ID: 960076798

View in Genome Browser
Species Human (GRCh38)
Location 3:113495421-113495443
Sequence CCAACCTGCTTGGCTATAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960076798 Original CRISPR CCAACCTGCTTGGCTATAGC CGG (reversed) Intronic
904906784 1:33903402-33903424 GCAAACTGCTTGGCCAGAGCGGG - Intronic
908793130 1:67802806-67802828 ACACCCAGCTTTGCTATAGCAGG - Intronic
914449682 1:147779970-147779992 CCAAACTGCTTGGCTGTATCTGG - Intergenic
916827377 1:168455517-168455539 CCATCCTGACTGGCTATCGCTGG - Intergenic
921811054 1:219514948-219514970 CCAGCTTGATTGGCTACAGCTGG + Intergenic
1064691158 10:17919913-17919935 CCAACCTGGGTGGCACTAGCTGG - Intergenic
1066044894 10:31586410-31586432 GCCACCTGCTTGGCTATTCCTGG - Intergenic
1067686280 10:48467729-48467751 CCAGGCTGCTTAGCTCTAGCAGG - Intronic
1067970743 10:50967642-50967664 CCAACCTTTATGGCTATAACTGG - Intergenic
1069719267 10:70539415-70539437 CTAACCTGCTTGGCTTTGGGGGG + Intronic
1074489099 10:113923043-113923065 CCCACCTTCTTGGCCACAGCTGG - Intergenic
1079364964 11:19801201-19801223 CCAACCAGTTTGGCAACAGCAGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1086366638 11:86113703-86113725 CCAGCTTGCTTGGCTATTACAGG - Intergenic
1086542734 11:87932090-87932112 CTAATCTCCCTGGCTATAGCTGG - Intergenic
1088026038 11:105184709-105184731 AGAATCAGCTTGGCTATAGCTGG + Intergenic
1089112287 11:116066315-116066337 CCAACCTGCTTGACTATATGTGG + Intergenic
1091842828 12:3633073-3633095 CCAGCCTGCTGGGCGACAGCTGG - Intronic
1094744586 12:33330090-33330112 CAAAGCAGCTTGCCTATAGCTGG - Intergenic
1096573902 12:52540775-52540797 CCAACCTCCATGTCTACAGCCGG + Intergenic
1100379572 12:94049080-94049102 CTCACCTGCTGGGCTCTAGCTGG + Intergenic
1107465770 13:40648701-40648723 ACATCCTGCTTGGCTATGCCTGG - Intronic
1108453592 13:50590826-50590848 CCACACTGCTTGTCTACAGCAGG + Intronic
1110567161 13:76968128-76968150 CCAACCTCCCTGGCTTCAGCGGG + Intergenic
1111965359 13:94856495-94856517 CCAACCACCTTGTCCATAGCAGG + Intergenic
1112160703 13:96864622-96864644 CCATCCTGGTTGGCTATATGAGG + Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1120365346 14:83561555-83561577 CCAACCTCCCTGGCTCCAGCAGG - Intergenic
1124552530 15:30694837-30694859 CCCAGATGCTTGGCTATTGCAGG + Intronic
1124678709 15:31710829-31710851 CCCAGATGCTTGGCTATTGCAGG - Intronic
1138262632 16:55636231-55636253 CCAACCTCCTTAGCCATTGCTGG - Intergenic
1138810099 16:60139561-60139583 CCAGCCATGTTGGCTATAGCTGG - Intergenic
1139122964 16:64042888-64042910 CCATCCTCCCTGGGTATAGCTGG - Intergenic
1140194697 16:72846655-72846677 ACAACCTGCACGGCTTTAGCTGG + Intronic
1142291531 16:89195581-89195603 CCACCCTGCTTGGCTGGGGCAGG + Intergenic
1142614405 17:1126258-1126280 CCCACCAGCATGGCTATAGGAGG + Intronic
1145778075 17:27543361-27543383 CCAACCTGCCTCTCCATAGCTGG - Intronic
1148085187 17:44989654-44989676 CCAGCATGCGTGGCTATAGGGGG - Intergenic
1162672793 19:12271947-12271969 CCAATCTTCTTGCATATAGCAGG + Exonic
1163498787 19:17663239-17663261 ACAACCTGCTTGTCTCCAGCTGG - Intronic
1163872150 19:19830989-19831011 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1163886145 19:19966426-19966448 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
1163888323 19:19989052-19989074 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1163958441 19:20665166-20665188 CCAACCTCCCTGGCTCTAGCAGG + Intronic
1164551777 19:29218163-29218185 CCAGCCTGCTTGGCAAGAGATGG - Intergenic
1166559255 19:43720898-43720920 CCAACCTGTTTAGCCATTGCTGG - Intergenic
1167676460 19:50889454-50889476 TGAACCTTCTTGGCTCTAGCTGG - Intergenic
927721331 2:25384530-25384552 CCAGCCTGCTTGACCATACCAGG - Intronic
933129473 2:78655119-78655141 CCATCCTCCTTGGCTCCAGCAGG - Intergenic
933602554 2:84347881-84347903 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
933730624 2:85453522-85453544 TCTACCTGCTAGGCTCTAGCAGG - Intergenic
934700512 2:96436086-96436108 CAAATCTGTTTGGCTATTGCAGG - Intergenic
935208079 2:100913963-100913985 CCAAGATGCATGGCTGTAGCTGG - Intronic
935597514 2:104890683-104890705 CAAACCTGCTGGGCCTTAGCAGG + Intergenic
