ID: 960077960

View in Genome Browser
Species Human (GRCh38)
Location 3:113509929-113509951
Sequence GCAGAAGGCCAAACAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1748
Summary {0: 1, 1: 3, 2: 35, 3: 316, 4: 1393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960077960_960077963 -1 Left 960077960 3:113509929-113509951 CCTGCTTCTGTTTGGCCTTCTGC 0: 1
1: 3
2: 35
3: 316
4: 1393
Right 960077963 3:113509951-113509973 CCATAATTGTAAGTTTCCTGAGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960077960 Original CRISPR GCAGAAGGCCAAACAGAAGC AGG (reversed) Intronic
900288509 1:1913907-1913929 TCCGAAGGCCACACAGAGGCTGG + Intergenic
900747869 1:4373465-4373487 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
900756287 1:4437375-4437397 GCGGAAGGCGAAGGAGAAGCAGG + Intergenic
900789370 1:4669420-4669442 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
900902941 1:5529020-5529042 GCGGAAGGCTAAAGGGAAGCAGG - Intergenic
900909443 1:5584569-5584591 GCAGAAGGCGAAGAAGAAGAAGG + Intergenic
901138992 1:7015856-7015878 GCAGAAGGCGAAGGGGAAGCAGG + Intronic
901193985 1:7429830-7429852 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
901315852 1:8307750-8307772 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
902063068 1:13661452-13661474 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
902176813 1:14656638-14656660 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
902322564 1:15678686-15678708 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
902782806 1:18715674-18715696 ACAGAAGGGGAAACAGAGGCAGG - Intronic
903736853 1:25535364-25535386 GCAGAAGGAAGAACAGAGGCTGG - Intergenic
904241531 1:29149369-29149391 TCACAATGCCAATCAGAAGCTGG + Intronic
904353361 1:29923114-29923136 GCAGAAGGCAAAGGGGAAGCGGG - Intergenic
904361894 1:29981141-29981163 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
904729848 1:32581798-32581820 GCAGAAGGTGAAGGAGAAGCAGG + Intronic
904820433 1:33239567-33239589 GCGGAAGGCAAAGGAGAAGCAGG + Intergenic
904871949 1:33624724-33624746 GGAGGAGGACAAACAGAGGCTGG - Intronic
905695385 1:39969723-39969745 GCAGGAGGCCACAGAGCAGCCGG - Exonic
905762871 1:40575025-40575047 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
906187925 1:43875663-43875685 GCGGAAGGTGAAACAGGAGCAGG - Intronic
906456757 1:46003850-46003872 TTTGAAGGCCATACAGAAGCAGG + Intronic
906860816 1:49357197-49357219 GCAGGAGGACACAGAGAAGCAGG - Intronic
907255429 1:53175051-53175073 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
907753280 1:57284355-57284377 GCAGAAGACCAAGCATAGGCTGG + Intronic
907898531 1:58716434-58716456 GCAGAAAGTGAAACGGAAGCAGG + Intergenic
907936317 1:59045450-59045472 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
907938021 1:59060095-59060117 GTGGAAGGCAAAAGAGAAGCAGG + Intergenic
908262294 1:62348565-62348587 GCGGAAGGCCAAGGGGAAGCAGG + Intergenic
908724769 1:67163726-67163748 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
908832629 1:68194316-68194338 GTAGAAGGCGATACAAAAGCTGG - Intronic
908846449 1:68329194-68329216 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
908931348 1:69319473-69319495 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
909180314 1:72415708-72415730 GCAGAAGGCAAAGCACAAGTAGG - Intergenic
909367653 1:74846564-74846586 GCAGAAGGCCAAGCCAGAGCAGG + Intergenic
909533460 1:76707237-76707259 GCAGAAGGCAAAAGGGCAGCTGG + Intergenic
910062671 1:83112430-83112452 ACAGAAGGCTTCACAGAAGCTGG - Intergenic
910162633 1:84290625-84290647 GCAGAAGGCGAAGGAGCAGCAGG - Intergenic
910295085 1:85636444-85636466 GCAGAAGGCGAAGGAGAAGCAGG - Intergenic
910353606 1:86329005-86329027 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
910570667 1:88698829-88698851 GAAGAAGGGAAAACAGAAGTTGG - Intronic
910826741 1:91417104-91417126 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
910833824 1:91487291-91487313 GTGGAAGGCGAAACAGGAGCAGG + Intergenic
910909061 1:92214689-92214711 GCAGAAGGCAAAAGAAAAGCAGG - Intergenic
911172602 1:94784904-94784926 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
911235006 1:95403158-95403180 GCAGAAGGGGAAAGGGAAGCTGG - Intergenic
911269951 1:95788949-95788971 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
911596679 1:99805747-99805769 GCAGAAGGCAAAGGAAAAGCAGG + Intergenic
911602558 1:99862641-99862663 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
911799177 1:102111578-102111600 GCAGAAGGCAAAGGTGAAGCAGG + Intergenic
911833239 1:102581564-102581586 GTGGAAGGCAAAGCAGAAGCAGG + Intergenic
911844960 1:102741075-102741097 GCAGAAGGCGAAAGAGGAGCCGG + Intergenic
911885285 1:103289871-103289893 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
912000796 1:104832397-104832419 GCAGAAGGCAAAGGAGAAGCTGG + Intergenic
912109911 1:106329068-106329090 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
912115443 1:106401141-106401163 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
912191647 1:107347766-107347788 GCAGAAAGCAAAGGAGAAGCAGG + Intronic
912937461 1:114016120-114016142 GCGGAAGGCAAAAGGGAAGCAGG + Intergenic
912942812 1:114059992-114060014 GCAGAAGGCCAACGGGAAGCAGG - Intergenic
912984910 1:114418138-114418160 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
913033428 1:114935965-114935987 CCAGAGGTACAAACAGAAGCTGG + Intronic
913330343 1:117662031-117662053 GCAGAAGGTGAATCAGGAGCAGG - Intergenic
913397787 1:118391522-118391544 GAAGAAGGTGAAACAGAAGATGG + Intergenic
914926811 1:151895941-151895963 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
915048015 1:153035347-153035369 GCAGAAGGCAAAAAGGAAGCAGG - Intergenic
915210780 1:154307552-154307574 TCAGAAGGAGAATCAGAAGCAGG - Intergenic
915737400 1:158093771-158093793 GCAGGAGGCCAGAGAGGAGCAGG - Intronic
915885545 1:159717360-159717382 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
916119925 1:161520286-161520308 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
916163541 1:161943345-161943367 GCAGAAGGCAAAGTGGAAGCAGG - Intronic
916287904 1:163131270-163131292 GCAGAAGATGAAGCAGAAGCAGG - Intronic
916768433 1:167884283-167884305 GCAGAAGACGAAGGAGAAGCAGG + Intronic
916910410 1:169340328-169340350 GCAGTAGGCAAAAGGGAAGCAGG - Intronic
917036942 1:170758471-170758493 GTAGAAGGCGAAGAAGAAGCAGG + Intergenic
917248215 1:173027710-173027732 GCAGAAGACAAAGGAGAAGCAGG - Intergenic
917572186 1:176279181-176279203 GCAGAAGGCAAAAGAGGAGCAGG + Intergenic
917861256 1:179146767-179146789 GCAGAAGGCAAAGGAGAAACAGG - Intronic
918455158 1:184703969-184703991 GCAGAATTGCAAAGAGAAGCAGG + Intronic
918485663 1:185026235-185026257 GCAGAAGGCAAAGAAGAAGCAGG + Intergenic
918540033 1:185622028-185622050 GCAGAAGGCAAAAAGGGAGCAGG + Intergenic
918569723 1:185975362-185975384 GCAGAAGGCAAAAGGGAAGCAGG + Intronic
918663976 1:187125503-187125525 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
918820863 1:189252700-189252722 GCAGAAGGTGAAGAAGAAGCGGG + Intergenic
918828190 1:189354588-189354610 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
918880571 1:190114211-190114233 GCAGAAGGCAGAACAGAAGCAGG - Intronic
919233624 1:194808055-194808077 GCAGAAGACCAAACAGGAGAAGG - Intergenic
919597462 1:199581438-199581460 GCAGAAAGCAAAGCAGGAGCAGG - Intergenic
920078374 1:203353569-203353591 GAAGAAGGCAAAAGAGAAGAAGG - Intergenic
920609143 1:207420853-207420875 GCAAAAGGCAAAGGAGAAGCAGG + Intergenic
920763422 1:208807969-208807991 GCAGTAGTCCAAACACAAGATGG - Intergenic
921079560 1:211727657-211727679 GCAGAAGGCGAAGCGGGAGCAGG - Intergenic
921272174 1:213482032-213482054 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
921351660 1:214242372-214242394 GCGGAAGGCAAAGCAGGAGCAGG - Intergenic
921536014 1:216350047-216350069 GCAGAAGGTGAAGGAGAAGCAGG + Intronic
921669780 1:217912788-217912810 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
921750129 1:218782574-218782596 GCAGAAGGCGAAGAAGGAGCAGG - Intergenic
921771565 1:219046814-219046836 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
922074580 1:222230784-222230806 GCAGAGGGCCAAGCTGAAGATGG - Intergenic
922081345 1:222300236-222300258 GTAGAAGGCTAAAGGGAAGCAGG + Intergenic
922094361 1:222430017-222430039 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
922409616 1:225358912-225358934 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
922484034 1:225959406-225959428 GCGCAAGGCCACTCAGAAGCAGG - Intergenic
922538074 1:226397695-226397717 GCAGAAGGCAGAGGAGAAGCCGG - Intronic
922704924 1:227785572-227785594 GCGGAAGGCAAAGCAGAAGTAGG + Intergenic
923106728 1:230859583-230859605 GCAGAAAGCCAAAAAGCAGGGGG + Intronic
923242831 1:232102308-232102330 GCAGAAGGCAAAACGGGAGCAGG - Intergenic
923504607 1:234594704-234594726 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
923559449 1:235027695-235027717 GCGGAAGGCAAAGCAGGAGCAGG + Intergenic
923708292 1:236363743-236363765 GCAGAAGGCAAAAGGGGAGCTGG - Intronic
924287518 1:242503344-242503366 GTGGAAGGCAAAGCAGAAGCAGG - Intronic
924297962 1:242607918-242607940 ACAGAAGGCAAAGAAGAAGCAGG + Intergenic
924797453 1:247302270-247302292 GAAGTTGGACAAACAGAAGCAGG + Intronic
924856692 1:247881387-247881409 GCAGAAGGCAAAGCAGGAACTGG - Intergenic
1063146213 10:3297311-3297333 GCAGAAGGCGAAGCCGGAGCAGG - Intergenic
1063217392 10:3936990-3937012 GCAGAAGGCAAAGGAGAGGCTGG - Intergenic
1063470121 10:6277661-6277683 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1063616219 10:7602573-7602595 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1063694120 10:8316595-8316617 ACAGAAGGCGAAAGGGAAGCAGG + Intergenic
1063713074 10:8499604-8499626 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1063733200 10:8722744-8722766 GCAGAAGGCAAAGAAGAAGCAGG + Intergenic
1063813683 10:9745226-9745248 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1063900401 10:10726939-10726961 GCGGAAGGCAAAGCCGAAGCAGG + Intergenic
1064072278 10:12240851-12240873 GCAGAAGACCAGACACAACCTGG - Intronic
1064153282 10:12883311-12883333 GCAGGAAACCAAACAGAAGGGGG + Intergenic
1064365885 10:14707461-14707483 GCACAAGGACAAAAAGAATCAGG + Intronic
1064423053 10:15206644-15206666 GCAGAAGGCAGAGCAGGAGCAGG - Intergenic
1064424910 10:15222062-15222084 GCAGAAGGCCAGGGAGAGGCTGG + Intronic
1064524178 10:16235763-16235785 GCAGGAGGCAAAGGAGAAGCAGG + Intergenic
1064673297 10:17737268-17737290 GCAGGAGGCCAAAGGGCAGCAGG - Intergenic
1064728759 10:18307862-18307884 GCAGAAGGCAAGAAAGAAGAAGG + Intronic
1064768687 10:18701039-18701061 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1064838682 10:19563983-19564005 GCAGAAGGCCAACTGGGAGCAGG - Intronic
1065146740 10:22777004-22777026 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1065244368 10:23742518-23742540 GCAGAAGGCAAAGCAGAAGCAGG + Intronic
1065326705 10:24556001-24556023 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1065521243 10:26575452-26575474 GCAGAAGGCAAAGTGGAAGCAGG + Intergenic
1065530264 10:26662662-26662684 GCAGAAGGCATAGCAGGAGCAGG + Intergenic
1065609860 10:27462301-27462323 GGAGAAGGCAAAGGAGAAGCAGG + Intergenic
1065852307 10:29801006-29801028 GCAGAAGGTGAAACTGGAGCAGG + Intergenic
1065871957 10:29963286-29963308 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1066040514 10:31544460-31544482 GAAGAAGGCAAAGCAGGAGCGGG - Intergenic
1066098651 10:32097604-32097626 GCAGAAGGCAAAAGAGAGGCAGG + Intergenic
1066176773 10:32915727-32915749 CCAGAGGTACAAACAGAAGCTGG + Intronic
1066252759 10:33650285-33650307 GCAGAAGGCAAAACGGGAACAGG + Intergenic
1067784083 10:49229834-49229856 CAAGAAAGCCAAACAGAAGACGG - Intergenic
1067798040 10:49334887-49334909 GCAGAAGGCAAAGCAGGGGCAGG + Intergenic
1068070118 10:52184753-52184775 GCAGAAGGCAAAGAAGGAGCAGG + Intronic
1068128306 10:52867783-52867805 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1068368531 10:56083931-56083953 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
1068388102 10:56358818-56358840 GCAGCAGGCAGAACAGGAGCGGG - Exonic
1068595598 10:58899815-58899837 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1068669581 10:59709762-59709784 GGAGAAGGCGAAAGAGAAGGTGG - Exonic
1068693392 10:59941011-59941033 GCAGAAGGGGAAGCAGGAGCAGG + Intergenic
1068836141 10:61556239-61556261 GCAGAAGGCAAAGGAGAAACAGG + Intergenic
1069159929 10:65080495-65080517 GCAGAAGACAAAGGAGAAGCAGG - Intergenic
1069381191 10:67844469-67844491 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1069635047 10:69919938-69919960 GCAGAAAGCCTAGCAGAAGGAGG + Intronic
1070430331 10:76331376-76331398 GCAGAAGGCAATATATAAGCAGG - Intronic
1070581814 10:77726001-77726023 GTAGAAGGCGAAGCAGCAGCAGG - Intergenic
1070643448 10:78185345-78185367 GCAGAATGGGAACCAGAAGCTGG - Intergenic
1070977112 10:80614288-80614310 GCAGAAGGCGAAGCTGGAGCAGG + Intronic
1071006641 10:80891083-80891105 GCAGAAGGCGAAGGAGGAGCAGG - Intergenic
