ID: 960077606

View in Genome Browser
Species Human (GRCh38)
Location 3:113505514-113505536
Sequence TAGGGATTAGTTTGGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960077606_960077610 -2 Left 960077606 3:113505514-113505536 CCTGAGATCCAAACTAATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 960077610 3:113505535-113505557 TAACTAGTTACTCTTCACAATGG 0: 1
1: 0
2: 0
3: 11
4: 105
960077606_960077611 25 Left 960077606 3:113505514-113505536 CCTGAGATCCAAACTAATCCCTA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 960077611 3:113505562-113505584 TAAAGACACCTAAAGTCTCATGG 0: 1
1: 1
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960077606 Original CRISPR TAGGGATTAGTTTGGATCTC AGG (reversed) Intronic
903939675 1:26921086-26921108 GAGGGATTAGCTTGGATGGCTGG + Intronic
904836503 1:33340935-33340957 TAGTGATTGTTTTGGATCACGGG + Intronic
907006025 1:50914824-50914846 TAGTGATTTGTTTGGATCTAGGG - Intronic
908013707 1:59810026-59810048 TAGGGATTAGTTTGCTTTTCTGG - Intergenic
918795701 1:188892919-188892941 TAGGGATTACCTTGAATCTGTGG - Intergenic
918926449 1:190792697-190792719 TAGGGAGTGTTTTGGGTCTCAGG + Intergenic
919034335 1:192286759-192286781 TAGGGATTACATTGAATCTGTGG - Intergenic
920955202 1:210613672-210613694 TAGGGATTATACTGGATCTGTGG + Intronic
921388680 1:214597332-214597354 CAGGGATTACTTTGAATCTACGG - Intergenic
922584358 1:226722548-226722570 TGGTAATTAGTTTCGATCTCAGG - Intronic
922643071 1:227255889-227255911 TAGGGATTGCTTTGAATCTGTGG - Intronic
923289853 1:232533973-232533995 TAGGGATTACATTGAATCTGTGG - Intronic
1064060337 10:12131341-12131363 TAGGTATTAGTTAGGCTCTGCGG - Intronic
1066105821 10:32156148-32156170 TGGGGATTTGTTTGGACATCGGG - Intergenic
1068093857 10:52466163-52466185 GAGGGATGGGTTTGGCTCTCAGG + Intergenic
1068140598 10:53001973-53001995 TAGGGCTGAGTTTGGATTCCTGG + Intergenic
1070648031 10:78215001-78215023 TAGGGTTGAGTTTGGGACTCAGG - Intergenic
1072526908 10:96279993-96280015 TAGGGATTAGATAGATTCTCTGG + Intergenic
1078680272 11:13469341-13469363 TTGGGAGGAGTTTGAATCTCAGG - Intergenic
1080016632 11:27514061-27514083 TAGGGTTTATGTTAGATCTCTGG - Intergenic
1085999167 11:81958321-81958343 TAGGGAATATTTTTGAGCTCAGG - Intergenic
1087267111 11:96072737-96072759 TTGGCATGAGGTTGGATCTCTGG - Intronic
1087542625 11:99540512-99540534 TAGCAATTAGTTTGTATCCCAGG - Intronic
1088139521 11:106598919-106598941 TAGGGATTACTTTGAATTTGTGG - Intergenic
1092989206 12:13878579-13878601 TAGGTATTATTGTGGAACTCAGG - Intronic
1094249118 12:28339211-28339233 AAGGGAGTAGTTTAGATCTTTGG + Intronic
1094252370 12:28378793-28378815 TAGTGATTGGTTTGGAGCTAAGG + Intronic
1094635598 12:32224646-32224668 TAAGGATTAGTTTGCAATTCAGG + Intronic
1098917032 12:76268116-76268138 TTGGGATTTATTTGGATCCCAGG - Intergenic
1100046567 12:90388753-90388775 TAGGGATTATCTTGAATCTGCGG - Intergenic
1111441640 13:88288658-88288680 TACTTATTAGTTTGGAACTCTGG + Intergenic
1111646780 13:91041364-91041386 TAGGGAATAGTTTGGCTGTAAGG - Intergenic
