871 2:159061945-159061967 AATATAAAGTAGGCCGGGCGTGG + Intronic
941700616 2:168600492-168600514 GAAGTATGGCAGGCCGGGCGTGG - Intronic
941817631 2:169813562-169813584 TACCTAAAACTGGCCGGGCGCGG + Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941834072 2:169996987-169997009 AATCCAAAGCAGGCCGGGCATGG - Intronic
942019677 2:171854276-171854298 TCTGCATAGCAGGCCAGGCGCGG + Intronic
942297602 2:174532900-174532922 TAACTTAAGCAGGCCAGGCGCGG - Intergenic
942341751 2:174956478-174956500 AATGAATAACAGGCCGGGCGTGG + Intronic
942465019 2:176198632-176198654 TAACTATTTCCGGCCGGGCGCGG + Intergenic
942677754 2:178446303-178446325 GATCTATGCCAGGCTGGGCGGGG - Intronic
943438902 2:187901758-187901780 TAGCCAGGGCAGGCCGGGCGCGG + Intergenic
943923784 2:193744620-193744642 TATGAATACCTGGCCGGGCGCGG + Intergenic
944609720 2:201390252-201390274 CATGTATAGCTGGCCGGGTGCGG + Intronic
944714090 2:202361742-202361764 AATCTATAAAAGGCCGGGCGCGG - Intergenic
945452928 2:210014377-210014399 TACCTACTCCAGGCCGGGCGCGG - Intronic
946259534 2:218475325-218475347 TATGTAAAGAAGGCTGGGCGAGG + Intronic
947359655 2:229334255-229334277 TATCTGTTGGAGGCCGGGCGTGG - Intergenic
948052183 2:234987060-234987082 AACCATTAGCAGGCCGGGCGGGG - Intronic
1169083076 20:2809377-2809399 GATCTTTAACTGGCCGGGCGCGG + Intergenic
1169124757 20:3119561-3119583 CATCTATCTCAGGCCAGGCGCGG + Intronic
1169770768 20:9197683-9197705 AAACTAAACCAGGCCGGGCGCGG + Intronic
1169854585 20:10089292-10089314 TATCTATAGGAGGATGGGTGTGG + Intergenic
1170067194 20:12325893-12325915 TAGTTACAGGAGGCCGGGCGCGG + Intergenic
1170995970 20:21359239-21359261 TTTATAAAACAGGCCGGGCGCGG + Intronic
1171297261 20:24028924-24028946 AATTTATTGTAGGCCGGGCGTGG - Intergenic
1171507569 20:25651005-25651027 TATCTATACAAGGCTGGGCGTGG - Intergenic
1172239455 20:33402736-33402758 TCTCCGTGGCAGGCCGGGCGTGG + Intergenic
1172283861 20:33727352-33727374 AAACTAAAACAGGCCGGGCGTGG + Intergenic
1172456940 20:35084007-35084029 TACAGAAAGCAGGCCGGGCGCGG + Intronic
1172479986 20:35265586-35265608 TATATTTATTAGGCCGGGCGCGG + Intronic
1172559513 20:35874264-35874286 AATTTATAGCAGGCCAGGTGTGG - Intronic
1173111351 20:40193331-40193353 TATCTATGTGTGGCCGGGCGCGG - Intergenic
1173513129 20:43645917-43645939 TTTCTATAGTGGGCCGGGCGCGG + Intronic
1173528993 20:43754180-43754202 AATGTGTAGCAGGCCGGGTGCGG - Intergenic
1173804337 20:45914042-45914064 TATAAATAGGCGGCCGGGCGCGG - Intergenic
1174079246 20:47959306-47959328 TATCTATAGTGGGCCGGGCGCGG - Intergenic
1174228412 20:49023826-49023848 ACTGTATATCAGGCCGGGCGCGG - Intronic
1174608268 20:51777381-51777403 TACCCACAACAGGCCGGGCGCGG + Intergenic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1174805740 20:53603137-53603159 TATAGACAACAGGCCGGGCGCGG + Intronic
1175730710 20:61352005-61352027 TAACTAAAGGAGGCCGGGTGCGG - Intronic
1176729468 21:10478087-10478109 TATTTACTGCAGGCTGGGCGTGG - Intergenic
1177117118 21:17100050-17100072 TAATTCTAGCTGGCCGGGCGCGG + Intergenic
1177219368 21:18171495-18171517 GAACTAAAGAAGGCCGGGCGCGG - Intronic
1178140745 21:29680842-29680864 TAAACATAGCAGGCTGGGCGTGG + Intronic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1179096326 21:38319049-38319071 TATCTATTGGTGGCCGGGCACGG + Intergenic
1179230188 21:39496208-39496230 TATCTTTATTTGGCCGGGCGCGG + Intronic
1179350807 21:40609243-40609265 AATCTGAAGCAGGCTGGGCGCGG - Intronic
1179512558 21:41883498-41883520 TTTATATAATAGGCCGGGCGCGG - Intergenic
1179826740 21:43970294-43970316 TGTTAACAGCAGGCCGGGCGTGG - Intronic
1180637745 22:17274420-17274442 TAACTAAAATAGGCCGGGCGCGG - Intergenic
1181227418 22:21400738-21400760 AATTTAAAACAGGCCGGGCGCGG + Intergenic
1181815976 22:25437234-25437256 TATCTACACTAGGCCAGGCGTGG - Intergenic
1181828244 22:25537474-25537496 TACCCAAAGGAGGCCGGGCGCGG + Intergenic