939391112 2:141570711-141570733 CCAGCCTCCTTGGCTTCAGCAGG - Intronic
940912281 2:159219165-159219187 GAAACCTGCCTGGGTATAGCAGG + Intronic
946546443 2:220749392-220749414 CCAGCCTCCCTGGCTTTAGCAGG - Intergenic
946740304 2:222794807-222794829 CCACCGTGCTTGTTTATAGCTGG - Intergenic
948831205 2:240599138-240599160 ACAGCCTGCTTGGCAAGAGCAGG - Intronic
1173627442 20:44483563-44483585 CCAAACTGCATGGCTAGAGTGGG + Intronic
1180171830 21:46063447-46063469 ACAGCCTGATTGGCTACAGCTGG + Intergenic
1180903334 22:19390567-19390589 CCAGCCTGCTGGGCAATAGAGGG + Intronic
1181827774 22:25533012-25533034 CCAACCCACTTGGCTCTCGCTGG + Intergenic
1185099257 22:48828793-48828815 GCAACCTGCTTGTCTTCAGCTGG + Intronic
954211350 3:49099325-49099347 CCAACCTGCTGGGCTATACCCGG + Exonic
959027096 3:101252275-101252297 CCAAGCTGCGTGTCTATAGTTGG + Intronic
960076798 3:113495421-113495443 CCAACCTGCTTGGCTATAGCCGG - Intronic
960388180 3:117046111-117046133 CCAGGCTGCTTAGCTCTAGCAGG - Intronic
962614299 3:137109428-137109450 CCAACCTGCTTGGCTTTAGAAGG + Intergenic
967700377 3:192585559-192585581 CCAACCTCCTTGGGTCAAGCTGG - Intronic
970747119 4:19312466-19312488 ACATCCTACTTGGCTACAGCAGG - Intergenic
973227335 4:47801582-47801604 CCAAGCTGCATGGCTACTGCTGG - Intronic
976538221 4:86242683-86242705 CCAGCCTCCCTGGCTCTAGCAGG + Intronic
979122418 4:116920395-116920417 CCATCCTGCATGGCTTGAGCAGG + Intergenic
981352811 4:143752340-143752362 CCAGCCTCCTTGGCTTCAGCTGG - Intergenic
981651069 4:147059678-147059700 TCTACCCGCTTGGCTATACCAGG - Intergenic
987834709 5:23146270-23146292 CCAGCCTCCTTGGCTCCAGCAGG + Intergenic
996893823 5:128456103-128456125 CCAACCTCCCTGGCTCCAGCAGG - Intronic
996965922 5:129306859-129306881 CCAGCCTGCCTGGCTGCAGCAGG + Intergenic
997955091 5:138273154-138273176 CCTATATGCTTGGCTTTAGCAGG + Intronic
1002469753 5:179428380-179428402 CCTACCTCCCTGGCTACAGCAGG + Intergenic
1002795444 6:467734-467756 CCATCCTGCTTAGCTGCAGCTGG - Intergenic
1008244256 6:49150802-49150824 CCAGCCTCCTTGGCTCCAGCCGG + Intergenic
1010331273 6:74626612-74626634 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1014205480 6:118651462-118651484 CCAGCCGGCTTGGCCATGGCAGG - Intronic
1019113539 6:169738140-169738162 CCAGCCTGCCTGGCTCCAGCAGG + Intergenic
1019543283 7:1560893-1560915 CCTACCTGCCTGGGTACAGCTGG + Intergenic
1021667047 7:22994130-22994152 ACCACATGCTTGGCTACAGCAGG + Intronic
1022555565 7:31291726-31291748 GCATCCTGGTTGGCTATGGCAGG + Intergenic
1022634625 7:32120046-32120068 CCAGCCTCCCTGGCTCTAGCAGG - Intronic
1023558452 7:41447593-41447615 CCAACCTGCTATGCTCTGGCTGG - Intergenic
1024537133 7:50446242-50446264 CCATCTTGCTTGGGTATAGGAGG + Exonic
1028964912 7:96791508-96791530 CCAGACTGCTGGGCTACAGCGGG - Intergenic
1039840363 8:41288771-41288793 CCAAACTGCTTCCCCATAGCAGG + Intronic
1041121823 8:54593686-54593708 CCAAGCTGCTTGGCTGTAAAGGG + Intergenic
1041413901 8:57586634-57586656 ATCACCTGGTTGGCTATAGCTGG - Intergenic
1049291060 8:141802227-141802249 CCAAACTGCTTGGCGTCAGCTGG - Intergenic
1052422928 9:28267135-28267157 CAAAACTGCATTGCTATAGCAGG - Intronic
1053069186 9:35091062-35091084 TCAATTTGCTTGGCTATGGCAGG + Intronic
1053186478 9:36020760-36020782 CTAAGCTGCTTGATTATAGCTGG + Intergenic
1056096316 9:83258082-83258104 CCAACCTGCTTGACTGTACATGG - Intronic
1056975130 9:91245889-91245911 CCATCCTTCTTGTCTAAAGCTGG + Intronic
1059728330 9:117030802-117030824 CCAACTTGCTCGGCAATGGCTGG - Intronic
1059814103 9:117892308-117892330 CCAATCTGCTCGGCTGCAGCAGG + Intergenic
1062453763 9:136626447-136626469 CCAACCTGGTTGGCCCTTGCTGG + Intergenic
1186430920 X:9503583-9503605 CCAGCCTCCCTGGCTCTAGCAGG - Intronic
1188884324 X:35531360-35531382 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1193048379 X:77076977-77076999 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
1193780799 X:85699024-85699046 CCATCCTACTTGGCTCCAGCAGG + Intergenic
1195979367 X:110561258-110561280 CCAGCCTCCTTGGCTTTTGCAGG + Intergenic
1197049572 X:122042521-122042543 CCAGCCTCCTTGGCTCTAGCAGG + Intergenic