1112749468 13:102567392-102567414 GAGGGGTTAATTTGGATTTCTGG - Intergenic
1118127279 14:62920541-62920563 GAGGGATTATCTTGGAACTCAGG - Intronic
1118518075 14:66548614-66548636 CAGGGAATATTTTGTATCTCAGG - Intronic
1122484365 14:102068284-102068306 TAGGGATTGGGTTGCATCTGTGG + Intergenic
1122499456 14:102187001-102187023 TGTGGTTTATTTTGGATCTCAGG + Intronic
1125117034 15:36106559-36106581 GACTCATTAGTTTGGATCTCTGG + Intergenic
1127742171 15:61920982-61921004 TAGGGATCAGTTTAGACTTCAGG - Intronic
1130209600 15:81910967-81910989 TAGGAATTTCTGTGGATCTCTGG + Intergenic
1131227999 15:90640988-90641010 TATGGATTAGTTTGCAAGTCAGG + Intronic
1138407376 16:56807321-56807343 AAGGGGTTGGTTTGGATTTCAGG - Intronic
1139177186 16:64701849-64701871 TAGGGATTTATTTCAATCTCTGG - Intergenic
1146494221 17:33306619-33306641 TAGCGATGAGAATGGATCTCAGG - Intronic
1147631016 17:41931663-41931685 TAGGGAGTAGTTGGGATTACAGG + Intronic
1148318599 17:46728058-46728080 GAGGGATCAGTTTTGACCTCAGG + Intronic
924968782 2:103840-103862 TAGGGATTGCTTTGAATCTGTGG + Intergenic
926544871 2:14226981-14227003 TAAGACTTAGTTTGGATTTCTGG + Intergenic
927037558 2:19195034-19195056 TAGGGATTTGTTTAGAACTTGGG + Intergenic
927142911 2:20141885-20141907 TAGGGCTCAGTTAGGATCTTAGG + Intergenic
929272886 2:39992887-39992909 AAGGGATTAATTTGGTTCCCAGG - Intergenic
930489297 2:52047829-52047851 GAGGGCATTGTTTGGATCTCAGG + Intergenic
931038123 2:58265860-58265882 TGGGGATTATTATGGAGCTCAGG + Intergenic
931116837 2:59174423-59174445 GAGGGATTTTTTTGGATCTGGGG - Intergenic
932355899 2:71068395-71068417 TTGGGATTAGTGTCCATCTCTGG + Exonic
933051673 2:77609878-77609900 TAGGGACTAATGTGGATCCCTGG + Intergenic
934085540 2:88506154-88506176 CAGGGATGAGCTTGGATCTGTGG - Intergenic
935747138 2:106198397-106198419 TAGGAAATAGTGGGGATCTCTGG + Intergenic
936979190 2:118248694-118248716 AAGGGTTTAGTTTGGGTCACTGG - Intergenic
937756927 2:125550823-125550845 TAGGGTTTAGTTTTAATCTTTGG - Intergenic
1169404341 20:5311114-5311136 TATGGATGAGTATGGATTTCAGG + Intronic
1176667056 21:9697337-9697359 TTGGGATTAATTTGGTTCTAGGG + Intergenic
1182754241 22:32665985-32666007 TAGGACTTAGTTTGGAGCTGGGG - Intronic
953070331 3:39514016-39514038 TAGGGATTTCTTTGCATCTCTGG - Exonic
960077606 3:113505514-113505536 TAGGGATTAGTTTGGATCTCAGG - Intronic
963040943 3:141069378-141069400 TTGGGACTAGTTTGGCTCTAGGG + Intronic
965850070 3:173012457-173012479 TAGGGATTACTTTGGCTATATGG - Intronic
966301529 3:178484744-178484766 TAGGGGTTATTTTGGAGCACTGG - Intronic
967089180 3:186120706-186120728 AAGGGATTCTGTTGGATCTCAGG + Intronic
968058288 3:195709817-195709839 CAGGGAGAAGTTTGGACCTCAGG + Intergenic
968401089 4:298380-298402 TATGGATTAGTTTGAGTCTCCGG + Intronic
968483647 4:848521-848543 GGGGGATTAGTTTGGAGCTTGGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969644159 4:8416877-8416899 TGGGGATGAGTCTGGATGTCCGG - Intronic
969920815 4:10537988-10538010 TAGCAATGAGTTTGGATCCCAGG - Intronic
975830224 4:78361363-78361385 TGAGGATTAATTTGGGTCTCAGG + Intronic