1181980449 22:26762299-26762321 ATTCTAAAGCAGGCCGGGCATGG + Intergenic
1182393480 22:30018911-30018933 TAGCATTTGCAGGCCGGGCGCGG + Intronic
1182902888 22:33913120-33913142 TATCAAAATCAGGCCGGGCTTGG - Intronic
1183120761 22:35728511-35728533 TGTCTAAAGTCGGCCGGGCGCGG - Intronic
1183149351 22:36025972-36025994 AATGTATAGAAGGCCGGGTGTGG + Intronic
1183222747 22:36527548-36527570 TATTTCTTGGAGGCCGGGCGCGG + Intronic
1183400435 22:37600623-37600645 TTTATTTAGCAGGCTGGGCGAGG + Intergenic
1183701664 22:39454517-39454539 TATCTCTGACAGGCTGGGCGTGG + Intergenic
1184126498 22:42491118-42491140 TAGCAATAACAGGCTGGGCGTGG + Intergenic
1184559485 22:45253661-45253683 TGTTCATAGCAGGCTGGGCGCGG + Intergenic
1184742302 22:46435987-46436009 TGTTCATAACAGGCCGGGCGTGG - Intronic
949956986 3:9277307-9277329 TTTGTATACCAGGCCGGGCATGG + Intronic
950470349 3:13180979-13181001 TATATGAAGCAGGCTGGGCGCGG + Intergenic
951226276 3:20125031-20125053 TATATACATGAGGCCGGGCGCGG + Intronic
951329543 3:21349666-21349688 GATGTAAAGCTGGCCGGGCGTGG + Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
952050465 3:29378180-29378202 TGTCTATTTCAGGCCGGGCACGG + Intronic
952051284 3:29387610-29387632 AATGTATAGATGGCCGGGCGCGG + Intronic
952369565 3:32708186-32708208 TAATAATAGCTGGCCGGGCGTGG - Intronic
952468506 3:33618236-33618258 TATCCTCACCAGGCCGGGCGCGG - Intronic
952510468 3:34048555-34048577 AAGCTATAGTAGGCTGGGCGCGG - Intergenic
952938214 3:38417899-38417921 TATATATATCAGGCCGGGCGTGG + Intronic
952996584 3:38889133-38889155 TACCTATTGCAGGCCAGGCACGG + Intronic
953131338 3:40142341-40142363 AATCAACAGCAGGCCGGGTGCGG - Intronic
953164019 3:40448129-40448151 TACCTAAAAGAGGCCGGGCGCGG + Intergenic
953328210 3:42030380-42030402 TATATATATATGGCCGGGCGTGG + Intronic
953522046 3:43652914-43652936 TATCAATGCCAGGCCGGGTGTGG + Intronic
953702246 3:45205907-45205929 TATATATATATGGCCGGGCGCGG - Intergenic
953978117 3:47397959-47397981 TATCTTCACCAGGCGGGGCGCGG - Intronic
954247028 3:49340065-49340087 GGTCTATAGCACGCCGCGCGCGG - Exonic
954406185 3:50346219-50346241 AGTGTATATCAGGCCGGGCGCGG + Exonic
954739439 3:52736294-52736316 TAATTATAGCAGGCCGGGCCTGG + Intronic
955009355 3:54999034-54999056 CAACTTTAGCTGGCCGGGCGCGG - Intronic
955281454 3:57598185-57598207 AAGGTGTAGCAGGCCGGGCGCGG - Intronic
955287152 3:57653453-57653475 TATTAGTAGTAGGCCGGGCGCGG + Intronic
955644236 3:61119502-61119524 TAACTATAACAGGCTGGGCACGG - Intronic
955792603 3:62604118-62604140 AACGTATAGCAGGCCGGGTGAGG - Intronic
956094314 3:65700151-65700173 AATCAATAGCAGGCTGGGCGCGG + Intronic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
957060899 3:75480546-75480568 TACTTATTGCAGGCCGGGCATGG + Intergenic
957680031 3:83421783-83421805 TAACTAAAGCAGGCCAGGCACGG - Intergenic
957822368 3:85394083-85394105 TAACTATTTCAGGCCAGGCGCGG - Intronic
958686443 3:97403734-97403756 TAACTTTAAAAGGCCGGGCGCGG - Intronic
958772512 3:98442589-98442611 CAGGTATAGCCGGCCGGGCGCGG - Intergenic
959115159 3:102168449-102168471 TAAATAAAGTAGGCCGGGCGCGG - Intronic
959383034 3:105665738-105665760 TATCTGTATCTGGCTGGGCGTGG + Intronic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960078518 3:113515328-113515350 GGTATATAGCAGGCCGGGCGCGG + Intergenic
960089191 3:113622172-113622194 AAACTATTTCAGGCCGGGCGCGG + Intronic
960652963 3:119971899-119971921 ATTTTATTGCAGGCCGGGCGCGG - Intronic
962115826 3:132506340-132506362 AATGTACAGAAGGCCGGGCGCGG - Intronic
962414918 3:135173322-135173344 AAACTATTTCAGGCCGGGCGCGG - Intronic
963132649 3:141872925-141872947 CCTCTACAGTAGGCCGGGCGAGG - Intergenic
964044545 3:152307277-152307299 TATGAATAGTAGGCTGGGCGCGG - Intronic
964240706 3:154590204-154590226 AATAAATACCAGGCCGGGCGCGG - Intergenic
964353274 3:155824002-155824024 TACCTATTGCAGGCTGGGCATGG - Exonic
964455257 3:156858380-156858402 TATATTTATCAGGCCAGGCGCGG + Intronic