1071056777 10:81520530-81520552 ATATAAGGCCAAACAGTAGCCGG - Intergenic
1071338577 10:84621985-84622007 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
1071523786 10:86346719-86346741 GCAGAAGGATAAACAGAGGCTGG + Intronic
1071666813 10:87566771-87566793 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
1071667074 10:87568813-87568835 GCAGAAGGCAAAGCAGCAGCAGG - Intergenic
1071780678 10:88841007-88841029 GCAGAAGGGGAAATAGAAGCAGG + Intronic
1071947724 10:90666394-90666416 GCAGAAGGCGAAGCAAAAGCAGG + Intergenic
1072018945 10:91379740-91379762 GCAGAAGGCAAAGCACAGGCAGG + Intergenic
1072396387 10:95047103-95047125 GCAGAAGGCAAAGCAGGAACAGG - Intronic
1072446565 10:95503861-95503883 GAAGAAGGGCAGACAGAAGAGGG + Intronic
1072464597 10:95651585-95651607 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1072481665 10:95814939-95814961 GCAAAAGGCAAAAAAGAAGGAGG - Intronic
1072491864 10:95914687-95914709 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1072505512 10:96062520-96062542 GCAGAAGGGTAAGCAGGAGCAGG + Intergenic
1073026048 10:100488080-100488102 GCAGAAGACAAAAAGGAAGCTGG - Exonic
1073646421 10:105308994-105309016 GCAGAAGGCAAACGGGAAGCAGG - Intergenic
1073980451 10:109147848-109147870 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
1073990258 10:109254232-109254254 CCAGAAGGCAAAGCCGAAGCAGG + Intergenic
1074011759 10:109489531-109489553 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
1074235112 10:111577102-111577124 GCAGAAGGCAAAGAAGAATCAGG + Intergenic
1074442175 10:113487667-113487689 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
1074663981 10:115696826-115696848 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1075017459 10:118920569-118920591 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1075350964 10:121725003-121725025 GCAGAAGGACAAAAAAAAGGGGG + Intergenic
1075400113 10:122154988-122155010 GCAGCAGTCGAGACAGAAGCTGG - Intronic
1075501020 10:122974225-122974247 GCAGACAGCCAAGCAGGAGCAGG - Intronic
1075639617 10:124055548-124055570 GCAGGTGGCCACACAGATGCAGG + Intronic
1075724205 10:124603353-124603375 GCAGATGGCCAAACGGATGGGGG + Intronic
1075902350 10:126053150-126053172 GCAGAAGGTGAAGGAGAAGCAGG - Intronic
1075903743 10:126063549-126063571 GCTGAAAGCCAAGCAGAATCAGG - Intronic
1076034311 10:127186302-127186324 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1076393312 10:130120139-130120161 GCAGAAGGCCAAGGGGCAGCGGG + Intergenic
1076585471 10:131544642-131544664 CTAGAAGGGCAAACAGCAGCTGG + Intergenic
1076783034 10:132734968-132734990 AGAGAAGGCCACACAGAGGCGGG + Intronic
1076985096 11:230420-230442 GCAGAAGGACAACCAACAGCAGG + Intronic
1077232067 11:1462236-1462258 GCGGAAGGGAACACAGAAGCTGG - Intronic
1077256341 11:1585109-1585131 GCAGACGGGCACACAGCAGCTGG + Exonic
1077259455 11:1608098-1608120 GCAGACGGGCACACAGCAGCTGG + Exonic
1077261208 11:1621932-1621954 GCAGATGGGCACACAGCAGCTGG + Exonic
1077274457 11:1697322-1697344 GCAGATGGGCACACAGCAGCTGG - Exonic
1077448985 11:2623168-2623190 GCGGAAGGCAAAGGAGAAGCAGG - Intronic
1078367904 11:10721864-10721886 CCAGATGGCCACACAGGAGCTGG + Intergenic
1078646740 11:13147780-13147802 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1078697014 11:13644542-13644564 GCAGAAGGCAAAAAGGAAGGAGG + Intergenic
1078747582 11:14129831-14129853 GCAGAAGGTGAAGGAGAAGCAGG + Intronic
1078884098 11:15482631-15482653 GGAGAAGGAGAAACAGAAGTTGG - Intergenic
1079127488 11:17728713-17728735 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1079431524 11:20393790-20393812 GCAGAAAGCAAAACAGAAACTGG + Intronic
1079508313 11:21180381-21180403 GCAGCATGCCAAACAGAATCAGG - Intronic
1079723440 11:23848222-23848244 GCTGAAGGCAAAGGAGAAGCAGG + Intergenic
1079916428 11:26373415-26373437 GCGGAAGGCAAAACAGAAGCAGG - Intronic
1080105463 11:28507259-28507281 ATAGAAGGCCAAAGTGAAGCAGG + Intergenic
1080159819 11:29160203-29160225 GCAGAAGGCAGAGGAGAAGCAGG - Intergenic
1080223225 11:29931367-29931389 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
1080321053 11:31009856-31009878 GCAAAAGGCAAAAGAGAAGCAGG + Intronic
1080481344 11:32653620-32653642 GCAGAAGAGAAAACAGAAACAGG + Intronic
1080871210 11:36238655-36238677 GCAGAAGGCAAAGAAGAAGAAGG - Intergenic
1081214171 11:40373801-40373823 GCAGAAGGCAAAACAGAAGCAGG - Intronic
1081373744 11:42335004-42335026 GCATAAGGCAAAAGAGAAGCAGG + Intergenic
1081558434 11:44189513-44189535 GCGGAAGGCAAAAGGGAAGCTGG + Intronic
1081682544 11:45018371-45018393 GCAGAAGGTGAAGCGGAAGCAGG + Intergenic
1081769189 11:45636870-45636892 GTAGAAGGCAAAGGAGAAGCAGG - Intergenic
1082830692 11:57614736-57614758 GGAGAAGGGCTAATAGAAGCAGG - Exonic
1082875958 11:57989012-57989034 CCAGAAGTACAAAGAGAAGCTGG - Intergenic
1083548642 11:63568300-63568322 ACAGAAGGCAAAGGAGAAGCAGG + Intergenic
1084498282 11:69518514-69518536 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
1084553682 11:69863800-69863822 TCAGAAGGCCCAACTGCAGCAGG - Intergenic
1084798371 11:71524639-71524661 GTAGAAGGCAAAGCAGGAGCAGG - Intergenic
1084798776 11:71527398-71527420 GCAGACGGGCACACAGCAGCTGG - Exonic
1084803880 11:71565706-71565728 GCAGACGGGCACACAGCAGCTGG - Exonic
1084860677 11:72015906-72015928 GCAGCAGGCCAAAGAGAAGCAGG - Exonic
1084963583 11:72731469-72731491 GCAGAAGGCAAAGCGGGAGCAGG - Intronic
1085241803 11:75062683-75062705 GCAGAAGGCCAAGAGGGAGCAGG - Intergenic
1085325822 11:75605920-75605942 GAGGAAGGCCAAAGACAAGCAGG - Exonic
1085351052 11:75798050-75798072 GCAGAAGGCCCATCAGAACCTGG + Intronic
1085462434 11:76702213-76702235 GCCCAAAGCCACACAGAAGCTGG + Intergenic
1085600620 11:77853365-77853387 GCAGAAGGCAAAGAGGAAGCTGG + Intronic
1085710022 11:78820839-78820861 CCAGAAGCACAAACACAAGCAGG + Intronic
1085857136 11:80188032-80188054 GGAGAAGGAGAAGCAGAAGCGGG - Intergenic
1085959991 11:81450468-81450490 GCGGAAGGCAAAATGGAAGCAGG + Intergenic
1085986928 11:81799152-81799174 GCAGGAGGCAAAACAAGAGCAGG - Intergenic
1086235728 11:84627770-84627792 GCAGAATGTGAAACAGGAGCAGG + Intronic
1086339947 11:85838549-85838571 GCAGAAGGCAAATGGGAAGCAGG + Intergenic
1086485725 11:87299286-87299308 GCAGAAGGCCAAGAGGAAGCAGG + Intronic
1086509555 11:87542300-87542322 GGAGAAGGCAAAGGAGAAGCAGG + Intergenic
1086701127 11:89901226-89901248 TCACAAGGCCCAACAGGAGCAGG + Intergenic
1086705040 11:89943301-89943323 TCACAAGGCCCAACAGGAGCAGG - Intergenic
1086868012 11:92003618-92003640 GCATAAGGCAAAGCAGGAGCGGG + Intergenic
1086871434 11:92042057-92042079 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
1087165707 11:95000182-95000204 GCAGAAGGCGAAGTGGAAGCAGG + Intergenic
1087254999 11:95943846-95943868 GCAGAAAGTGAAGCAGAAGCAGG - Intergenic
1087480546 11:98694215-98694237 GCGGAAGGCAAAAAGGAAGCAGG - Intergenic
1087582996 11:100082972-100082994 GTAGAAGGTGAAGCAGAAGCAGG + Intronic
1087594736 11:100238444-100238466 GGAGAAGGCGAAAGAGAAGAGGG + Intronic
1087750827 11:102005330-102005352 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1087828076 11:102788913-102788935 ACAGAAGGTGAAAGAGAAGCCGG - Intergenic
1087870986 11:103292785-103292807 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1087917147 11:103823916-103823938 AAAGAAGGCAAAAGAGAAGCAGG - Intergenic
1088178647 11:107083164-107083186 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1088186936 11:107181055-107181077 GCAAAAGGCAAAGAAGAAGCAGG + Intergenic
1088356702 11:108951661-108951683 GCAGAAGGCAAAGTGGAAGCAGG - Intergenic
1088572607 11:111237878-111237900 GAAGAAGGACAAATAGAAGGAGG + Intergenic
1089324445 11:117647695-117647717 GCAGAAAGCAAAAGGGAAGCAGG + Intronic
1089459308 11:118643488-118643510 GCAGGAGACCAACTAGAAGCTGG - Intronic
1089994998 11:122898170-122898192 GCAGCAAGGAAAACAGAAGCAGG - Intronic
1090207066 11:124891299-124891321 TTGGAAGGCCAAAAAGAAGCAGG - Exonic
1090426040 11:126607705-126607727 GCAGAAGGCCACACAGCAGCAGG - Intronic
1090438347 11:126705470-126705492 GCAGAAGGTGAAGCAGGAGCAGG - Intronic
1090532034 11:127600881-127600903 GCAGACTGCCTGACAGAAGCAGG - Intergenic
1090569091 11:128027961-128027983 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
1090585325 11:128205955-128205977 GCAGAAGGCAAAGCTGGAGCAGG + Intergenic
1090842988 11:130508810-130508832 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1090854599 11:130600653-130600675 GTGGAAGGCGAAAGAGAAGCAGG + Intergenic
1091322283 11:134660221-134660243 GCAGAAGGCAGAGCAGGAGCAGG - Intergenic
1091399071 12:171894-171916 GCAGAAGACCCAGCAGCAGCTGG + Intronic
1091560097 12:1605627-1605649 GCAGAAGGGGAAGCAGGAGCGGG + Intronic
1091658892 12:2366834-2366856 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1091836233 12:3588063-3588085 GCAGGAGCCCCAGCAGAAGCAGG + Intronic
1092081424 12:5719549-5719571 GCAGAAGACCAAACAGCAAAAGG - Intronic
1092403372 12:8196905-8196927 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1092473289 12:8796968-8796990 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1092582294 12:9855598-9855620 GCAGACGGCCAAGGAGAAGAGGG + Intronic
1092601609 12:10072220-10072242 GCAGAAGGCGAAGCAAGAGCTGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093007173 12:14063342-14063364 GCTGAAACCCAACCAGAAGCTGG - Intergenic
1093062002 12:14617122-14617144 GCAGAAGACAAAGCAGGAGCAGG - Intronic
1093371774 12:18374868-18374890 GCAGAAGGCAAAGGAGGAGCAGG - Intronic
1093824199 12:23662325-23662347 ACCGAATGCCAAACAGAATCTGG + Intronic
1094000740 12:25691297-25691319 GCAGAAGGCAATGCGGAAGCAGG - Intergenic
1094041073 12:26122459-26122481 GCAGAAGGGCAGGCAGAAGGGGG + Exonic
1094171262 12:27494817-27494839 GCAGAAGGCCAAAGGGAAGGAGG - Intronic
1094246031 12:28294500-28294522 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1094383415 12:29868060-29868082 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1094393026 12:29973659-29973681 GCAGAAGGCGAAGGGGAAGCCGG - Intergenic
1094719513 12:33049060-33049082 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1095269746 12:40203815-40203837 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1095300682 12:40580967-40580989 GCAGAAGGCCAAAGAGAAGCAGG + Intergenic
1095781683 12:46067102-46067124 GCGGAAGGCAAAACGGGAGCAGG + Intergenic
1095801487 12:46273656-46273678 GCAGAAGCCAAAGCAGGAGCAGG - Intergenic
1096113427 12:49041684-49041706 GCAAAAGGCCAAAGATAACCGGG - Exonic
1096418760 12:51437547-51437569 GCAGAAGGCAAAAGGGAAGCTGG - Intronic
1096532769 12:52252361-52252383 GCAGAAGGCCAAGCAGGACATGG - Intronic
1096535176 12:52267443-52267465 GCAGAAGGCCAGGCAGTACCAGG + Intronic
1096537925 12:52287202-52287224 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096540846 12:52306158-52306180 GCAGAAGGCCAAGCAGGACATGG + Exonic
1096547419 12:52350211-52350233 GCAGAAGGCCAAGCAGGACATGG + Intergenic
1096549391 12:52362351-52362373 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096554700 12:52396112-52396134 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096557779 12:52414061-52414083 GCAGAAGGCCAAGCAGGACATGG - Intergenic
1096559855 12:52428356-52428378 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096562670 12:52447878-52447900 GCAGAAGGCCAAGCAGGACCTGG - Exonic
1096564840 12:52469770-52469792 GCAGAAGGCCAAGCAGGACCTGG - Exonic
1096566760 12:52488428-52488450 GCAGAAGGCCAAGCAGGACCTGG - Exonic
1096569948 12:52516737-52516759 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096584430 12:52610715-52610737 GCAGCAGGCCAAGGAGGAGCTGG - Exonic
1096611928 12:52807744-52807766 GCAGCAGGCCAAGGAGGAGCTGG - Exonic
1097029525 12:56080964-56080986 GCAGGAGGCCCAACAGAGGCTGG + Intronic
1097205772 12:57319525-57319547 ACAGAAGGCTAAACAGGGGCCGG - Intronic
1097220656 12:57448966-57448988 GCAGAAGGGCAAAGAGAGGGTGG + Intronic
1097520111 12:60656745-60656767 GCAGAAGGCAAAAAGGAAGGAGG - Intergenic
1097613722 12:61859162-61859184 GCCCAAGGCAAAAGAGAAGCAGG + Intronic
1098138462 12:67427767-67427789 GCAGAAAGGGAAACAGAAGATGG + Intergenic
1098275238 12:68805978-68806000 GCACAAGGCCAATGAGAAGGGGG + Intergenic
1098319420 12:69226498-69226520 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1098433360 12:70444349-70444371 GCAGAAGGTGAAGTAGAAGCAGG - Intergenic
1098655227 12:73019748-73019770 GCAGAAGGCAAAAGGGAAGCTGG - Intergenic
1098764591 12:74469870-74469892 CCAGAAGAACAAAGAGAAGCTGG + Intergenic
1098782577 12:74705427-74705449 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1098816278 12:75168402-75168424 GCCTAAGGCCATAAAGAAGCTGG + Intronic
1098920898 12:76301380-76301402 GTGGAAGGCAAAAGAGAAGCAGG + Intergenic
1098940657 12:76531118-76531140 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1099095119 12:78365753-78365775 GAAGAAGGTGAAACAGGAGCAGG - Intergenic
1099363045 12:81730399-81730421 GCGGAAGGCAAAAGAGAAGCAGG + Intronic
1099542634 12:83932183-83932205 GCAGAACGCCCAGCATAAGCTGG + Intergenic
1099568007 12:84277844-84277866 GCAGAAGGCAAAGGGGAAGCGGG + Intergenic