978439289 4:108716683-108716705 AAGGGATTTGGTTGGGTCTCAGG + Intergenic
979528087 4:121738451-121738473 TAGGGGTGAATTTGGATTTCTGG + Intergenic
985407957 4:189655000-189655022 TTGGGATTAATTTGGTTCTAGGG - Intergenic
988918408 5:35919198-35919220 GTGAAATTAGTTTGGATCTCAGG + Intronic
989515937 5:42343280-42343302 TAGGGATTGCATTGGATCTGTGG - Intergenic
990095829 5:52111088-52111110 TAGGGATTGCATTGGATCTTTGG + Intergenic
993697384 5:91077813-91077835 TCGGGCTTGGTTTTGATCTCTGG + Intronic
994750488 5:103731599-103731621 GAGGGAGTAGTTTGGTTGTCTGG + Intergenic
994995620 5:107058809-107058831 TAGGGATTTTTTGGGTTCTCTGG - Intergenic
995649359 5:114351010-114351032 TAGGGATTTGATTGTATCTGTGG + Intergenic
997910946 5:137872684-137872706 AAGGGATTATTTTGGAAGTCAGG - Intronic
998942356 5:147298181-147298203 AAGGGATGAGTTTAGATCACAGG + Intronic
1000417750 5:161000805-161000827 TCAGGATTACTTTGGCTCTCTGG + Intergenic
1000803084 5:165752687-165752709 AAGGGAGTAATTTTGATCTCTGG - Intergenic
1001272026 5:170320052-170320074 TAGGGATTACCTTCAATCTCAGG + Intergenic
1003221036 6:4161171-4161193 TGGGGATGTGTTTGGGTCTCAGG - Intergenic
1007971255 6:46054417-46054439 CAGGGATTAGCTTGGATCACAGG - Intronic
1013340401 6:109208995-109209017 TAGGGATTGCTTTGAATCTGTGG + Intergenic
1014125659 6:117774273-117774295 TAGGCATTTCTTTGGCTCTCTGG - Intergenic
1018628073 6:165799529-165799551 TATGGATTCGATTGTATCTCGGG + Intronic
1022544985 7:31178080-31178102 GATGGATTACTTTGGGTCTCAGG - Intergenic
1022607025 7:31825432-31825454 TAGGGATTCTTTTGGATTTGGGG + Intronic
1030192986 7:106828078-106828100 GAGGGATTAGTTTGGTTCTAGGG + Intergenic
1030313312 7:108089568-108089590 TAAGGATTAGTTAGGGTCACTGG - Intronic
1031944289 7:127822890-127822912 TAGACATGAGTTTGAATCTCTGG + Intronic
1033953879 7:146819634-146819656 TAAAGATGAGTTTGGGTCTCAGG - Intronic
1034133422 7:148742154-148742176 TAGGGATTACATTGAATCTTTGG + Intronic
1037210691 8:16383482-16383504 TAGGGTTTATTTTGTATTTCAGG - Intronic
1041659761 8:60390443-60390465 TAAATATTAGTTTGGAGCTCAGG - Intergenic
1042531059 8:69816309-69816331 CAGGGATGATTTTGGCTCTCTGG - Intronic
1045070491 8:98499271-98499293 TAAGACTTAGTTTGGATTTCTGG + Intronic
1056551536 9:87657120-87657142 TAGGGATTTCTTTTGATCTAGGG - Intronic
1057601019 9:96457240-96457262 TAGAGATTAGCTGGGATCACAGG - Intronic
1057823050 9:98348489-98348511 TAGGGATTACGTTGAATCTGTGG + Intronic
1060908633 9:127330858-127330880 TAGTGATGAGTGTGCATCTCAGG + Intronic
1061459764 9:130727836-130727858 GTGGGATTACTTTGGTTCTCTGG - Intronic
1203659040 Un_KI270753v1:24425-24447 TTGGGATTAATTTGGTTCTAGGG - Intergenic
1189668964 X:43387521-43387543 TAGGGATGTGATTGGATCACGGG + Intergenic
1192058505 X:67798635-67798657 TAGGGATTACCTTGGATATTTGG - Intergenic
1192241563 X:69334120-69334142 TAGGGATTGGATTTGATCTATGG + Intergenic
1193693629 X:84680094-84680116 TAGTGATTACTTTGGATCCTGGG + Intergenic
1196601035 X:117602331-117602353 TAGGGATTACATTGAATCTCTGG - Intergenic