965537055 3:169834069-169834091 TATATATTTCAGGCCTGGCGCGG + Intronic
966502380 3:180657947-180657969 TATTAATAGCAGGCCAGGTGCGG + Intronic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967594670 3:191315301-191315323 TTTGTAGAGTAGGCCGGGCGTGG - Intronic
968016799 3:195342703-195342725 AAACTTTAGCAGGCTGGGCGCGG + Intronic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968376759 4:50290-50312 TATAAATAGCCGGCCGGGCGCGG + Intergenic
968587045 4:1423813-1423835 TACCTAAAAGAGGCCGGGCGCGG - Intergenic
968782298 4:2592376-2592398 TAAATGTAGCAGGCTGGGCGCGG - Intronic
968864070 4:3196444-3196466 TATCCATTGCAGGCCAGGTGTGG + Intronic
968920906 4:3521843-3521865 TAACTATTTTAGGCCGGGCGCGG + Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969210303 4:5682198-5682220 TAGCAATAGCAGGCCGGGGGCGG + Intronic
969251640 4:5972291-5972313 AATTGAAAGCAGGCCGGGCGCGG - Intronic
969595311 4:8145472-8145494 AATCAATACCTGGCCGGGCGCGG - Intronic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
970239628 4:13994908-13994930 AATAAATAGCTGGCCGGGCGCGG - Intergenic
970327772 4:14945102-14945124 TTTCTTTTGCCGGCCGGGCGCGG - Intergenic
970349880 4:15191806-15191828 TATGCATAGGAGGCCGGGCGCGG + Intergenic
970642367 4:18081232-18081254 TACCTATTGCAGGGCGGGAGTGG + Intergenic
970776024 4:19675131-19675153 TACCTATTGGGGGCCGGGCGTGG + Intergenic
970946746 4:21701992-21702014 TATTTTTAGTAGGCCGGGCATGG - Intronic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
972096403 4:35352081-35352103 TATCTACAAGAGGCCAGGCGTGG + Intergenic
972233486 4:37102299-37102321 TATGTATGGCCGGCCAGGCGTGG + Intergenic
972541183 4:40040773-40040795 TATCTCAAGCAGGCCAGGTGTGG - Intergenic
973674144 4:53247567-53247589 TAACAAGATCAGGCCGGGCGCGG + Intronic
974084308 4:57243023-57243045 AATCTATGACAGGCCGGGCGTGG - Intergenic
974127793 4:57717189-57717211 GAACTAGAGAAGGCCGGGCGCGG + Intergenic
974259768 4:59510683-59510705 TATCACTAAGAGGCCGGGCGCGG - Intergenic
974434891 4:61844255-61844277 TGTCTATAGATGGCCAGGCGCGG + Intronic
975151060 4:71021363-71021385 TAGAAATAGCAGGCCGGGCGCGG - Intronic
976189094 4:82472064-82472086 TAACTATAATCGGCCGGGCGCGG + Intergenic
976260939 4:83144215-83144237 TTTCTTTAGCAGGCTGGGTGCGG - Intergenic
976415524 4:84769710-84769732 TAATAAAAGCAGGCCGGGCGCGG - Intronic
976568151 4:86576482-86576504 GGCCTATAGTAGGCCGGGCGCGG + Intronic
976576791 4:86681635-86681657 TATATAATGTAGGCCGGGCGTGG + Intronic
976629612 4:87222872-87222894 TACATATTGTAGGCCGGGCGTGG - Intronic
976707332 4:88033134-88033156 TATCTGTTACAGGCTGGGCGCGG + Intronic
977332269 4:95652361-95652383 TATATATTATAGGCCGGGCGCGG + Intergenic
977941857 4:102868356-102868378 AATCCAAAGCTGGCCGGGCGCGG - Intronic
978101635 4:104848550-104848572 TATCAAGGTCAGGCCGGGCGTGG - Intergenic
978411176 4:108427661-108427683 TATCTACATCTGGCCGGGCATGG - Intergenic
978561762 4:110041368-110041390 TACCTACTGCAGGCCGGGTGTGG - Intergenic
978780722 4:112550560-112550582 AGTCTACAGTAGGCCGGGCGCGG + Intronic
979269961 4:118747973-118747995 TACCTATAGTAGGCCGGGCGTGG + Intronic
979595213 4:122527257-122527279 TATAGATAGAAGGCCGGGCACGG + Intergenic
979653977 4:123169769-123169791 AATATAGAACAGGCCGGGCGCGG - Intronic
979745814 4:124211858-124211880 TAATTATCACAGGCCGGGCGTGG + Intergenic
980144819 4:128969280-128969302 TTCCTATTGCTGGCCGGGCGCGG + Intronic
980764793 4:137287697-137287719 AATGTATTGCAGGCCGGGTGCGG - Intergenic
980777789 4:137459089-137459111 TAACAATAGCAGGCCTGGCGCGG - Intergenic
981314850 4:143332028-143332050 TATCCAAATCAGGCCGGGCGAGG - Intergenic
981986971 4:150869207-150869229 TCTCTATGGTAGGCCGGCCGTGG - Intronic
982160995 4:152569368-152569390 TATCTGGCCCAGGCCGGGCGCGG + Intergenic
982205342 4:152993655-152993677 TATATGCATCAGGCCGGGCGCGG - Intergenic
982254803 4:153441463-153441485 TTACTAGAGCAGGCCGGGTGCGG + Intergenic