1099607808 12:84827937-84827959 GTGGAAGGCAAAAAAGAAGCAGG - Intergenic
1099626839 12:85086457-85086479 GCAGAAGGCAAAAGGGGAGCAGG - Intronic
1099854778 12:88150190-88150212 GCAGAAGGGGAAGCAGGAGCAGG + Intronic
1099915082 12:88882879-88882901 GCAGAAGGCACAAAGGAAGCAGG - Intergenic
1099983936 12:89640830-89640852 GCAGAAGGCGAAGCAGGAGCAGG - Intronic
1099984535 12:89647920-89647942 GCAGAAGGTGAAGCAGGAGCAGG - Intronic
1100163372 12:91888088-91888110 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1100367912 12:93938347-93938369 GCAGAAGGAAAAGGAGAAGCAGG + Intergenic
1100369697 12:93956691-93956713 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1100383645 12:94085341-94085363 GCAGAAGGGGAAAGGGAAGCAGG + Intergenic
1100428576 12:94509934-94509956 GCAGAAGGCAAAGGAGCAGCAGG - Intergenic
1100429624 12:94519073-94519095 GCAGAAGGCAAAGAAGGAGCAGG + Intergenic
1100614820 12:96222904-96222926 GCAGAAGGCAAAAGGGGAGCAGG + Intronic
1100773265 12:97947392-97947414 GCAGAAGACAAAATAGAAGAGGG + Intergenic
1100810147 12:98329786-98329808 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1100878703 12:98992549-98992571 GCAGAAGGCGAAGGGGAAGCAGG - Intronic
1101051938 12:100873045-100873067 GCAGAAGGCAAAAGGGAAGCAGG - Intronic
1101629822 12:106482453-106482475 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1101688536 12:107050538-107050560 GCAGAAGGTGAAAGGGAAGCAGG - Intronic
1101742727 12:107513511-107513533 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1102172602 12:110853452-110853474 GGAGAAGGCCAAAGAGCAGCAGG + Exonic
1102359992 12:112277363-112277385 GCGGAAGGCAAAGGAGAAGCAGG - Intronic
1102666861 12:114581524-114581546 GCAGAAGGCGAAAGGGAAGCAGG + Intergenic
1103135860 12:118507056-118507078 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1103667658 12:122582899-122582921 GCAGATGTCCAAACAAGAGCTGG + Exonic
1103704787 12:122865702-122865724 ACAGAAGGCAGAACTGAAGCGGG - Exonic
1104175697 12:126330489-126330511 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1104210346 12:126683046-126683068 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1104318333 12:127724961-127724983 GCAGAAGGCGAACAGGAAGCAGG - Intergenic
1104328167 12:127819623-127819645 TCAGAAGGCGCAACAGAAACAGG + Intergenic
1104366178 12:128179629-128179651 GCAGAAGGTGAAAAAGAGGCAGG + Intergenic
1104495453 12:129232772-129232794 GCAGAAGGTGAAAGGGAAGCAGG + Intronic
1104770196 12:131356713-131356735 GGAGCAGGCCAAGGAGAAGCAGG + Intergenic
1104770407 12:131358190-131358212 GCAGAAGGCGAATGGGAAGCAGG - Intergenic
1105284837 13:18995375-18995397 GCAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105310324 13:19201932-19201954 GCAGAAAGCCCAGCAGAATCAGG + Intergenic
1105353417 13:19636002-19636024 GCGGAAGGCAAAGGAGAAGCAGG - Intronic
1105529080 13:21201939-21201961 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1105718639 13:23092088-23092110 GCAGAAAGCAAATGAGAAGCAGG - Intergenic
1106383862 13:29265678-29265700 GCAGAAGGCTAAGCGGGAGCAGG + Intronic
1106606307 13:31232368-31232390 GCAGAAGGTGAAGAAGAAGCAGG + Intronic
1106885009 13:34175648-34175670 CAAGAAGCCAAAACAGAAGCTGG - Intergenic
1107043754 13:35974640-35974662 GCAGAAGGTGAAAGGGAAGCAGG - Intronic
1107231829 13:38119173-38119195 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1107585967 13:41848615-41848637 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1107800220 13:44099478-44099500 GCAGAAGGCAAAAGGGGAGCAGG + Intergenic
1108005140 13:45938674-45938696 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
1108031190 13:46231424-46231446 GCAGAAGGCAAAACAAGAGCAGG + Intronic
1108060578 13:46529073-46529095 GAAGAAGGGCAAATAGAAGGTGG - Intergenic
1108440853 13:50451416-50451438 GCAGAAGGCAAAGCTGGAGCAGG + Intronic
1108445180 13:50501463-50501485 GCAGAAGGCAAAAGGGAAGCAGG + Intronic
1108950760 13:56088832-56088854 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
1108956537 13:56165841-56165863 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1108993705 13:56697674-56697696 GCATTAGGCAAAACAGAAGCTGG + Intergenic
1109003224 13:56834506-56834528 GCAGAAGGCAAAGGAAAAGCAGG + Intergenic
1109096921 13:58130655-58130677 CCAGAAGTACAAAGAGAAGCTGG - Intergenic
1109147025 13:58791532-58791554 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1109164029 13:59010948-59010970 GCAGAAGGCACAGCAGAAGCAGG - Intergenic
1109171786 13:59106584-59106606 GCAGAAGCCAAAGGAGAAGCAGG - Intergenic
1109251839 13:60029628-60029650 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1109449427 13:62490724-62490746 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1109493861 13:63142286-63142308 GCAGAAGGCAAAAAGGAAGCAGG + Intergenic
1109963212 13:69658994-69659016 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1109995041 13:70112070-70112092 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1110033689 13:70652847-70652869 GCAGAAGGCAAAAGAGAAGCAGG - Intergenic
1110124987 13:71931628-71931650 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1110397554 13:75049288-75049310 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1110471037 13:75860766-75860788 GCAGAAGGACAGGCAAAAGCAGG + Intergenic
1110643298 13:77851954-77851976 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
1110822309 13:79931118-79931140 GCAGAAGCAGAAAGAGAAGCAGG + Intergenic
1110832194 13:80044303-80044325 GCAGAAGGCAAAGGAGAAGTAGG - Intergenic
1110868275 13:80422001-80422023 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1110907399 13:80909218-80909240 GCAGAAGATGAAGCAGAAGCAGG - Intergenic
1110920473 13:81077909-81077931 GCAGAAGGCGAAGTGGAAGCTGG + Intergenic
1111214118 13:85121215-85121237 CCAGAAGTACAAACAGGAGCTGG + Intergenic
1111334461 13:86802247-86802269 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1111370772 13:87313681-87313703 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1111415035 13:87929332-87929354 TCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1111678338 13:91414323-91414345 GCGGAAGGCAAAGGAGAAGCAGG - Intronic
1111790658 13:92851035-92851057 GCAGAAGGCAAAAAGGAAGCAGG + Intronic
1111792164 13:92871416-92871438 GTAGAAGGCAAAAGGGAAGCAGG + Intronic
1112139384 13:96621426-96621448 GCAGAAGGTAAAAGGGAAGCAGG - Intronic
1112246915 13:97743658-97743680 GCGGAAGGCAAATGAGAAGCAGG + Intergenic
1112378167 13:98863081-98863103 TCAGCAGACCAAACAGAGGCAGG + Exonic
1112450878 13:99508670-99508692 GCAGAAGGTGAAGCAGGAGCAGG + Intronic
1112499796 13:99933974-99933996 GCAGAAGGTCAAGGGGAAGCAGG + Intergenic
1112549112 13:100403467-100403489 GTGGAAGGCCAAAGAGGAGCAGG + Intronic
1112635996 13:101218753-101218775 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1112999055 13:105610916-105610938 GCAGAAGGCGAAAGGGGAGCAGG + Intergenic
1113025876 13:105940151-105940173 GCAGAAGGCGAAGGTGAAGCAGG - Intergenic
1113305527 13:109074442-109074464 GTAGAAGGCAAAGGAGAAGCAGG + Intronic
1113320489 13:109228035-109228057 GCAGAAGGATAAGGAGAAGCAGG + Intergenic
1113346818 13:109486233-109486255 GCAGAAGGCGAAGGAGAAGAGGG - Intergenic
1113502432 13:110787105-110787127 GCGGAAGGCAAAAGGGAAGCAGG - Intergenic
1113866264 13:113527530-113527552 GCACAAGTCTAAACAGCAGCAGG - Intronic
1114081563 14:19205064-19205086 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
1114082984 14:19218023-19218045 GGAGGTGGCCAAAGAGAAGCAGG - Intergenic
1114100257 14:19373328-19373350 GCGGAAGGACAGACAGGAGCGGG - Intergenic
1114540246 14:23450123-23450145 GCAGAAGGCAAAGCAGGAGAAGG - Intergenic
1114777045 14:25496177-25496199 GCAGAAGGTAAAAGGGAAGCAGG + Intergenic
1114935583 14:27532822-27532844 GCAGAAGCCAAAAGGGAAGCTGG - Intergenic
1115016410 14:28620448-28620470 GCAGAAGGCGAAGCAAGAGCAGG - Intergenic
1115111451 14:29828274-29828296 GCAGAAGGCAAAGGAGGAGCAGG + Intronic
1115135325 14:30100992-30101014 GCAGAAGTACAAAGAGGAGCTGG + Intronic
1115389955 14:32842939-32842961 GCAGTAGGCAAAGCAGAAGCAGG - Intergenic
1115475818 14:33811944-33811966 GCAAAAGGCCAGACAGAGGGAGG - Intergenic
1115552732 14:34519212-34519234 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1115812464 14:37124877-37124899 GCAGAGGGCAAAGCAGGAGCAGG - Intronic
1115888190 14:37997201-37997223 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1116120011 14:40710939-40710961 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1116152987 14:41165824-41165846 GCAGAAGGTGAAGGAGAAGCTGG - Intergenic
1116354572 14:43912705-43912727 GCAGAAGACTAAAAGGAAGCAGG - Intergenic
1116485660 14:45444994-45445016 GCAGAAGACAAAGGAGAAGCAGG - Intergenic
1116662858 14:47734404-47734426 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
1116693941 14:48149005-48149027 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
1117534822 14:56693818-56693840 CCAGAAGGCCAAACACAGCCTGG - Intronic
1117762791 14:59049690-59049712 GCAGAAGGCAAAGCGGGAGCAGG + Intergenic
1118088324 14:62443743-62443765 GCAGAAAGCAAAGTAGAAGCAGG - Intergenic
1118172499 14:63401837-63401859 GAAGAAAGCCAACGAGAAGCAGG + Intronic
1118545041 14:66876808-66876830 CCAGAAGTACAAACAGGAGCTGG + Intronic
1118578688 14:67271383-67271405 GCAGAAGGCCAAACAACAGAAGG - Intronic
1119682244 14:76601556-76601578 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1119908692 14:78329651-78329673 GCATTAGGCCAAAAAGAAGGGGG + Intronic
1119961252 14:78859183-78859205 GTGGAAGGCAAAAGAGAAGCAGG - Intronic
1120041411 14:79757385-79757407 AGAAAAGCCCAAACAGAAGCAGG + Intronic
1120073000 14:80124149-80124171 GCAGAAGGCCAAAGGGGAGCAGG - Intergenic
1120583107 14:86278805-86278827 GCAGAAGGCTAAGGAGAAGTAGG - Intergenic
1120659375 14:87234114-87234136 GCAGAAGGTAAAGGAGAAGCAGG - Intergenic
1120688524 14:87566337-87566359 GCAGAAGGCAAAAAAGGAGCAGG - Intergenic
1120715932 14:87840710-87840732 GCAGAAGGCAAAATGGGAGCAGG + Intronic
1120799634 14:88674389-88674411 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1120799903 14:88676320-88676342 GCAGAAGCCAAAGGAGAAGCAGG + Intronic
1120935150 14:89888449-89888471 GCAGAAGGTAAAGCAGGAGCAGG + Intronic
1121130356 14:91440186-91440208 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1121162709 14:91759916-91759938 GCAGAAGGCAAAACAGAAGTAGG - Intronic
1121178567 14:91909690-91909712 CCAGAAGGCCCACCAGATGCTGG + Intronic
1121496595 14:94396093-94396115 CAAGAAGGGCAAACACAAGCTGG + Intergenic
1121513866 14:94536004-94536026 GCAGGTGGGAAAACAGAAGCAGG - Intergenic
1121574287 14:94970567-94970589 GCAGAAGGCAAAGGAGAGGCAGG + Intergenic
1121679248 14:95778920-95778942 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1121684316 14:95821779-95821801 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1121814005 14:96915231-96915253 GCAGAAGGCAAAGCAGAAGCAGG - Intronic
1121875342 14:97446117-97446139 TGAGAAAGCCAATCAGAAGCAGG + Intergenic
1122170452 14:99869860-99869882 GCAGAAGACAAGACAGGAGCAGG - Intronic
1122812798 14:104297311-104297333 GGAGAGGGCCAAAGAGAAACTGG + Intergenic
1123221589 14:106862422-106862444 GCAGAAGACCAAGCATAGGCTGG + Intergenic
1202892154 14_KI270722v1_random:168775-168797 GCAGAAGGCCAAGAGGGAGCTGG + Intergenic
1123492861 15:20796587-20796609 GCAGAAGTGCAAACATTAGCAGG - Intergenic
1123494823 15:20814802-20814824 GCGGAAGGACAGACAGGAGCGGG - Intergenic
1123549362 15:21365683-21365705 GCAGAAGTGCAAACATTAGCAGG - Intergenic
1123551318 15:21383895-21383917 GCGGAAGGACAGACAGGAGCGGG - Intergenic
1123874558 15:24610695-24610717 GCACAAGGTCAGACATAAGCTGG - Intergenic
1124031180 15:26013730-26013752 GCAGAAGGACCCACAGAGGCAGG - Intergenic
1124244549 15:28058199-28058221 GCTGAAGGCAAAACTGCAGCAGG + Intronic
1124705270 15:31958743-31958765 GCAGAAGGCAAAATGGGAGCAGG - Intergenic
1125065893 15:35486130-35486152 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1125209610 15:37197845-37197867 GCAGAAGACAAAGCAGAAGCAGG + Intergenic
1125398785 15:39278202-39278224 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1125554630 15:40573877-40573899 GCACCAGGCCAAACAGAGCCTGG + Exonic
1125854077 15:42932418-42932440 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1126064032 15:44811446-44811468 GCAGAAGGTGAAGAAGAAGCAGG + Intergenic
1126120277 15:45245512-45245534 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1126182994 15:45804164-45804186 GCAGAAGGACCTACAGAAGAGGG + Intergenic
1126203982 15:46020916-46020938 GCAGAAGGCAAAGCAAGAGCAGG - Intergenic
1126290174 15:47066497-47066519 GCCGAAGGCAAAGGAGAAGCAGG + Intergenic
1126494855 15:49278910-49278932 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1126533036 15:49731852-49731874 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1126562988 15:50064800-50064822 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1126718137 15:51544364-51544386 GCAGAAGGTGAAGCAGGAGCCGG - Intronic
1127196479 15:56591425-56591447 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1127550562 15:60033652-60033674 GCAGAAGGCAAAGGGGAAGCGGG - Intronic
1127577453 15:60305703-60305725 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1127845431 15:62866422-62866444 GCAGAAGCAGATACAGAAGCAGG + Intergenic
1128476910 15:68005192-68005214 GCAGAAGACAAAACAGGAGGAGG - Intergenic
1128562377 15:68677390-68677412 GCTGAAGGCCACACAGCAGAGGG + Intronic
1129094808 15:73194474-73194496 GCAGAAGGCAAAATGGGAGCAGG + Intronic
1130192155 15:81747665-81747687 GCAGAATGCCAAGAGGAAGCAGG - Intergenic
1130709197 15:86263035-86263057 GCAGAATGCTAAACAAAAGTGGG + Intronic
1131271848 15:90952348-90952370 GTAGAAGGCAAAGCAGGAGCAGG + Intronic
1131474006 15:92720769-92720791 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1131697435 15:94893399-94893421 TCATAAGGCAAAACAGAAGGTGG - Intergenic
1131705532 15:94991677-94991699 GCAGAAGGCCAAGTAGGAGCAGG + Intergenic
1131969720 15:97879776-97879798 GCAGAAGGCAGAGCAGGAGCAGG + Intergenic
1131974889 15:97934557-97934579 GGAGAAGGCAAAGGAGAAGCAGG + Intergenic
1132034913 15:98474397-98474419 GCAGAAGGCAAAGAGGAAGCAGG + Intronic
1132159816 15:99529737-99529759 GCAGAAGGCAAAAGAGAATCAGG - Intergenic
1132210518 15:100018578-100018600 GCAGAAGGCAAAAGAGAAGTAGG - Intronic
1132287632 15:100676145-100676167 CCAGAAGTACAAAGAGAAGCTGG - Intergenic
1202957693 15_KI270727v1_random:92899-92921 GCAGAAGTGCAAACATTAGCAGG - Intergenic
1202959659 15_KI270727v1_random:111138-111160 GCGGAAGGACAGACAGGAGCGGG - Intergenic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133390846 16:5408748-5408770 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1133402024 16:5495137-5495159 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1133453697 16:5924144-5924166 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1133537958 16:6720313-6720335 GCAGAAGGCAAAAGGGAAGCTGG - Intronic
1133665870 16:7967154-7967176 GCAAAAGGCAAAGGAGAAGCAGG + Intergenic
1133945723 16:10346682-10346704 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1134208528 16:12257142-12257164 GCTGAGAGCCAACCAGAAGCGGG - Intronic
1134562871 16:15225854-15225876 GCAGAAGGCAGAGGAGAAGCAGG + Intergenic
1134572626 16:15304252-15304274 GCAGAAGGTGAAAGGGAAGCTGG - Intergenic
1134638069 16:15807889-15807911 GCCCAAGCCCAAACACAAGCTGG + Intronic
1134729757 16:16451771-16451793 GCAGAAGGTGAAAGGGAAGCTGG + Intergenic
1134923408 16:18137487-18137509 GCAGAAGGCAGAGGAGAAGCAGG + Intergenic
1134937676 16:18260125-18260147 GCAGAAGGTGAAAGGGAAGCTGG - Intergenic
1135075103 16:19386460-19386482 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1135089305 16:19500175-19500197 GTAGAAGCCCAAGCAGCAGCCGG - Intergenic
1135098694 16:19587042-19587064 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1135146896 16:19970455-19970477 GCAGAAGGCAAAGGAAAAGCAGG - Intergenic
1135333486 16:21581445-21581467 GCAGAAGGCAAAGGAGAAGTAGG - Intergenic
1135675149 16:24408739-24408761 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1135685827 16:24497667-24497689 GCAGAAGGCCAAGGGGGAGCTGG - Intergenic
1136030243 16:27497452-27497474 GCAGATAGACAAACAGATGCTGG + Intronic
1137333673 16:47526943-47526965 GCAGAAGACAAAACAGGAGAAGG + Intronic
1137472672 16:48775959-48775981 GCATAAGGCAAAGCAGGAGCAGG - Intergenic
1137542610 16:49375429-49375451 GCAGAAGGCAAAAGAGGAGCAGG + Intronic
1137603629 16:49772940-49772962 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1138166410 16:54805808-54805830 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1138218671 16:55229162-55229184 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
1138384788 16:56628808-56628830 GCAGAAGGCCAACAGGGAGCAGG - Intergenic
1138499996 16:57435236-57435258 GCAGAAGGTGAAGCAGGAGCAGG - Intronic
1138776936 16:59734584-59734606 GCAGAAGGCAAAAGGGAAGCAGG - Intronic
1138978898 16:62242412-62242434 GCAGAAGACAAAGGAGAAGCAGG - Intergenic
1139104833 16:63816086-63816108 TCAGAATGCCAAAAAGCAGCTGG + Intergenic
1139211201 16:65078842-65078864 GCAGAATGTCAACCAGAACCTGG + Intronic
1139777289 16:69324425-69324447 GCAGACGGCCAGACAGCAGAGGG - Exonic
1140297873 16:73726655-73726677 GCAGAAGGCAAAGCAGGAGCTGG + Intergenic
1140324440 16:73987893-73987915 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1141004120 16:80336364-80336386 GCAGAAAGCGAAGCAGGAGCAGG + Intergenic
1141045317 16:80711227-80711249 GCAGATGGCCAACAAGAAGTGGG + Intronic
1141069682 16:80942393-80942415 GCAGAAGGCAAAAGGGGAGCAGG - Intergenic
1141249650 16:82343530-82343552 GCAGAAGTCCTAGCAGTAGCAGG + Intergenic
1141346191 16:83248272-83248294 GAAGAAGGAGAAACAGAGGCAGG + Intronic
1141492095 16:84380721-84380743 ACAGAAGAACAAACAGAGGCAGG - Intronic
1141638184 16:85326586-85326608 GCAGAAGGGGAAGCAGAAGCAGG - Intergenic
1142782665 17:2193272-2193294 GCAGAAGGCGAAAGGGGAGCAGG - Intronic
1143104602 17:4522703-4522725 GCAGATGGCCAGACAAAGGCTGG - Intronic
1143848607 17:9792246-9792268 CCAGAAGGCCAATCACAATCAGG + Intronic
1143928956 17:10400464-10400486 GCAGCGGGTCAAACAGAAGCTGG - Exonic
1143951740 17:10638117-10638139 GCAGCGGGTCAAGCAGAAGCTGG - Exonic
1144254531 17:13453574-13453596 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
1144375963 17:14641802-14641824 GCAGAAGGCCAAGAAAGAGCAGG - Intergenic
1144446083 17:15330539-15330561 GCAGAAGGCAAAGGAGGAGCAGG - Intronic
1144580903 17:16458777-16458799 TCAGAAGGCTTAACAGAAGTTGG - Intronic
1144874772 17:18391664-18391686 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1145157453 17:20552757-20552779 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1145759117 17:27415922-27415944 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1145781718 17:27568019-27568041 GCAGATGGCCGAGGAGAAGCTGG - Intronic
1145799867 17:27676104-27676126 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1145922361 17:28619682-28619704 GGAGAAGGCCAACCTGCAGCTGG - Exonic
1146845244 17:36178316-36178338 GCAGAAGGCGAAGGGGAAGCAGG + Intronic
1146873458 17:36390159-36390181 GCAGAAGGCGAAGGGGAAGCAGG + Intronic
1146880819 17:36441247-36441269 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1147065930 17:37922714-37922736 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1147196585 17:38770581-38770603 GGAGAAGGGCAGACAGCAGCTGG + Intronic
1148198403 17:45731280-45731302 GCAGAAAGCAAAGCAGAAGTAGG + Intergenic
1148661625 17:49338440-49338462 GCAGAAGGGCGAAAAGAAGAGGG + Intronic
1148689311 17:49517691-49517713 GCGGAAGGCGAAAGGGAAGCAGG - Intergenic
1148827781 17:50406853-50406875 ACAGAAGGAGGAACAGAAGCTGG - Intergenic
1148897610 17:50848843-50848865 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1149041615 17:52196366-52196388 GCAGAAGGCAAAGGAGAAACAGG - Intergenic
1149047130 17:52259205-52259227 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1149134202 17:53345202-53345224 GCATAAGGCAAAAGGGAAGCAGG - Intergenic
1149175598 17:53867009-53867031 GTAGAAGGTCAAAAGGAAGCAGG + Intergenic
1149281650 17:55111645-55111667 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
1149386186 17:56145452-56145474 GCAGAAGGCAAAGGAAAAGCAGG + Intronic
1150384921 17:64751154-64751176 GCAGAAGGCCAAGGTGAAGTTGG + Intergenic
1150732988 17:67712051-67712073 GAAGAAGGCAACAAAGAAGCAGG + Intergenic
1151066391 17:71155191-71155213 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1151373528 17:73666326-73666348 GCAGAAGGCAAAGTGGAAGCTGG - Intergenic
1151902417 17:77025395-77025417 GCGGAAGGCAAAGGAGAAGCAGG + Intergenic
1151989663 17:77566244-77566266 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
1152219507 17:79054870-79054892 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1152391895 17:80008413-80008435 GCAGAACCACAACCAGAAGCTGG - Intronic
1152643153 17:81457552-81457574 CCAGAAGGCCAAGAAGAAGAAGG + Exonic
1152998923 18:435333-435355 GCAGAAGGCAAAGAAGAGGCAGG + Intronic
1153448901 18:5204632-5204654 GCAGAAGGTGAAACAGAAGCAGG - Intergenic
1153582996 18:6594197-6594219 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1153776119 18:8455755-8455777 GAAGAAGGACAAAGAGAAGAGGG - Intergenic
1153839590 18:8994372-8994394 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1153987189 18:10362897-10362919 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1154168348 18:12032911-12032933 GCAGAAGCAGAAGCAGAAGCAGG - Intergenic
1154284983 18:13046156-13046178 GCAGAAGGCGAAGCGGGAGCAGG + Intronic
1154452224 18:14487323-14487345 GCGGAAGGACAGACAGGAGCGGG - Intergenic
1154499691 18:14989698-14989720 GGAGGTGGCCAAAGAGAAGCAGG - Intergenic
1155344249 18:24843054-24843076 GCGAAAGGCCAAGCAGAAGCAGG + Intergenic
1155711369 18:28884616-28884638 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1155738758 18:29259177-29259199 CCATAATGCCAAACAGAAGCAGG - Intergenic
1155769625 18:29680631-29680653 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1156169226 18:34462469-34462491 GCAGAAGGTAAAGGAGAAGCAGG + Intergenic
1156181939 18:34615159-34615181 GAAGAAGGCAAAGCAGGAGCAGG + Intronic
1156224616 18:35091973-35091995 GCAGAAGGCCAAGGGAAAGCAGG + Intronic
1156861154 18:41837741-41837763 GCACAAGGTGAAAGAGAAGCAGG - Intergenic
1157027111 18:43857999-43858021 GCAGAAGGTGAAGCAGAAGCAGG - Intergenic
1157206475 18:45704466-45704488 GCAGAAGGCAAAGCAGGAGTAGG + Intergenic
1158031006 18:52964971-52964993 GAAGAAGTAGAAACAGAAGCAGG - Intronic
1158046807 18:53166026-53166048 GCAGAAGTCCAAACAAAAGATGG + Intronic
1158147903 18:54336413-54336435 GTAGAAGGCAAAGGAGAAGCAGG - Intronic
1158489405 18:57896338-57896360 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1158879205 18:61760442-61760464 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1158904593 18:62000002-62000024 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1159002752 18:62988194-62988216 ACCAAAGGCCAAACAAAAGCTGG - Intergenic
1159176261 18:64838892-64838914 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1159441187 18:68483067-68483089 GCAGAAGGCAAAGTGGAAGCCGG + Intergenic
1159537822 18:69737273-69737295 GCAGAAGGTGAAACGGAAGCAGG + Intronic
1159664773 18:71144796-71144818 TGAGAAGGCCAAAGAGAAGATGG - Intergenic
1159674182 18:71261112-71261134 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1159812073 18:73027626-73027648 GCAGTAGGCAAAGCGGAAGCAGG - Intergenic
1159918920 18:74210065-74210087 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1160460018 18:79032006-79032028 GCGGAAGGCAAAGAAGAAGCCGG + Intergenic
1160881239 19:1321704-1321726 ACAGAAGGCCAAGCAGAGGCTGG + Intergenic
1161478604 19:4499619-4499641 GGAGAAGGCCGAGGAGAAGCTGG + Exonic
1162217437 19:9148063-9148085 GCAGAAGGCAAAAGGGAAGCAGG - Intronic
1162764374 19:12909490-12909512 GCAGAGGGACAGAGAGAAGCTGG - Intronic
1163003549 19:14383725-14383747 GAAGTTGCCCAAACAGAAGCCGG - Intronic
1163449156 19:17365489-17365511 TCAGGAGGCGAAACAGAAGGTGG - Exonic
1163667773 19:18611136-18611158 GCAGAAGGAGAAACTGAGGCTGG - Intronic
1163792596 19:19316453-19316475 ACAGAAAGCCAAGCAGAATCAGG - Exonic
1164335969 19:24321592-24321614 GAAGAAGGATAAAGAGAAGCAGG - Intergenic
1164396997 19:27874769-27874791 GCAGAAGGCAAAAGTGGAGCAGG + Intergenic
1164437113 19:28240262-28240284 GCAGAAGTCCAAAGAAACGCTGG + Intergenic
1164821228 19:31252653-31252675 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1165027273 19:32971132-32971154 GCAGCAGTCCAGACAGATGCTGG + Intronic
1165173842 19:33912928-33912950 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1165180408 19:33962643-33962665 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1165197763 19:34118246-34118268 GCAGAAGGAGAAAGAGAAGGAGG + Intergenic
1165407065 19:35637521-35637543 GCAGAAGGAAAAGAAGAAGCTGG + Exonic
1165932597 19:39369674-39369696 GCAGGAGTCCAAAGAGAAGGTGG + Exonic
1166128885 19:40733527-40733549 GCAGACGGATAAACAGAACCTGG - Intronic
1166631634 19:44412117-44412139 GGGGAAGGCCAGAGAGAAGCTGG - Intergenic
1166636542 19:44456504-44456526 GGGGAAGGCCAGAGAGAAGCTGG + Intergenic
1166814987 19:45538987-45539009 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1167302185 19:48684495-48684517 ACAAAAGCCCAAGCAGAAGCTGG + Intergenic
1167673065 19:50866818-50866840 GTAGAAGGCAAAGCAGGAGCAGG - Intronic
1167683467 19:50940688-50940710 GGAGAAGGGCAAACTGAAGGGGG - Intergenic
1168560200 19:57375782-57375804 GTAGAAGGCAAAGGAGAAGCAGG + Intronic
925470443 2:4155560-4155582 GAAGATGGCCAAGCAGAGGCTGG + Intergenic
925476428 2:4221873-4221895 GCAGAAGGCGAAGGAGAAGCAGG + Intergenic
925663963 2:6233154-6233176 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
925752810 2:7104996-7105018 GTGGAAGGCTAAGCAGAAGCAGG - Intergenic
925806238 2:7651860-7651882 GCAGAAGGTGAAAGAGATGCAGG + Intergenic
926173818 2:10571300-10571322 GCAGAAGGTGAAGCGGAAGCAGG - Intronic
926416785 2:12657228-12657250 CCAGAAGGCCCAACAGGAACTGG + Intergenic
926492171 2:13537948-13537970 GCGGAAGGCAAAGAAGAAGCAGG - Intergenic