982581625 4:157186394-157186416 TACATAAAGCTGGCCGGGCGCGG - Intergenic
982939497 4:161531912-161531934 TATTTTTAGAGGGCCGGGCGTGG + Intronic
983086424 4:163450500-163450522 TATATTTTGTAGGCCGGGCGCGG - Intergenic
983729262 4:170972712-170972734 AATATATAAGAGGCCGGGCGCGG - Intergenic
984049516 4:174846301-174846323 AATGTAAAGGAGGCCGGGCGCGG - Intronic
984083737 4:175282721-175282743 TAGCTAGAGTCGGCCGGGCGTGG + Intergenic
984613854 4:181873357-181873379 TACTTATATTAGGCCGGGCGTGG - Intergenic
984693642 4:182757020-182757042 GATCTTCAGGAGGCCGGGCGCGG + Intronic
985063270 4:186098620-186098642 TAGCTATATCTGGCAGGGCGCGG - Intergenic
985221055 4:187705959-187705981 TATACATAACAGGCCGGGCGCGG + Intergenic
985335764 4:188892015-188892037 TAGCTAGAAGAGGCCGGGCGCGG - Intergenic
985504420 5:271000-271022 AAGCAAAAGCAGGCCGGGCGCGG - Intergenic
985782660 5:1879279-1879301 TAAAAATAGTAGGCCGGGCGCGG - Intronic
986550894 5:8953732-8953754 TATCAAAAGCTGGCCGGGCGTGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
987178920 5:15346131-15346153 TACCTATCGGAGGCCGGGCGCGG + Intergenic
987317964 5:16741852-16741874 CATCTTTAGCAGTCCGGGCAAGG + Intronic
987769829 5:22287432-22287454 AATGTATAACAGGCTGGGCGCGG + Intronic
987875182 5:23672573-23672595 TTTGGAAAGCAGGCCGGGCGCGG + Intergenic
987878328 5:23710190-23710212 TATCAATTTTAGGCCGGGCGTGG - Intergenic
987946746 5:24619481-24619503 CATCTAAATCAGGCCGGGCACGG - Intronic
987994804 5:25263294-25263316 TATTTTTCTCAGGCCGGGCGTGG + Intergenic
988037028 5:25840492-25840514 TATCTGCAGCTGGCCGAGCGTGG + Intergenic
989182888 5:38596024-38596046 TACCTATTGTGGGCCGGGCGCGG - Intronic
990505939 5:56445365-56445387 TATCTATATCTGGTCGGGCGCGG + Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
991121087 5:63015241-63015263 TATAAATCACAGGCCGGGCGTGG + Intergenic
991332200 5:65503944-65503966 TTTTTTTAGCAGGCCGGGCACGG - Intergenic
991673028 5:69065971-69065993 TAAAAATAGGAGGCCGGGCGTGG - Intergenic
991697458 5:69286521-69286543 TATCTAAAGTTGGCCGGGCGCGG - Intronic
992419537 5:76589021-76589043 TACCAATACCTGGCCGGGCGTGG + Intronic
992449698 5:76864995-76865017 AAAGTATAGTAGGCCGGGCGTGG - Intronic
992953737 5:81886992-81887014 TAAGAAAAGCAGGCCGGGCGCGG - Intergenic
993782238 5:92081507-92081529 TATCAAGTGCAGGCTGGGCGCGG - Intergenic
995866879 5:116701099-116701121 TATTTATTGTAGGCCGGGCGCGG + Intergenic
996359335 5:122628089-122628111 ATTCTAGAGCTGGCCGGGCGCGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
996743051 5:126819776-126819798 TATATAAAGCCAGCCGGGCGTGG - Intronic
997567218 5:134897537-134897559 TATCTATAATAGGCCAGGCACGG - Intronic
997866026 5:137463657-137463679 TAACTAAAAGAGGCCGGGCGTGG + Intronic
998311837 5:141140151-141140173 TATCTATAGATGGCCAGGTGTGG - Intronic
998410832 5:141910074-141910096 ACTGTATATCAGGCCGGGCGTGG - Intergenic
998470652 5:142381288-142381310 TATATATGACAGGCCGGGCACGG - Intergenic
999129150 5:149269671-149269693 AATTTATGGGAGGCCGGGCGCGG + Intergenic
999390986 5:151190373-151190395 TAGCAATTTCAGGCCGGGCGTGG + Intronic
999562217 5:152816333-152816355 AATATATTGGAGGCCGGGCGTGG - Intergenic
1000463245 5:161547559-161547581 TATTTATAGCAGGAGGGGAGGGG + Intronic
1000616727 5:163436116-163436138 TCTTTATGGCAGGCTGGGCGCGG - Intergenic
1001499645 5:172220343-172220365 AAGCTATAGCTGGCCGGGCACGG + Intronic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001787784 5:174428339-174428361 AATTTACAGCAGGCTGGGCGCGG - Intergenic
1001895136 5:175372312-175372334 TAACTATTGGGGGCCGGGCGCGG - Intergenic
1002341773 5:178521261-178521283 TATTTAAAGCTGGCCGGGCGCGG + Intronic
1002469691 5:179428006-179428028 TCGCCATCGCAGGCCGGGCGCGG + Intergenic
1002506593 5:179683421-179683443 TATATGTAGTTGGCCGGGCGCGG - Intronic
1002933587 6:1652080-1652102 TATCCTTAACAGGCCGGGTGTGG + Intronic
1003086913 6:3068032-3068054 TATGCACATCAGGCCGGGCGCGG - Intronic