926545628 2:14235889-14235911 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
926849150 2:17175594-17175616 GCAGAAGGCAAAGTAGAAGCAGG + Intergenic
926853618 2:17228208-17228230 GCAGAAGGCAACAGGGAAGCAGG + Intergenic
927113697 2:19882221-19882243 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
927326445 2:21810968-21810990 GTAGAAGGGGAAGCAGAAGCAGG - Intergenic
927447855 2:23181229-23181251 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
927469222 2:23359859-23359881 GCAAAGGGCCACACAAAAGCTGG + Intergenic
927838034 2:26416933-26416955 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
927845259 2:26468311-26468333 GCAGGAGGGAAAAGAGAAGCAGG + Intronic
928002000 2:27531533-27531555 GCAGAAGGGGAAAGGGAAGCAGG - Intergenic
928087160 2:28353014-28353036 GGAGAAGGGCAAACAGAAAAAGG + Intergenic
928097180 2:28411986-28412008 GCAGAAGGAGAAGGAGAAGCTGG + Exonic
928218191 2:29380027-29380049 GTAGAAGGCAAAAGGGAAGCAGG + Intronic
928345932 2:30496054-30496076 GCAGAAGGCAAAGGGGAAGCTGG + Intronic
928413888 2:31075188-31075210 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
928836675 2:35555797-35555819 GCAGAAGGCCAAGGGGAAGTAGG + Intergenic
929040729 2:37742039-37742061 GCGGAAGGCGAAAGGGAAGCAGG - Intergenic
929132132 2:38587078-38587100 GCAGAAGGCCAAAGAAATGTCGG + Intronic
929363847 2:41127433-41127455 GCAAAAGGCAAAAGAGAAGCAGG + Intergenic
929415631 2:41744225-41744247 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
929720504 2:44362483-44362505 GAAGGAGGCAAAACAGAAGCAGG - Intronic
929853681 2:45616712-45616734 GCATAAGGCAAAGGAGAAGCAGG + Intergenic
930118439 2:47740036-47740058 ACAGAAGGCAAAGCAGGAGCAGG + Intronic
930233230 2:48863851-48863873 GCAGAAGGCAAAAAGGAAGCAGG + Intergenic
930274240 2:49293128-49293150 GCAGAAGGCCAAGGAGAAGCAGG - Intergenic
930506157 2:52284988-52285010 GCAAAAGGCAAAGGAGAAGCAGG + Intergenic
930605886 2:53492713-53492735 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
930982303 2:57542207-57542229 GCAGAAGGCAAAGGAGAAACAGG + Intergenic
931703509 2:64927506-64927528 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
931955322 2:67418137-67418159 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
932026542 2:68139301-68139323 GCAGAAGGCAAAAGGGGAGCAGG - Intronic
932461912 2:71887764-71887786 GCAGAAGGCAAAGGGGAAGCGGG - Intergenic
932510349 2:72280965-72280987 GCAGAAAGCCAAGCAGAAAATGG + Intronic
932879640 2:75489234-75489256 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
933135762 2:78733066-78733088 GCAGAAGGCAAAAGAGAAGCAGG - Intergenic
933164988 2:79065845-79065867 GCAGAAGGTGAAAGAGGAGCAGG - Intergenic
933198072 2:79415281-79415303 GCAGAAGGCCAAAGGGGAGCAGG - Intronic
933539485 2:83620184-83620206 ACAGAAGGCAAAAGGGAAGCAGG + Intergenic
933608573 2:84410236-84410258 GCAGAAGGCGAACAGGAAGCAGG + Intergenic
933753138 2:85616119-85616141 GCACAAGGCCAATCAGGAGAGGG - Intronic
933969283 2:87457216-87457238 TGAGCAGGCCAAACAGAACCTGG - Intergenic
934090582 2:88547214-88547236 GCAGAACTTCAAACACAAGCAGG - Intergenic
934910916 2:98253655-98253677 TCAGAAGGCCAAGAAGCAGCCGG - Intronic
934955373 2:98613470-98613492 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
935300415 2:101688907-101688929 GCAGAAAGCGAAGTAGAAGCAGG - Intergenic
935370748 2:102344094-102344116 GCAGAAGGCAAAGCAAAGGCAGG + Intronic
935832204 2:107011835-107011857 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
935965082 2:108464905-108464927 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
936103151 2:109601034-109601056 GCAGATGGCCAAACACATGGAGG - Intronic
936324503 2:111493278-111493300 TGAGCAGGCCAAACAGAACCTGG + Intergenic
936702983 2:115036116-115036138 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
936756876 2:115724833-115724855 GCAGAAGGTAAAGCAGGAGCAGG + Intronic
937170206 2:119858069-119858091 GCAGAAGGCAAAGTGGAAGCAGG - Intronic
937350534 2:121157506-121157528 GCAGAAGGCAAAAGGGAAGCAGG - Intergenic
937679891 2:124632854-124632876 GCAGAAAGGGAAGCAGAAGCAGG + Intronic
937786477 2:125905069-125905091 GCTGAAGGCAAAGGAGAAGCGGG - Intergenic
937807204 2:126160623-126160645 GCAGGAGGGCAAGCTGAAGCAGG + Intergenic
937827802 2:126387195-126387217 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
937889362 2:126925431-126925453 GTGGAAGGCAAAAGAGAAGCAGG - Intergenic
937889622 2:126927336-126927358 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
938017484 2:127879405-127879427 GCGGAAGGCAAAGCAGGAGCGGG - Intronic
938417528 2:131116516-131116538 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
938479369 2:131646850-131646872 GCGGAAGGACAGACAGGAGCGGG + Intergenic
938493590 2:131778614-131778636 GGAGGTGGCCAAAGAGAAGCAGG + Intergenic
938498901 2:131820051-131820073 GGAGGTGGCCAAAGAGAAGCAGG - Intergenic
938692458 2:133804903-133804925 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
938890399 2:135698723-135698745 GCAGAAGGCAAGAGGGAAGCAGG + Intronic
938920542 2:135990543-135990565 GCAGGAAGCCAAAAAGCAGCAGG - Intergenic
939091153 2:137781414-137781436 GCAGAAGGCAAAGCAGAAGCAGG + Intergenic
939358978 2:141143913-141143935 GCAGGAGTCTAAACAGAACCAGG + Intronic
939692053 2:145275519-145275541 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
939706000 2:145454432-145454454 GCAGAAGGCAAAGCCAAAGCAGG - Intergenic
939885558 2:147677612-147677634 GAGGAAGCCCAAACAGAACCTGG + Intergenic
939963558 2:148588139-148588161 GCAGAAGGCAAAACAGGAGCAGG + Intergenic
939978430 2:148748220-148748242 GGAGAAGGCGAAAGGGAAGCAGG - Intronic
940149147 2:150579730-150579752 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
940269306 2:151874036-151874058 GCAGAAGGCCAAGCGGGAGCAGG - Intronic
940575366 2:155496675-155496697 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
940912825 2:159224198-159224220 GCAGAAGCCTAAGCAGCAGCTGG - Intronic
941073539 2:160981766-160981788 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
941122469 2:161546719-161546741 ACAGAAGGCAAAGCAGGAGCAGG + Intronic
941250597 2:163156891-163156913 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
941301537 2:163808615-163808637 ACAGAAGGCAAAAGAGTAGCAGG - Intergenic
941349329 2:164413356-164413378 GTGGAAGGCAAAGCAGAAGCAGG + Intergenic
941509118 2:166384014-166384036 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
941701019 2:168604735-168604757 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
941815742 2:169794257-169794279 GGAAAAGGTCAAAGAGAAGCAGG + Intronic
941997599 2:171615333-171615355 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
942189415 2:173455902-173455924 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
942358458 2:175145432-175145454 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
943483273 2:188448897-188448919 GCAGAAGGCAAAACAGGAGCAGG - Intronic
943832179 2:192477225-192477247 GCAGAAGGCAAAACAGGAGCAGG - Intergenic
943945959 2:194064762-194064784 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
944091064 2:195912492-195912514 GCAGAAGGCCCATCTGAAACAGG + Intronic
944100713 2:196023242-196023264 GCAGAAGGCAAAATGGGAGCAGG - Intronic
944225995 2:197349152-197349174 GCAGAGAGCCAAACAGAAGGAGG - Intergenic
944479886 2:200145623-200145645 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
944581472 2:201136582-201136604 GCAGAAGGCCAATGTGAATCTGG - Intronic
944785966 2:203070680-203070702 GCAGAAGGCAAAGCAGGAGCAGG + Intronic
945009391 2:205445454-205445476 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
945530979 2:210951853-210951875 GCAGAAGGTAAAAGGGAAGCAGG + Intergenic
945724735 2:213462690-213462712 GCAGAAGGCAAAGGAGAAACAGG - Intronic
945753613 2:213818864-213818886 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
945766106 2:213979493-213979515 GCAGAAGTCAAAGGAGAAGCAGG + Intronic
946055705 2:216900252-216900274 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
946094088 2:217257419-217257441 GCAGAAGGCAAAGAATAAGCTGG + Intergenic
946550330 2:220794027-220794049 GCGGAAGGCAAAGGAGAAGCAGG - Intergenic
946766799 2:223048073-223048095 GCGGAAGGCAAAGGAGAAGCAGG + Intergenic
947110955 2:226719279-226719301 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
947113517 2:226745189-226745211 TCAGAAGGCCATACACAGGCAGG + Intronic
947273747 2:228368468-228368490 GCAGAAGGTCAAACGCATGCCGG + Intergenic
947615701 2:231555462-231555484 GCAGAAAGACAAAGAGAGGCTGG + Intergenic
947719584 2:232362383-232362405 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
948014508 2:234677069-234677091 GCAGATGGCCAAACAAAGACCGG - Intergenic
948034879 2:234850356-234850378 ACAGAAGGCGAAGCAGAAGCAGG + Intergenic
948119741 2:235520570-235520592 GCAAAAGGACAAATAGAAGGTGG - Intronic
948131255 2:235602102-235602124 CTAGAAAGCCATACAGAAGCAGG - Intronic
948299130 2:236888806-236888828 GCAGCAGGCCACACAGACGCAGG - Intergenic
948700752 2:239758121-239758143 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
948757074 2:240166125-240166147 GCAGAAGGCAAAAGGGAAGCAGG - Intergenic
948842528 2:240661197-240661219 GCAGAAGGCAAAGCGGGAGCAGG + Intergenic
948980675 2:241493002-241493024 GTAGAAGAACAAACAGAAGTTGG - Exonic
1169164890 20:3414765-3414787 GCAGAAGACAAAGGAGAAGCAGG + Intergenic
1169165227 20:3417032-3417054 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
1169358066 20:4924493-4924515 GCAGGAGGCCAGGCAGGAGCTGG - Intronic
1169569744 20:6892798-6892820 GCAGAAGAAAGAACAGAAGCAGG + Intergenic
1169873688 20:10273573-10273595 GCAGAAGGAGAAACAGAGGGAGG + Intronic
1169899140 20:10535143-10535165 GCAGAAGGCCAGGCTGGAGCAGG + Intronic
1169977726 20:11349224-11349246 GCAGAAGGCAAGATAGGAGCAGG - Intergenic
1169994579 20:11542245-11542267 GCAGAAGAACAAACTGAGGCTGG + Intergenic
1170109293 20:12787519-12787541 GCAGAAGGCAAAGGAGAAACAGG - Intergenic
1170259365 20:14386644-14386666 GCAGAAGGCAAAAGGGGAGCTGG - Intronic
1170377235 20:15713492-15713514 GCAGAATGCAAAAGGGAAGCAGG + Intronic
1170426215 20:16237786-16237808 ACAGAAGGCCAAGAGGAAGCAGG + Intergenic
1170726999 20:18938432-18938454 CCAGAAGTACAAACAGGAGCTGG - Intergenic
1170973316 20:21137290-21137312 GCAGGAAGCCAAGCAGCAGCAGG - Intronic
1171036493 20:21716276-21716298 TTAGAAGGTCAAACAGAGGCAGG - Intronic
1171053798 20:21886391-21886413 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
1171180264 20:23086194-23086216 GCAGAGGGCCACACAGAGACCGG - Exonic
1171403706 20:24895518-24895540 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1171815339 20:29781435-29781457 ACAGAAGGCAAAAGGGAAGCAGG + Intergenic
1171954647 20:31451635-31451657 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
1172454951 20:35063199-35063221 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1172806187 20:37613499-37613521 GCAGAAGGCAAAGTGGAAGCAGG - Intergenic
1172809180 20:37634718-37634740 GCAGAAGGGGAAACAGTAGCTGG + Intergenic
1172849417 20:37949962-37949984 GCGGAAGGTGAAGCAGAAGCAGG + Intergenic
1173181645 20:40810559-40810581 ACAGAAAGCCAGAGAGAAGCAGG + Intergenic
1173399716 20:42713862-42713884 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1173684078 20:44910381-44910403 GCAGGCGGACAGACAGAAGCCGG + Intronic
1173768829 20:45640157-45640179 GCAGAAGGAAAAGCAGGAGCAGG + Intergenic
1173909734 20:46657776-46657798 GCAGAAGGCGAACCAGGAGCAGG + Intronic
1173966229 20:47114894-47114916 GCAGAAGGCCAAGTGGGAGCAGG - Intronic
1174060521 20:47829725-47829747 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1174060963 20:47832854-47832876 GCTGGAGGCCAAAGAGGAGCTGG - Intergenic
1174070934 20:47898516-47898538 GCTGGAGGCCAAAGAGGAGCTGG + Intergenic
1174071377 20:47901645-47901667 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1174089443 20:48035371-48035393 GCAGAAGGCGGAAGGGAAGCAGG - Intergenic
1174152676 20:48497016-48497038 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1174666036 20:52258621-52258643 GCAGAAGACAAAAGGGAAGCAGG - Intergenic
1174675468 20:52350061-52350083 GAAGAAGGGAAAACAGATGCTGG - Intergenic
1175129005 20:56775153-56775175 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
1175163238 20:57024194-57024216 GGAGGGGGCCAATCAGAAGCAGG + Intergenic
1175624170 20:60476664-60476686 GGAGAAGGCTAAGCAGAGGCAGG + Intergenic
1175635121 20:60575444-60575466 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1175649135 20:60702065-60702087 GCAGAAGGTAAAGCAGAAGCAGG - Intergenic
1175692153 20:61073255-61073277 GCAGAAGGCAGAAGAGAGGCAGG - Intergenic
1175695103 20:61097239-61097261 GCAGAAGGCAAAGCAGGAGCTGG + Intergenic
1175849334 20:62080218-62080240 GTAGAAGGCAAAGGAGAAGCAGG + Intergenic
1175849662 20:62082731-62082753 GTAGAAGGCAAAGGAGAAGCAGG - Intergenic
1175852788 20:62102797-62102819 GCAGAAGGGGAAGCAGGAGCAGG - Intergenic
1175942595 20:62544741-62544763 GCAGAAGGCGAAGGAGGAGCAGG + Intergenic
1176093641 20:63329774-63329796 GCACAAGGCCCAGCAGAGGCAGG + Intronic
1176255341 20:64149169-64149191 GCAGAAGGCAAAATAGCTGCAGG + Intergenic
1176419620 21:6503710-6503732 GCAGAAGGAGAAGCAGCAGCTGG - Intergenic
1176443801 21:6800977-6800999 GCGGAAGGACAGACAGGAGCGGG + Intergenic
1176614301 21:9015752-9015774 GGAGGTGGCCAAAAAGAAGCAGG - Intergenic
1176710896 21:10148117-10148139 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1176821970 21:13666016-13666038 GCGGAAGGACAGACAGGAGCGGG + Intergenic
1176883632 21:14228720-14228742 GTAGAAGGCAAAGGAGAAGCAGG - Intergenic
1176913691 21:14599393-14599415 GCAGAAGGCTAAGGAGAAGCAGG - Intronic
1176954791 21:15089197-15089219 GCGGAAGGCAAAGCAGAAGCAGG - Intergenic
1176963601 21:15187594-15187616 GCAGAAGGCAAAACAGATGCAGG + Intergenic
1177089402 21:16748180-16748202 GCGGAAGGCAAAGCGGAAGCAGG - Intergenic
1177147782 21:17425215-17425237 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1177169432 21:17639576-17639598 GCAGAAGGTGAAAGAGAAGCAGG + Intergenic
1177270973 21:18849304-18849326 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1177273420 21:18877050-18877072 GCAGAAGGTGAAGCGGAAGCAGG + Intergenic
1177283753 21:19021098-19021120 GGAGAAGGTCAAAGGGAAGCAGG - Intergenic
1177393949 21:20509946-20509968 GTGGAAGGCAAAAGAGAAGCAGG + Intergenic
1177397006 21:20549370-20549392 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1177446002 21:21196995-21197017 GAAGAAGGCAACACAGGAGCAGG - Intronic
1177496021 21:21893819-21893841 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1177620875 21:23591352-23591374 GCAGAAGGCAAAAGGGAAGAAGG - Intergenic
1177739560 21:25136958-25136980 GCAGAAGGCCAAGGGGAAGCAGG + Intergenic
1177882096 21:26706287-26706309 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1177883182 21:26718370-26718392 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
1178148119 21:29763278-29763300 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1178238683 21:30873783-30873805 GCAGAAGGTCAAAGAGCAGGGGG - Intergenic
1178765789 21:35449974-35449996 GCAGAAGGCAAAGCAGGAGCAGG + Intronic
1178836012 21:36098167-36098189 GCTGAAGGTGAAGCAGAAGCAGG + Intergenic
1178883114 21:36464207-36464229 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1178988866 21:37334780-37334802 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1179044203 21:37830358-37830380 GAGGAAGGCCAAACAGACCCAGG - Intronic
1179550249 21:42139299-42139321 GCAGAAGACCAAGGGGAAGCAGG + Intronic
1179570751 21:42277536-42277558 GCAGAAAGCCACACAGAGGAAGG + Intronic
1179695113 21:43112033-43112055 GCAGAAGGAGAAGCAGCAGCTGG - Intergenic
1179962245 21:44774774-44774796 GGAGAAGGCAACACAGAAGTGGG - Intronic
1180097503 21:45564529-45564551 ACAGAAGGACAATCTGAAGCTGG + Intergenic
1180117433 21:45719657-45719679 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1180497795 22:15904658-15904680 GGAGGTGGCCAAAGAGAAGCAGG + Intergenic
1180499210 22:15917622-15917644 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
1180757081 22:18169613-18169635 GCGGAAGGCCAAGCAGGAGCAGG - Intronic
1181074697 22:20367852-20367874 GCGGAAGGCCAAGCAGGAGCAGG + Intronic
1181261265 22:21599541-21599563 ACTTAAGACCAAACAGAAGCAGG + Intronic
1181296483 22:21844060-21844082 GCAGAAGGGCAAGCAAAGGCAGG + Intronic
1181333172 22:22110304-22110326 GCAGATAGCTAGACAGAAGCAGG - Intergenic
1181976141 22:26731598-26731620 GCAGAAGGCGAAAGGGAAGCAGG + Intergenic
1182096339 22:27628512-27628534 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1182144095 22:27986293-27986315 GCGGAAGGCGAAGGAGAAGCAGG - Intronic
1182402245 22:30087661-30087683 GCAGAAGACAAAGGAGAAGCAGG + Intronic
1182470709 22:30546581-30546603 GCAGAAGGAGAAACTGAGGCTGG + Intronic
1182529552 22:30944732-30944754 GTAGAAGGCGAAAGCGAAGCAGG - Intronic
1182744635 22:32596147-32596169 TCAGAAGGCGAAAGGGAAGCAGG - Intronic
1182831243 22:33306272-33306294 GCAGAAGGTAAAACAGGTGCAGG - Intronic
1182881277 22:33735590-33735612 GCTGAAGGCAAAACAGGACCAGG - Intronic
1182995961 22:34812684-34812706 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1183025457 22:35062783-35062805 GCAGAAGGCAAAGTGGAAGCAGG + Intergenic
1183221274 22:36515017-36515039 GCAGAAAGCAAAGGAGAAGCAGG - Intronic
1183288129 22:36980798-36980820 GCAGAAGGCGAAGCGGGAGCAGG + Intergenic
1183382295 22:37496284-37496306 GCACAAGGACAGACAGAAGGAGG + Intronic
1183437936 22:37805973-37805995 CAAGAAGGCCAAGAAGAAGCTGG + Exonic
1183594310 22:38800965-38800987 GCAGAAGGTGAAGAAGAAGCAGG - Intergenic
1184432944 22:44452222-44452244 GCGGAAGGCAAAGCAGGAGCCGG - Intergenic
1184498727 22:44859395-44859417 GCAGAAGGCAAAAAGGAAGGAGG - Intronic
1184894597 22:47399780-47399802 GCGGAAGGCGAAGGAGAAGCAGG + Intergenic
1185076158 22:48683924-48683946 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1203292993 22_KI270736v1_random:13618-13640 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
949267432 3:2174808-2174830 GCAGAAGGCAAAGCAGGAGCGGG + Intronic
949526909 3:4913692-4913714 GCAGAAGGCAAAAAGGAAGCAGG + Intergenic
949602902 3:5620346-5620368 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
949724811 3:7031823-7031845 GCACAAGGCCAAGCACAAACAGG + Intronic
950374806 3:12562477-12562499 GAAAAAGCACAAACAGAAGCTGG - Intronic
950402915 3:12784302-12784324 GTAGAAGGCAAAAGAGAAGCAGG - Intergenic
950526652 3:13528378-13528400 AAAGAGGGCCAAACAGAGGCTGG + Intergenic
950827903 3:15844972-15844994 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
950955883 3:17053259-17053281 GCAGAAGGTGAAGGAGAAGCAGG + Intronic
951306846 3:21074350-21074372 GCAGAAGGCAAAGGAGAAACAGG + Intergenic
951415212 3:22414840-22414862 CAAGGAGGGCAAACAGAAGCAGG - Intergenic
951429306 3:22587475-22587497 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
951520071 3:23603142-23603164 GCTGAAGGCCAGACAGCACCAGG - Intergenic
951530139 3:23691318-23691340 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
951928462 3:27936490-27936512 GCAGAAGGTGAAAGAGAAGTAGG - Intergenic
951937166 3:28034282-28034304 GCGGAAGGCAAAGGAGAAGCAGG - Intergenic
952074306 3:29677019-29677041 GTAGAAGGCAAAGCAGAAGCAGG + Intronic
952194883 3:31064898-31064920 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
952346058 3:32486913-32486935 GCAGAAGGCGAGGCGGAAGCAGG - Intronic
952363522 3:32654228-32654250 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
952523397 3:34184785-34184807 GCAGAAGGTGAAGAAGAAGCAGG - Intergenic
952671406 3:35973886-35973908 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
952671680 3:35975801-35975823 GCAGAAAGCAAAGGAGAAGCAGG + Intergenic
952734900 3:36680015-36680037 GCAGAAGGCTAAGGGGAAGCAGG + Intergenic
952972938 3:38665952-38665974 GCAGAAGGCAAAGAAGAAGCAGG - Intergenic
953140006 3:40220753-40220775 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
953237369 3:41118517-41118539 GCAGAAGGCAAAGCAAGAGCAGG + Intergenic
953378118 3:42445843-42445865 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
953402946 3:42642542-42642564 GCAGAGGCCGAACCAGAAGCCGG + Exonic
953411473 3:42692756-42692778 GAAGCAGGACAAAGAGAAGCCGG - Exonic
953738342 3:45515221-45515243 GCAGAAGAACAGAGAGAAGCAGG - Intronic
953990468 3:47479309-47479331 GCACAAGGCCACGCAGAAGATGG + Intergenic
954329812 3:49883863-49883885 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
954472030 3:50706101-50706123 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
954601000 3:51869225-51869247 GTAGAAGGCAAAGGAGAAGCAGG - Intergenic
954927889 3:54253385-54253407 GCAGAAGGCAAAAGGGTAGCAGG + Intronic
954984540 3:54778094-54778116 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
955056667 3:55461268-55461290 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
955108534 3:55924612-55924634 GCAGAACTCCAAGCAGAAGGTGG + Intronic
955130476 3:56161182-56161204 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
955167403 3:56527890-56527912 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
955577355 3:60380317-60380339 GCAGAAGGCAAAAGGGGAGCTGG - Intronic
955636525 3:61036154-61036176 GCAGAAGGCGAAATAGTAGCAGG + Intronic
955841526 3:63117878-63117900 GCACAAATCCAGACAGAAGCAGG - Intergenic
956132582 3:66068420-66068442 GCAGAATGCAAAATAGTAGCTGG - Intergenic
956284135 3:67590594-67590616 GCAGAAGGCAAAGCAGGAGTAGG - Intronic
956323673 3:68026958-68026980 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
956512603 3:70010796-70010818 GCAGAAGGCAAAGGAGCAGCAGG + Intergenic
956544929 3:70390505-70390527 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
956711418 3:72041713-72041735 CCAAGATGCCAAACAGAAGCCGG + Intergenic
956901824 3:73724720-73724742 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
957018809 3:75100964-75100986 GCGGAAGGCAAAAGGGAAGCAGG - Intergenic
957585915 3:82131754-82131776 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
957746189 3:84346599-84346621 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
957747865 3:84368027-84368049 GCTGAAGGCAAAGCAGGAGCAGG + Intergenic
957899100 3:86465154-86465176 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
957978084 3:87473389-87473411 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
958047794 3:88305599-88305621 GTGGAAGGCAAAGCAGAAGCAGG - Intergenic
958163565 3:89849781-89849803 GCAGACGGCGAAGGAGAAGCAGG - Intergenic
958256701 3:91333035-91333057 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
958551636 3:95621545-95621567 GTAGAAGGCAAAAAGGAAGCAGG + Intergenic
958558121 3:95705690-95705712 GCAGAAGGCAAAGTGGAAGCAGG - Intergenic
958611549 3:96432850-96432872 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
959149593 3:102592218-102592240 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
959237895 3:103748191-103748213 GCAGAAGGCAAATGAGAAGCAGG + Intergenic
959337866 3:105088880-105088902 ACAGAAGGTGAAACAGGAGCAGG - Intergenic
959355604 3:105324188-105324210 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
959448547 3:106469809-106469831 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
959468897 3:106724292-106724314 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
959742416 3:109736507-109736529 GCAGAAGGCAAAGGAGAGGCAGG + Intergenic
959771900 3:110108632-110108654 GCAGAAGGTAAAGGAGAAGCAGG + Intergenic
960059978 3:113310868-113310890 TCAGAAGCCAAAACAGGAGCAGG - Intronic
960077960 3:113509929-113509951 GCAGAAGGCCAAACAGAAGCAGG - Intronic
960216448 3:115044028-115044050 GCAGAAGGCAAAGGAGGAGCAGG - Intronic
960228245 3:115192681-115192703 GTGGAAGGCCAAGGAGAAGCAGG - Intergenic
960488506 3:118281768-118281790 GCACATGGCCACACAGAAGCTGG + Intergenic
960911094 3:122650307-122650329 ACAGAAGGCAAAGGAGAAGCGGG + Intergenic
960999916 3:123367282-123367304 GCAGGAGGACAAAGAGAGGCTGG + Intronic
961156105 3:124681045-124681067 GAGGAAGGCCAGACAGAGGCAGG + Intronic
961608257 3:128114558-128114580 ACTGCAGGCCAAACAGAACCAGG - Intronic
961949369 3:130732052-130732074 CCAGAAGACCAAAGAAAAGCAGG + Intronic
962095999 3:132293396-132293418 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
962255913 3:133870170-133870192 GCAGAAGGCAAAGGAGAAACAGG + Intronic
962435801 3:135365603-135365625 GCAGAAGACCGAAGAGAAGAAGG + Intergenic
962456792 3:135572304-135572326 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
962472491 3:135724131-135724153 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
962518577 3:136176745-136176767 GCAGAAGGCTAAAGGGGAGCAGG - Intronic
962552690 3:136511152-136511174 GCAGAATGCAAAGGAGAAGCAGG - Intronic
962871053 3:139493526-139493548 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
963828252 3:149979241-149979263 GCAGAAGGTGAAGGAGAAGCAGG - Intronic
963853339 3:150228710-150228732 GTGGAAGGCAAAAGAGAAGCAGG + Intergenic
964092247 3:152891501-152891523 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
964324879 3:155534866-155534888 GCAGAGGGCAAAAAGGAAGCAGG - Intronic
964367612 3:155966602-155966624 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
964505493 3:157394624-157394646 GCAGAAGGCAAAGCAGGAGTAGG + Intronic
964567703 3:158075736-158075758 GCAGAAGGCAAAGCCGGAGCAGG - Intergenic
964852987 3:161115156-161115178 GCAGAAGGCAAAACGATAGCTGG + Intronic
964884084 3:161460249-161460271 GCAGAAGGCAAAAAGGAAGGAGG - Intergenic
965127741 3:164651113-164651135 GCAGAAGGCAAAGGAGAAGTAGG - Intergenic
965281736 3:166763998-166764020 ATAGAAGGCAAAAGAGAAGCAGG + Intergenic
965298032 3:166975577-166975599 ACAGAAGGTGAAACAGAAGCAGG - Intergenic
965582024 3:170278797-170278819 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
965756696 3:172034849-172034871 GCAGAAGGTAAAGCAGGAGCAGG + Intergenic
965891548 3:173520112-173520134 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
966121638 3:176528273-176528295 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