1003662569 6:8076611-8076633 TATATTTTGTAGGCCGGGCGTGG - Intronic
1004064212 6:12227078-12227100 TATATATTACAGGCCAGGCGTGG - Intergenic
1004691861 6:17999042-17999064 GAACTCTTGCAGGCCGGGCGCGG + Intergenic
1005044168 6:21625996-21626018 TCTAAATATCAGGCCGGGCGTGG + Intergenic
1005282004 6:24284315-24284337 AATGTAAAGCAGGCCAGGCGTGG + Intronic
1005297959 6:24445315-24445337 TACCTATTTCAGGCCGGGTGCGG - Intronic
1005298687 6:24450219-24450241 TATCTAAAATAGGCCGGGCACGG + Intronic
1005619505 6:27606730-27606752 TAACTGTTGCCGGCCGGGCGCGG - Intergenic
1005642795 6:27812860-27812882 TATGGACAACAGGCCGGGCGCGG + Intergenic
1005903238 6:30237683-30237705 TACATATATGAGGCCGGGCGCGG + Intergenic
1006514853 6:34540008-34540030 AATTTAGGGCAGGCCGGGCGTGG + Intronic
1007458098 6:41996438-41996460 TAAATATATCAGGCTGGGCGCGG - Intronic
1007568963 6:42875405-42875427 TACCTATAACTGGCCGGGCGCGG + Intergenic
1007596979 6:43057165-43057187 TATTTATAACCGGCCGGGTGTGG - Intronic
1009240614 6:61182017-61182039 GATATATAACAGGCCGGGCGCGG + Intergenic
1009337065 6:62504658-62504680 ATGCTATACCAGGCCGGGCGCGG + Intergenic
1010347426 6:74827682-74827704 ACTGTATAGCTGGCCGGGCGCGG - Intergenic
1010648115 6:78418202-78418224 GATACAAAGCAGGCCGGGCGTGG - Intergenic
1010651677 6:78462986-78463008 TCTCCAAAGCAGGCTGGGCGTGG + Intergenic
1010976758 6:82324406-82324428 TATCAATATCAGGCCAGGTGCGG + Intergenic
1011144728 6:84200986-84201008 TATGCAATGCAGGCCGGGCGCGG + Intronic
1011145443 6:84209663-84209685 TAGCTATAATAGGCCGGGTGTGG - Intronic
1011893948 6:92200938-92200960 AAGTTAGAGCAGGCCGGGCGCGG + Intergenic
1012562969 6:100609050-100609072 TATTTATAGCAGGCCAGGCGCGG - Intronic
1012889193 6:104879711-104879733 TATCTATTCTGGGCCGGGCGCGG - Intergenic
1013122064 6:107149832-107149854 GAACAATATCAGGCCGGGCGCGG - Intergenic
1013129697 6:107221050-107221072 TACCTATATCAGGACGGGCGCGG + Intronic
1013521355 6:110936591-110936613 TATAGATCCCAGGCCGGGCGTGG - Intergenic
1013649664 6:112181806-112181828 TAACTGTCACAGGCCGGGCGCGG + Intronic
1013800504 6:113936699-113936721 TAACAATAGCAAGCCAGGCGCGG + Exonic
1014742600 6:125163633-125163655 TAAGTACAACAGGCCGGGCGTGG + Intronic
1015600213 6:134904174-134904196 TATCTGCACCAGGCCGGGCGCGG - Intergenic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016851753 6:148626620-148626642 TCTTCACAGCAGGCCGGGCGCGG + Intergenic
1017106019 6:150888882-150888904 TAACTATTAAAGGCCGGGCGTGG + Intronic
1017632454 6:156410247-156410269 CATCAATGGCGGGCCGGGCGAGG + Intergenic
1017797183 6:157856037-157856059 AATCAATGACAGGCCGGGCGTGG - Intronic
1018002504 6:159592069-159592091 TAAATACACCAGGCCGGGCGCGG + Intergenic
1018048639 6:159988223-159988245 AAAGCATAGCAGGCCGGGCGCGG + Intronic
1018195004 6:161347904-161347926 AAGTTAGAGCAGGCCGGGCGCGG - Exonic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019652416 7:2167255-2167277 CATGATTAGCAGGCCGGGCGCGG + Intronic
1019726414 7:2605328-2605350 TCCCTATAGTAGGCCGGGCGCGG + Intronic
1020034349 7:4955760-4955782 AATTTAAAGCTGGCCGGGCGTGG + Intronic
1020036849 7:4969021-4969043 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1020065633 7:5186393-5186415 TATATATTGCAGGCCGGGCGTGG + Intergenic
1020089243 7:5329010-5329032 TATTGATAGAAGGCCAGGCGTGG + Intronic
1020220117 7:6229843-6229865 TATCTATCTCAGGCTGGGCTGGG + Intronic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1020247568 7:6441705-6441727 TATGTATTGAAGGCCAGGCGCGG - Intronic
1020530088 7:9322286-9322308 AAACTAGAACAGGCCGGGCGCGG - Intergenic
1020691600 7:11361588-11361610 ACTCAATAGAAGGCCGGGCGCGG - Intergenic
1020885906 7:13819158-13819180 TATCTATATTCGGCCGGGCGCGG + Intergenic
1020983817 7:15107484-15107506 CACATATAGCAGGCTGGGCGTGG + Intergenic
1021458783 7:20860945-20860967 TATCTAATGGCGGCCGGGCGCGG - Intergenic