966224912 3:177587832-177587854 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
966336385 3:178872614-178872636 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
966393687 3:179478944-179478966 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
966408769 3:179627080-179627102 GCAGAAAGCAAAGCAGGAGCAGG + Intronic
966550371 3:181198582-181198604 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
966619050 3:181944628-181944650 GCAGAAGGCGAAGTAGGAGCAGG + Intergenic
967013915 3:185464555-185464577 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
967548703 3:190763845-190763867 GCAGAAGGCAAAGCAGAAGCAGG - Intergenic
968124496 3:196148536-196148558 GCAGAAGGCGAAGCGGGAGCAGG - Intergenic
968156992 3:196389623-196389645 GCAGAAGGCAAAGGGGAAGCCGG - Intronic
968808601 4:2790164-2790186 GAATAAGGCCAAAGAGAAGGGGG - Intergenic
968885107 4:3324729-3324751 GAAGAAGGCCAAAGGGAAGGAGG - Intronic
969072006 4:4547078-4547100 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
969095138 4:4727155-4727177 GTGGAAGGCAAACCAGAAGCAGG - Intergenic
969151945 4:5177226-5177248 GCAGAAGGCAAAGGAGAAGCCGG + Intronic
969189116 4:5502708-5502730 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
969484149 4:7462472-7462494 GCAGAAGCCCAGATAAAAGCAGG + Intronic
969762695 4:9200955-9200977 GTGGAAGGCAAGACAGAAGCAGG - Intergenic
969929666 4:10618687-10618709 GCAGAAAGTGAAGCAGAAGCAGG + Intronic
970068658 4:12129160-12129182 GCAGAGGGTGAAACAGGAGCAGG - Intergenic
970211522 4:13715101-13715123 GCAAAAGGACAAAGAGAAGTTGG - Intergenic
970229448 4:13893710-13893732 GCAGAAGGCAAAGAAGAAGCAGG - Intergenic
970245697 4:14060008-14060030 GCAGAAGGCGAAGGAGAAGCAGG - Intergenic
970249641 4:14100759-14100781 GCAAAAGGTGAAGCAGAAGCAGG + Intergenic
970346170 4:15154184-15154206 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
970497492 4:16641518-16641540 GCAGAAGGTGAAGCAGAAACAGG + Intronic
970690376 4:18612814-18612836 GCAGAAGTAGAAACAGCAGCAGG - Intergenic
970807767 4:20056035-20056057 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
970886422 4:20992233-20992255 GCAGAGGGCAAAGGAGAAGCAGG + Intronic
970953506 4:21784094-21784116 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
971001952 4:22333154-22333176 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
971003313 4:22346732-22346754 GCAGAAGGTGAAGGAGAAGCAGG - Intronic
971078014 4:23172859-23172881 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
971101600 4:23472491-23472513 GCAGATGGCAAAGGAGAAGCAGG + Intergenic
971157728 4:24101278-24101300 GCAGAAGGCGCAGGAGAAGCAGG - Intergenic
971454784 4:26834131-26834153 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
971593261 4:28496424-28496446 GCTGAAGGCAAAGGAGAAGCAGG - Intergenic
971677555 4:29653270-29653292 ACAGAAGGCAAAGGAGAAGCAGG + Intergenic
971715254 4:30167470-30167492 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
971725684 4:30308674-30308696 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
971930008 4:33069283-33069305 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
972196488 4:36659592-36659614 CCAGAGGGACAAAGAGAAGCTGG + Intergenic
972289462 4:37678110-37678132 GCAGAAGGCAACAGAGGAGCAGG + Intronic
972354900 4:38271425-38271447 GCAGAAGGCAAAGCAGGGGCAGG - Intergenic
972517798 4:39825440-39825462 AATGAAGGCCAAACAGAAGCAGG - Exonic
972850445 4:43042598-43042620 GCGAAAGGCCAAGCAGGAGCAGG - Intergenic
972976798 4:44644987-44645009 GCAGAAGGCAAAGCAAGAGCAGG - Intronic
973010632 4:45068738-45068760 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
973074471 4:45905123-45905145 GCAGAAAGCAAAAGGGAAGCTGG + Intergenic
973128615 4:46620904-46620926 GCAGAAGGCTAAAGGGGAGCAGG - Intergenic
973169095 4:47116861-47116883 GCAGAAGGGCAAGGGGAAGCAGG + Intronic
973180107 4:47256637-47256659 GTAGAAGGCAAAGGAGAAGCAGG + Intronic
973560790 4:52133237-52133259 GCGGAAGGCAAAGCAGAAGCAGG - Intergenic
973628866 4:52799869-52799891 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
973674893 4:53254390-53254412 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
973698743 4:53516264-53516286 GCAAAATGCCAAACAGTACCTGG + Intronic
973749081 4:53994537-53994559 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
973987762 4:56372161-56372183 GAAGAGGCCCAAACAGCAGCTGG + Intronic
974101380 4:57421473-57421495 GTAGAAGGCAAAGGAGAAGCAGG - Intergenic
974197276 4:58591838-58591860 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
974872371 4:67659498-67659520 GCAGAAGGCACAGGAGAAGCAGG - Intronic
975029774 4:69600726-69600748 GCAGAAGGCAACAGAGCAGCAGG + Intronic
975230381 4:71925164-71925186 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
975460402 4:74646219-74646241 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
975488556 4:74963090-74963112 GCAGAAGGCAAAGGAGAAACAGG - Intronic
975610011 4:76194117-76194139 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
975859754 4:78664085-78664107 GCAGAAGGCAAAAGGAAAGCAGG - Intergenic
976453656 4:85220371-85220393 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
976530219 4:86143082-86143104 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
976735494 4:88304694-88304716 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
977016237 4:91695886-91695908 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
977271106 4:94918011-94918033 GCAGAAGGTGAAGCAGGAGCAGG - Intronic
977389635 4:96391264-96391286 GCAGAAGGCAAAAAGGGAGCAGG - Intergenic
977393593 4:96445413-96445435 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
977917973 4:102614564-102614586 GCAGGAGGCCAAGCAGAGGGTGG - Intronic
977970116 4:103203243-103203265 GTGGAAGGCGAAGCAGAAGCAGG + Intergenic
978178062 4:105758511-105758533 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
978547966 4:109893559-109893581 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
978649602 4:110984664-110984686 GCAGAAGCCCAAAGAGATACTGG + Intergenic
979049234 4:115909455-115909477 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
979152108 4:117332043-117332065 GCAGAAGGCAAAACAGAAGCAGG + Intergenic
979428159 4:120593680-120593702 GCGGAAGGCTAAAGGGAAGCTGG + Intergenic
979428889 4:120602847-120602869 GAAGAGGGCCACACAGAAGGGGG + Intergenic
979610495 4:122684061-122684083 GCAAAAGGCAAAAGGGAAGCAGG - Intergenic
979658358 4:123223527-123223549 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
979703589 4:123694676-123694698 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
979848280 4:125544662-125544684 GCGGAAGGCAAAGGAGAAGCAGG - Intergenic
979852548 4:125591659-125591681 GCAGAAGGCAAAAGGGAAGAAGG + Intergenic
979877178 4:125907494-125907516 GCAGAAGGCGAAATGGGAGCGGG - Intergenic
980300633 4:130986904-130986926 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
980315696 4:131196871-131196893 GCAGATAGCCAGACACAAGCAGG - Intergenic
980325388 4:131338258-131338280 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
980384093 4:132063284-132063306 GCAGAAGGCAAAGGAGGAGCTGG + Intergenic
980406901 4:132365657-132365679 GCAGAAGGCGAAGAGGAAGCTGG + Intergenic
981176995 4:141693139-141693161 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
981259936 4:142707608-142707630 GCAGAAGGCCAAGAGGAAGGAGG - Intronic
981426670 4:144611369-144611391 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
981442340 4:144797403-144797425 GTAGAAGGCAAAGCAGGAGCAGG - Intergenic
981447742 4:144859786-144859808 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
981460927 4:145013033-145013055 GCAGAAGACAAAAGGGAAGCAGG - Intronic
981512997 4:145577894-145577916 CCAGAGGTACAAACAGAAGCTGG + Intergenic
981937919 4:150254368-150254390 GCAGAAGGCAGGAGAGAAGCAGG - Intronic
982021080 4:151205141-151205163 ATAGAAGGCCAAAGAGAAGAGGG + Intronic
982210332 4:153029533-153029555 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
982256835 4:153459131-153459153 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
982301350 4:153882061-153882083 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
982428706 4:155297691-155297713 ACAGAAGGCAAAAAAGAAGCAGG + Intergenic
982570992 4:157050573-157050595 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
982795804 4:159642198-159642220 GCAGAAGGCCAAGGGGAAGCTGG + Intergenic
982834824 4:160110393-160110415 GCACAAGGCGAAGGAGAAGCAGG + Intergenic
983084809 4:163429716-163429738 GCAGAAGGCGAAGCAGGAGCAGG + Intergenic
983291272 4:165808958-165808980 GCAGAAGGCAAAATGGGAGCAGG + Intergenic
983469173 4:168135984-168136006 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
983665372 4:170176277-170176299 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
983719124 4:170824059-170824081 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
983802711 4:171954895-171954917 GTAGAAGGCAAAAGGGAAGCAGG - Intronic
983896345 4:173085438-173085460 GCAGAATGCCAAGCAGGAGAGGG + Intergenic
984138972 4:175978213-175978235 GCAGAAGGTGAAAGGGAAGCAGG + Intronic
984253945 4:177367619-177367641 GCATAAGGACTAACAGATGCAGG - Intergenic
984314189 4:178105225-178105247 GCAGAAGGCAACGGAGAAGCAGG + Intergenic
984414957 4:179446328-179446350 GTGGAAGGCCAAGGAGAAGCAGG - Intergenic
984453324 4:179931680-179931702 GTAGAAGGCAAAGGAGAAGCAGG - Intergenic
984632208 4:182073143-182073165 GCAGGAGGCGAAGCAGAAGCAGG + Intergenic
984736579 4:183114228-183114250 GTAGAAGGCAAAAGAGGAGCAGG - Intronic
985008679 4:185560247-185560269 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
985636636 5:1038897-1038919 GCAGGAGGCCAAGCAGCAGAAGG + Exonic
985860426 5:2466319-2466341 GCAGGAGGCCACAGAGAAGGCGG - Intergenic
985929366 5:3044609-3044631 GATGATGGCCAAACAGCAGCTGG + Intergenic
986116925 5:4784422-4784444 GTGGAAGGCAAAAGAGAAGCAGG + Intergenic
986156847 5:5184586-5184608 GGAAAAGGGCAAACAGAGGCAGG + Intronic
986204104 5:5607313-5607335 GCAGAAGGCTAAGGAGAACCAGG + Intergenic
986345975 5:6835612-6835634 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
986481616 5:8194603-8194625 GCAGAAGGCAAAGGGGAAGCGGG + Intergenic
986678529 5:10211871-10211893 GCAGAAAGCAAAATAGAAGCAGG - Intergenic
986805894 5:11308894-11308916 GCAGAAGGCGAAGGGGAAGCAGG + Intronic
986837266 5:11652285-11652307 ACAGAAGGCAAAAGGGAAGCAGG - Intronic
986926872 5:12765554-12765576 GTAGAAGGCAAAACGGGAGCAGG + Intergenic
987008852 5:13739411-13739433 GCGGAAGGCAAAGGAGAAGCAGG - Intronic
987178453 5:15341293-15341315 GCAGAAGGCAAAGCAGGAGCTGG + Intergenic
987243435 5:16024416-16024438 GCAGAAGGTAAAGCAGGAGCAGG - Intergenic
987252771 5:16117557-16117579 GCAACAGGCCCAACAGAAGTTGG + Intronic
987342421 5:16950623-16950645 CCGGAAGGCAAAGCAGAAGCAGG - Intergenic
987393256 5:17397003-17397025 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
987431725 5:17843147-17843169 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
987636609 5:20550876-20550898 GCAGAAGTCAAAGCAGGAGCTGG + Intronic
987646868 5:20684681-20684703 GTAGAAGGCAAAAGAAAAGCAGG - Intergenic
987694041 5:21305001-21305023 GCAGAAGGCAAAAAGGAAGGAGG - Intergenic
987699790 5:21382498-21382520 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
987711778 5:21510246-21510268 ACAGAAGGCAAAGCAGGAGCAGG + Intergenic
987860714 5:23484336-23484358 GAAGAAGGCAAAAGAGAAGCAGG + Intergenic
987867681 5:23566853-23566875 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
987898478 5:23979907-23979929 GCAGAGGGAGAGACAGAAGCAGG - Intronic
988302636 5:29450534-29450556 ACAGAAGGCAAAGCAGGAGCAGG - Intergenic
988338894 5:29943164-29943186 GTGGAAGGCAAAAGAGAAGCAGG + Intergenic
988430666 5:31115111-31115133 GCAGAAGGTGAAGCAGAAGCAGG - Intergenic
988474126 5:31567662-31567684 GCAGAAAGCAAAGGAGAAGCAGG - Intergenic
988493723 5:31726967-31726989 GCAGAAGGTGAAGCGGAAGCAGG + Intronic
988671259 5:33384611-33384633 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
988672890 5:33400956-33400978 GCAGAAGGCAAGAGGGAAGCAGG - Intergenic
988889275 5:35597450-35597472 GCAGAAGGCAAAGGGGAAGCTGG + Intergenic
989132608 5:38123038-38123060 GCAGAAGGCAAAGGAAAAGCAGG + Intergenic
989132901 5:38125242-38125264 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
989180525 5:38572250-38572272 GCAGAAGGCAAAGAAGGAGCAGG + Intronic
989289511 5:39747082-39747104 ACACAAGGTGAAACAGAAGCTGG + Intergenic
989421338 5:41242363-41242385 GCAGAAGGCAAAGGAGAGGCAGG - Intronic
989520075 5:42391383-42391405 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
989545749 5:42671247-42671269 GCAGAAGGTGAAACAGGAACAGG + Intronic
989677169 5:43985455-43985477 GCAGTAGGCAAAGCAGGAGCAGG + Intergenic
990083283 5:51943910-51943932 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
990083542 5:51945835-51945857 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
990143254 5:52730173-52730195 GTAGAAGGCAAAGGAGAAGCAGG - Intergenic
990143515 5:52732112-52732134 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