1021576975 7:22113831-22113853 TAATAATAACAGGCCGGGCGTGG + Intergenic
1021841723 7:24726531-24726553 TAACAATGGTAGGCCGGGCGCGG + Intronic
1022076783 7:26979147-26979169 TAACAAAAGCAGGCTGGGCGTGG - Intronic
1022116833 7:27268238-27268260 TATTTTTTGCAGGCCGGGCGCGG - Intergenic
1022228188 7:28385384-28385406 TATGTATATGAGGCCAGGCGTGG + Intronic
1022337673 7:29437306-29437328 TATCTAAAACCGGCTGGGCGCGG + Intronic
1022402778 7:30056231-30056253 TATGTTTTGCAGGCCGGGCGTGG - Intronic
1022699991 7:32750782-32750804 AAACTAAACCAGGCCGGGCGCGG + Intergenic
1024415113 7:49096954-49096976 TAGCTATAGCAGGCCATGGGTGG + Intergenic
1024994099 7:55258091-55258113 TATAGAAAGCCGGCCGGGCGCGG - Intergenic
1025928575 7:65978098-65978120 TATCTTTTTCAGGGCGGGCGCGG - Intronic
1026091076 7:67301537-67301559 TATCTGAAGTGGGCCGGGCGCGG - Intergenic
1026427469 7:70310800-70310822 TATCTTTTGCAGGCCGAGCCAGG - Intronic
1026600887 7:71776397-71776419 TAAAAATAGTAGGCCGGGCGCGG - Intergenic
1026701811 7:72653789-72653811 AATCCTTAGCAGGCCAGGCGTGG + Intronic
1027117071 7:75489676-75489698 AATGTATAGCAGGCCAGGCGCGG - Intergenic
1027191593 7:75999834-75999856 TATACATAACAGGCCGGGCGCGG - Intronic
1027198352 7:76046969-76046991 AATATGTATCAGGCCGGGCGCGG + Intronic
1027229900 7:76266156-76266178 TATATAAATAAGGCCGGGCGCGG - Intronic
1027274738 7:76545928-76545950 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1027533699 7:79368556-79368578 TGTCTATTGTAGGCCAGGCGCGG + Intronic
1027877042 7:83784186-83784208 TATCTAATACAGGCCGGGTGCGG + Intergenic
1028255873 7:88597259-88597281 TATCTACTGGGGGCCGGGCGCGG + Intergenic
1028334803 7:89638555-89638577 AATGTAAAGTAGGCCGGGCGCGG - Intergenic
1028959333 7:96731712-96731734 CATGAAAAGCAGGCCGGGCGCGG + Intergenic
1029140712 7:98407866-98407888 AAACTCTAGGAGGCCGGGCGCGG - Intergenic
1029212141 7:98917829-98917851 TATGTAAAGAAGGCCGGGCACGG + Intronic
1029522318 7:101071099-101071121 AATCAATAGCAGGCCAGGCATGG + Intergenic
1029702136 7:102254170-102254192 TTTCTTTTGCAGGCAGGGCGTGG + Exonic
1029720432 7:102360386-102360408 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1030001770 7:105072019-105072041 TACCATTAGGAGGCCGGGCGCGG + Intronic
1030013518 7:105195337-105195359 CATATTTAGCAGGCCGGGCATGG - Intronic
1030065069 7:105653164-105653186 TAGCAATATCAGGCCGGGCATGG + Intronic
1030250688 7:107440961-107440983 TATCAATCCCAGGCCGGGCGTGG + Intronic
1030311469 7:108073294-108073316 ATCCTATAGCTGGCCGGGCGCGG - Intronic
1031249422 7:119360102-119360124 TTGCTATATCAGGCCGGGCGCGG - Intergenic
1031589321 7:123570324-123570346 GAGCTATGGCAGGCTGGGCGCGG - Intronic
1032373352 7:131383011-131383033 TATCCGTAGCTGGCCGGGTGTGG - Intronic
1032830044 7:135613817-135613839 TATTAGTAGCAGGCCGGGCACGG - Intronic
1032852455 7:135806686-135806708 TAAATATAGGAGGCCAGGCGAGG + Intergenic
1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG + Intronic
1033354683 7:140590097-140590119 CATGTAATGCAGGCCGGGCGCGG + Intronic
1033715287 7:143995722-143995744 AATCAATTGCCGGCCGGGCGCGG - Intergenic
1034168034 7:149040722-149040744 AATTTAAAACAGGCCGGGCGTGG + Intergenic
1034183394 7:149156014-149156036 TATATAAAACTGGCCGGGCGCGG - Intronic
1034247276 7:149656544-149656566 AGTTTATAGCAGGCCGGGTGTGG + Intergenic
1034310450 7:150083234-150083256 TATCTAGAGGAGGCTGGGCATGG - Intergenic
1034509867 7:151525363-151525385 TATATATATCAGGCTGGGCGCGG + Intergenic
1034708544 7:153170475-153170497 TGTCTATAGCAGGCTGAGTGAGG - Intergenic
1034796392 7:154017407-154017429 TATCTAGAGGAGGCTGGGCATGG + Intronic
1035994410 8:4530201-4530223 TAACAATGGCAGGCCTGGCGCGG - Intronic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036980317 8:13462694-13462716 TAAGAATAGTAGGCCGGGCGCGG - Intronic
1037039871 8:14217919-14217941 AATCTTTAGTTGGCCGGGCGTGG - Intronic
1037314678 8:17589939-17589961 TAACAATTGCAGGCCGGGTGCGG + Intronic
1037371997 8:18190078-18190100 TGTCAATAGCAGGCTGGGTGTGG - Intronic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037795085 8:21986441-21986463 TATATATTGAAGGCGGGGCGCGG - Intronic
1037872583 8:22512784-22512806 AATTTATTGCAGACCGGGCGCGG + Intronic
1038181272 8:25230558-25230580 TATTTATACCAGGCTGGGCATGG + Intronic
1038749367 8:30281688-30281710 TTTGAAAAGCAGGCCGGGCGCGG + Intergenic
1039698996 8:39943445-39943467 AACCTATAGCTGGCCGGGCGCGG + Intronic
1040824714 8:51608545-51608567 AAAGTATTGCAGGCCGGGCGCGG + Intronic
1041279138 8:56194006-56194028 TACCTAATGAAGGCCGGGCGTGG - Intronic
1041633960 8:60121582-60121604 ATTAAATAGCAGGCCGGGCGCGG + Intergenic
1041788196 8:61659258-61659280 TATCTACAGCATGCCGGGACTGG - Intronic
1042897609 8:73688002-73688024 TAAAGATAGTAGGCCGGGCGCGG - Intronic
1042921061 8:73920023-73920045 TAACTGTATCAGGCTGGGCGTGG - Intergenic
1043208038 8:77473104-77473126 TCTATATTACAGGCCGGGCGCGG + Intergenic
1043884753 8:85586191-85586213 TATCTATAAAAGGCCGGGCGCGG - Intergenic
1044227193 8:89733007-89733029 TATATAAGGCAGGCCGGGCATGG + Intergenic
1045044250 8:98259363-98259385 TATTTAAAGGAGGCCGGGTGCGG - Intronic
1045219875 8:100188443-100188465 TATTTATAGCAGGCCAGGCTTGG - Intronic
1045792962 8:106007271-106007293 AAAATACAGCAGGCCGGGCGCGG - Intergenic
1045857096 8:106776943-106776965 AATCCACAGCTGGCCGGGCGCGG - Intergenic
1046183611 8:110684621-110684643 AATATGTTGCAGGCCGGGCGCGG + Intergenic
1047342174 8:123993150-123993172 AATGTATATCCGGCCGGGCGCGG + Intronic
1047949743 8:129922571-129922593 TATCTAATAAAGGCCGGGCGCGG + Intronic
1048665939 8:136661560-136661582 AAGAAATAGCAGGCCGGGCGCGG + Intergenic
1049109408 8:140634371-140634393 TATGTTTACCCGGCCGGGCGAGG - Intronic
1050276627 9:4007862-4007884 TACCCATGGCAGGTCGGGCGGGG + Intronic
1050576303 9:6999374-6999396 TATTAAAAACAGGCCGGGCGCGG + Intronic
1051182145 9:14422790-14422812 TATCTATGGCTGGCAGGGCTGGG - Intergenic
1051277915 9:15414945-15414967 AATCTAGACCAGGCCGGGCGCGG + Intergenic
1052288470 9:26815452-26815474 AATGCATATCAGGCCGGGCGCGG + Intergenic
1052426746 9:28314692-28314714 TAAATATATGAGGCCGGGCGCGG + Intronic
1052838435 9:33269682-33269704 GATATGTAGCAGGCCGGGTGCGG + Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053378498 9:37628906-37628928 CTACTATATCAGGCCGGGCGCGG + Intronic
1055220680 9:73927005-73927027 TATATATATTAGGCCGGGCATGG - Intergenic
1056157417 9:83852153-83852175 TATCTCTATCAGCCTGGGCGCGG + Intronic
1056353127 9:85771947-85771969 TATCTATATCAGGCTGGGCGCGG - Intergenic
1056387447 9:86110770-86110792 AATCAATGGCAGGCTGGGCGTGG - Intergenic
1057149989 9:92787907-92787929 TGTCTATAGAGGGCTGGGCGCGG + Intergenic
1057320637 9:94009583-94009605 TGTTTAGAACAGGCCGGGCGCGG + Intergenic
1057356392 9:94335147-94335169 TATCTAAAGAAGGCCAGGCACGG - Intergenic
1057601682 9:96463543-96463565 TATCTAAAGCAGGCTGGGCTCGG - Intronic
1057651357 9:96922480-96922502 TATCTAAAGAAGGCCAGGCACGG + Intronic
1059070826 9:111134185-111134207 TAAATATAGGAGGCCGGGCGTGG + Intergenic
1059230411 9:112716330-112716352 AATGAATAGCAGGCCGGGAGCGG - Intronic
1059854951 9:118386002-118386024 GATATATAACAGGCCGGGCGCGG - Intergenic
1060257416 9:122044817-122044839 TATCAAAAACAGGCTGGGCGAGG + Intronic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060953928 9:127624293-127624315 TAACTATAACAGGCCGGGCATGG + Intronic
1061350592 9:130061651-130061673 TAGCCAGGGCAGGCCGGGCGTGG + Intronic
1062537077 9:137025736-137025758 TGCCCATAGCAGGCCGGGTGTGG - Intronic
1062559211 9:137132212-137132234 TTTCTATTTCAGGCCGGGTGCGG - Intergenic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1203572471 Un_KI270744v1:143956-143978 TATAAATAGCCGGCCGGGCGCGG - Intergenic
1185673437 X:1829645-1829667 AGTCCATTGCAGGCCGGGCGTGG - Intergenic
1185730753 X:2459815-2459837 TATCTACACTGGGCCGGGCGCGG + Intronic
1186398242 X:9232302-9232324 TGTCTTTTGCAGGCCGGGCATGG + Intergenic
1186493017 X:9989697-9989719 ACTATATTGCAGGCCGGGCGAGG - Intergenic
1186785429 X:12952432-12952454 TATATATAATAGGCCGGGCATGG - Intergenic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1187137683 X:16563976-16563998 TATGTATAACAGGCCGGGTGTGG - Intergenic
1187371544 X:18712040-18712062 AAGCTATAGTAGGCCTGGCGTGG - Intronic
1187461684 X:19492674-19492696 TATATGTTTCAGGCCGGGCGCGG + Intronic
1187890728 X:23932702-23932724 TAGCAACAGGAGGCCGGGCGTGG + Intronic
1187897494 X:23996373-23996395 AAACCATATCAGGCCGGGCGTGG + Intronic
1188359929 X:29240523-29240545 TATATTTATAAGGCCGGGCGAGG - Intronic
1188365127 X:29306238-29306260 TATTTATGGGGGGCCGGGCGCGG + Intronic
1188522662 X:31056410-31056432 TATGTATATAAGGCCAGGCGTGG + Intergenic
1189080047 X:37961072-37961094 AATCTGGAGGAGGCCGGGCGCGG - Intronic
1189093725 X:38115192-38115214 TACTTATTTCAGGCCGGGCGCGG + Intronic
1189391750 X:40582135-40582157 AACCTATGGGAGGCCGGGCGCGG + Intronic
1190005163 X:46729481-46729503 TATCTCTTGCTGGCTGGGCGTGG + Intronic
1190516702 X:51231319-51231341 TAACAATTGCAGGCCGGGTGTGG + Intergenic
1190738870 X:53274749-53274771 CAGCTAAAGCAGGCCGGGTGCGG - Intronic
1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG + Intergenic
1192098997 X:68243676-68243698 TATATATAACAGGCCAGGCATGG - Intronic
1192487676 X:71544074-71544096 TATATATATCAGGCCGGGCGTGG - Intronic
1193379768 X:80805643-80805665 TACCTACCCCAGGCCGGGCGCGG + Intronic
1193990473 X:88300364-88300386 TATGTATTCCAGGCCGGGCGCGG - Intergenic
1194011924 X:88572528-88572550 TAACTACAACTGGCCGGGCGCGG + Intergenic
1194062240 X:89217465-89217487 TAACTATGTAAGGCCGGGCGCGG - Intergenic
1194305003 X:92233003-92233025 TATTTAGGGCAGGCCGGGCGCGG - Intronic
1194362914 X:92976726-92976748 TATGGGTAGCTGGCCGGGCGCGG - Intergenic
1194817746 X:98464802-98464824 AATGAAAAGCAGGCCGGGCGTGG - Intergenic
1195391913 X:104371027-104371049 TCTCCATTGCAGGCCGGGTGCGG - Intergenic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1195633797 X:107090083-107090105 TGTCTAATGGAGGCCGGGCGTGG + Intronic
1195642904 X:107196738-107196760 TACATAAAGGAGGCCGGGCGTGG - Intronic
1195934154 X:110109225-110109247 TACATATAGCTGGCCAGGCGCGG + Intronic
1196106885 X:111906062-111906084 TGTCATTAACAGGCCGGGCGCGG + Intronic
1196301584 X:114054565-114054587 TATGTTGAGAAGGCCGGGCGTGG - Intergenic
1196635193 X:117994024-117994046 TAAATGCAGCAGGCCGGGCGTGG - Intronic
1196780433 X:119378680-119378702 TACCTAGAAGAGGCCGGGCGCGG + Intergenic
1197221844 X:123921832-123921854 TATATATTTCAGGCCGGGCATGG - Intergenic
1197687772 X:129460355-129460377 TATCAATATTAGGCCGGGCACGG + Intronic
1197742372 X:129905209-129905231 TATATATATTAGGCCGGGCCCGG + Intergenic
1197782036 X:130168915-130168937 TATCAATTCCAGGCCGGGCACGG + Intergenic
1198092181 X:133342325-133342347 TAGATATTGCAGGCCGGGCATGG - Intronic
1198245083 X:134822845-134822867 TATGTACAACAGGCCAGGCGCGG + Intronic
1198470974 X:136946741-136946763 AAGCCATACCAGGCCGGGCGTGG + Intergenic
1198825881 X:140697278-140697300 TAGGTATAGCAGGCTGGGCATGG - Intergenic
1199106159 X:143871372-143871394 TAAGAATAGCAGGCCGGGCACGG + Intergenic
1200172304 X:154086210-154086232 TATATATAACAGGCTGGGCGTGG - Intronic
1200328311 X:155265629-155265651 TACACATAGAAGGCCGGGCGCGG - Intergenic
1200664475 Y:6003909-6003931 AATATAAAACAGGCCGGGCGCGG + Intergenic
1200671157 Y:6092955-6092977 TATGGGTAGCTGGCCGGGCGCGG - Intergenic
1200756027 Y:6990845-6990867 AAAATAAAGCAGGCCGGGCGCGG - Intronic
1200764362 Y:7068009-7068031 AAACTAGAGCAGGCCAGGCGCGG + Intronic
1201698877 Y:16858142-16858164 AATCACAAGCAGGCCGGGCGTGG + Intergenic
1201786128 Y:17781288-17781310 TACATATATTAGGCCGGGCGCGG - Intergenic
1201815425 Y:18124700-18124722 TACATATATTAGGCCGGGCGCGG + Intergenic