990619076 5:57540466-57540488 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
990889986 5:60637387-60637409 GCAGAAGGCAAAACGGGAGCAGG - Intronic
990895437 5:60695318-60695340 GCAGAAGGTGAAGCGGAAGCAGG + Intronic
990896834 5:60708647-60708669 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
991145781 5:63301960-63301982 TCAGCAGACCAAACAGAGGCAGG - Intergenic
991401440 5:66255959-66255981 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
991704442 5:69344750-69344772 GTAGAAGGCCAAGGAGAAGCAGG - Intergenic
991740381 5:69666370-69666392 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
991746207 5:69744530-69744552 GCAGAAGGCAAAAAGGAAGGAGG + Intergenic
991751498 5:69810711-69810733 GCAGAAGGCAAAAAGGAAGGAGG - Intergenic
991757117 5:69886797-69886819 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
991762145 5:69929388-69929410 ACAGAAGGCAAAGCAGGAGCAGG + Intergenic
991785183 5:70188712-70188734 ACAGAAGGCAAAGCAGGAGCAGG - Intergenic
991791956 5:70246111-70246133 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
991797809 5:70324483-70324505 GCAGAAGGCAAAAAGGAAGGAGG + Intergenic
991819844 5:70542487-70542509 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
991825585 5:70619844-70619866 GCAGAAGGCAAAAAGGAAGGAGG + Intergenic
991830785 5:70685605-70685627 GCAGAAGGCAAAAAGGAAGGAGG - Intergenic
991836520 5:70762679-70762701 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
991841373 5:70804437-70804459 ACAGAAGGCAAAGCAGGAGCAGG + Intergenic
991877630 5:71189110-71189132 ACAGAAGGCAAAGCAGGAGCAGG - Intergenic
991884405 5:71246449-71246471 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
991890152 5:71323802-71323824 GCAGAAGGCAAAAAGGAAGGAGG + Intergenic
992252908 5:74893719-74893741 GCAGAAGGCAAAAGAAGAGCAGG + Intergenic
992448361 5:76854004-76854026 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
992721055 5:79561649-79561671 GCAGAAGGCAAAGCGGGAGCAGG + Intergenic
992903541 5:81322756-81322778 GTGGAAGGCAAAGCAGAAGCAGG + Intergenic
993344822 5:86769803-86769825 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
993638520 5:90374309-90374331 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
993704530 5:91154723-91154745 GCGGAAGGCAAAGGAGAAGCAGG + Intronic
993741802 5:91550567-91550589 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
993857991 5:93099247-93099269 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
993911881 5:93693620-93693642 GCAGAAGTACAAAGAGGAGCTGG + Intronic
994047850 5:95329485-95329507 GCAGAAGCTCAGACAGCAGCAGG - Intergenic
994080745 5:95706435-95706457 GCAGAAGGTGAAAAGGAAGCAGG - Intergenic
994259279 5:97637879-97637901 GCAGAAGGCAAAGCAGGAGTAGG + Intergenic
994338542 5:98598660-98598682 TCAGAAGGAGAAGCAGAAGCAGG - Intergenic
994558720 5:101339043-101339065 GAGGAAGGCCAAAGTGAAGCAGG + Intergenic
994582538 5:101663574-101663596 GCAGAAGTTCAAAAAGAATCGGG + Intergenic
994708103 5:103230944-103230966 GCAGAAGGTAAAGGAGAAGCAGG + Intergenic
994719872 5:103368014-103368036 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
994936199 5:106256171-106256193 GCAGAAGGTGAAAGAGATGCAGG - Intergenic
994967298 5:106690628-106690650 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
995035685 5:107531603-107531625 GCTCATGGCCAAGCAGAAGCTGG + Intronic
995059228 5:107795783-107795805 TCAGAAGGCAGAGCAGAAGCAGG + Intergenic
995477906 5:112566332-112566354 GCAGAAGGTGAAGAAGAAGCTGG + Intergenic
995761507 5:115566579-115566601 GCAGAAGGTAAAGCAGGAGCAGG - Intergenic
995768580 5:115645527-115645549 GCAGAAGGCGAATGGGAAGCAGG + Intergenic
995817105 5:116182977-116182999 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
996035033 5:118749444-118749466 GGAGAGGGCCAGAAAGAAGCAGG + Intergenic
996217673 5:120888865-120888887 GCAGAAGGCAAAGTGGAAGCAGG - Intergenic
996777388 5:127147409-127147431 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
996869953 5:128179587-128179609 GCAGAAGGCAAAGCAGGAACAGG + Intronic
996955674 5:129180575-129180597 GCAGAAAGCAAAGGAGAAGCAGG - Intergenic
997456023 5:134018202-134018224 GCAGAAGGCCAACAAGGAGCAGG + Intergenic
998109588 5:139490833-139490855 GCAGAAGGAAAAGGAGAAGCAGG - Intergenic
998224247 5:140314268-140314290 GCAGAAGGCCATGAAGAATCAGG + Intergenic
998682583 5:144486812-144486834 ACAGAAGGCCAAGCAGGAGAAGG + Intergenic
998754929 5:145366986-145367008 CCAGAAGGCCATACATAATCAGG + Intergenic
999059374 5:148617261-148617283 GCAGAAGGTGAAGCAGAAGCAGG - Intronic
999178374 5:149648425-149648447 GCAGAAGGCAAAGGAGAAGTAGG - Intergenic
999516470 5:152306913-152306935 GCAGAAGGGCAAAGAGAGGAGGG + Intergenic
999847848 5:155505200-155505222 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1000011868 5:157240677-157240699 GCAGAAGGCAAAAGGGGAGCAGG + Intronic
1000088511 5:157909921-157909943 GCAGAAGGCAAAAGAGAAGCAGG - Intergenic
1000883353 5:166721960-166721982 GCAGAAGCCAAAAGGGAAGCAGG + Intergenic
1000938757 5:167335173-167335195 GCAGAAGGCAAAGCAGGAGCAGG + Intronic
1001033512 5:168280110-168280132 GCAGAAGGCAAAAGGGGAGCTGG + Intergenic
1001462275 5:171926608-171926630 GCAGAAGGCGAAGGGGAAGCGGG - Intronic
1001523362 5:172411596-172411618 GCAGACGGCCAAACAGGCTCAGG - Intronic
1001675227 5:173506894-173506916 GCTGAATGACAAACAGGAGCTGG - Intergenic
1001838913 5:174856565-174856587 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
1001863442 5:175081075-175081097 GTAGAAGAGCAAACAGTAGCTGG - Intergenic
1002286908 5:178169431-178169453 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1002692072 5:181057078-181057100 GCAGATGGCACAACAGAAGAAGG - Intronic
1002851945 6:1004073-1004095 CCAGAAGGGCAAAGAGCAGCAGG - Intergenic
1003019724 6:2499209-2499231 GCAGAAGGCTAACAGGAAGCTGG + Intergenic
1003163174 6:3653452-3653474 GCAGAAGGGAAAGGAGAAGCAGG - Intergenic
1003402881 6:5805434-5805456 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
1003445092 6:6176954-6176976 GGAGACCGCCAAACAGAAGCAGG + Intronic
1003613152 6:7631081-7631103 GCAGAAGGTCAGAGAGAAGCTGG + Intergenic
1003652992 6:7978400-7978422 GCAGAAGGCAAAGCGGGAGCAGG - Intronic
1003775171 6:9352318-9352340 GCAGAAGGCAATAGGGAAGCAGG - Intergenic
1003818050 6:9863722-9863744 GCAGAAGGCAAAAAGGAAGGAGG + Intronic
1003856257 6:10279324-10279346 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1004472612 6:15942616-15942638 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1004985453 6:21077565-21077587 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1005146999 6:22702818-22702840 GCAGAAGGCAAAAGGGGAGCAGG + Intergenic
1005510949 6:26511127-26511149 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1005550776 6:26912276-26912298 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
1005556866 6:26994919-26994941 GCAGAAGGCAAAAAGGAAGGAGG + Intergenic
1005890914 6:30137048-30137070 GCAGAAGGACAACCAGGAGGAGG + Exonic
1006258664 6:32850970-32850992 GCAGAAGGAAAAGCAGAGGCAGG + Exonic
1006614966 6:35319951-35319973 GCAGCAGGCCCAGCAGCAGCTGG + Exonic
1006916980 6:37601072-37601094 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1007140733 6:39570779-39570801 GCAGAAAGCAAAGGAGAAGCAGG - Intronic
1007171915 6:39870122-39870144 GCAGGAGACCTAAAAGAAGCTGG + Intronic
1007225310 6:40309602-40309624 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
1007361683 6:41361230-41361252 ACAGAAGGCAAAGCAGGAGCAGG - Intergenic
1007410907 6:41660793-41660815 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1007854516 6:44841043-44841065 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1008086085 6:47245879-47245901 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1008104486 6:47427631-47427653 GCAAAAGGCAAAGGAGAAGCAGG + Intergenic
1008104799 6:47429846-47429868 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
1008135507 6:47771595-47771617 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1008471253 6:51887667-51887689 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
1008656200 6:53616712-53616734 CCAGAATGCCAAAGAGCAGCAGG + Intronic
1008799065 6:55344101-55344123 GCAGAAATACAAACAGGAGCTGG + Intronic
1008851541 6:56028281-56028303 GCAGAAGGCAAAGCTGGAGCAGG + Intergenic
1008976842 6:57437089-57437111 GCAGAAGGCAAAACAGGAGTAGG + Intronic
1009005922 6:57786438-57786460 ACAGAAGGCAAAGCAGGAGCAGG - Intergenic
1009056880 6:58346791-58346813 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
1009164984 6:60330034-60330056 GCAGAAGGCAAAACAGGAGTAGG + Intergenic
1009187123 6:60587504-60587526 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1009234363 6:61104784-61104806 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1009287970 6:61846066-61846088 GCGGAAGGCCAAATGGGAGCAGG - Intronic
1009294825 6:61933129-61933151 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1009370338 6:62893097-62893119 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1009529556 6:64794506-64794528 GCAGAAGGCAAAGGAGAAGTAGG - Intronic
1009759837 6:67990973-67990995 GCAGAAGGCAGAGGAGAAGCAGG - Intergenic
1010364656 6:75035329-75035351 GCACAGGGCAACACAGAAGCTGG + Intergenic
1010935120 6:81851300-81851322 GCAGAAGGCAAAGCTGGAGCAGG - Intergenic
1011115755 6:83889803-83889825 ACAGAAGGCAAAGCAGGAGCAGG + Intronic
1011458015 6:87573196-87573218 GCAGAAAGCGAAAGGGAAGCAGG + Intronic
1011691746 6:89876545-89876567 GCAGAAAACAAAAAAGAAGCAGG + Intergenic
1011731761 6:90272322-90272344 GCAGAAGGAGAAAGAGGAGCAGG - Intronic
1011781930 6:90799354-90799376 GAAGAAGGTAAAACAGGAGCAGG + Intergenic
1012011672 6:93795584-93795606 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1012053441 6:94373552-94373574 GCAGAATGCGAAGCAGGAGCAGG + Intergenic
1012507467 6:99964481-99964503 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1012533109 6:100262633-100262655 GAAGAAAGGCAGACAGAAGCTGG + Intergenic
1012576146 6:100802380-100802402 GCAGAAGGCAAAAGGGGAGCAGG - Intronic
1012692257 6:102328486-102328508 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
1012732631 6:102901339-102901361 GCAGATGGCAAAGGAGAAGCAGG + Intergenic
1012899061 6:104986178-104986200 GCAGAAGGTGAAGGAGAAGCAGG - Intronic
1013049588 6:106519567-106519589 GCAGATGTACAAACAGATGCTGG + Exonic
1013450900 6:110279960-110279982 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1013603519 6:111726940-111726962 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1013684627 6:112565225-112565247 GCAGAAGGAGAAACTGAGGCAGG + Intergenic
1013698842 6:112738352-112738374 GCAGAAGGTGAAGCAGAAGCAGG + Intergenic
1013763375 6:113545131-113545153 GCAGAAGGCAAAAAGGAAGCAGG - Intergenic
1013869480 6:114739818-114739840 GCAGCAGGCAAAACAGAAGCAGG - Intergenic
1013947116 6:115735003-115735025 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1013957906 6:115861684-115861706 GCAGAAGTCAAAGGAGAAGCAGG - Intergenic
1014096069 6:117463700-117463722 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1014127607 6:117794795-117794817 GCAGTGGGCCAAAGGGAAGCTGG + Intergenic
1014309477 6:119782247-119782269 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1014329394 6:120042156-120042178 GCAGAAGGCAAAAGAGAAACAGG + Intergenic
1014378992 6:120715132-120715154 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1014446663 6:121535834-121535856 GCAGGAGGCCCAGCAGGAGCTGG + Intergenic
1014719964 6:124904140-124904162 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1014928919 6:127309792-127309814 GCAGAAGGCGAAGCGGAAGCAGG + Intronic
1014994533 6:128125408-128125430 GCAGAAGGCAAAAGGGAGGCAGG - Intronic
1015091565 6:129364878-129364900 GCAGAAGGCAAAGCTGGAGCAGG + Intronic
1015873225 6:137797955-137797977 GCAGAAGGCAAAGAGGAAGCTGG + Intergenic
1016020614 6:139233630-139233652 GCAGAAGGTGAAGAAGAAGCAGG - Intergenic
1016456939 6:144240541-144240563 GCACAAGGCAAAGGAGAAGCAGG - Intergenic
1016664813 6:146625672-146625694 GCAGAAGGCAAAGCAGTATCAGG - Intronic
1016674636 6:146749775-146749797 GCAGAAGACGAAAAGGAAGCAGG + Intronic
1016911592 6:149204686-149204708 GCAGAAGGCAAAGGCGAAGCAGG + Intergenic
1017019042 6:150125515-150125537 GCAGAAGGAGAAGCAGGAGCCGG - Intergenic
1017321428 6:153098472-153098494 GCAAAGTGCCAAACAAAAGCAGG - Intronic
1017392596 6:153957854-153957876 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1017496506 6:154988356-154988378 GCAGAAGGCGAAGGGGAAGCAGG + Intronic
1017530745 6:155289938-155289960 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1017602569 6:156099789-156099811 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1017907699 6:158768265-158768287 GCAGAAGGCGAAGGGGAAGCAGG - Intronic
1017927945 6:158926343-158926365 GCAGAAGGCAAAGGAAAAGCAGG - Intergenic
1017989016 6:159470234-159470256 GCAGAAGGTAAAGGAGAAGCAGG + Intergenic
1018211981 6:161490934-161490956 GCAGAAGGCAAAAGGGGAGCAGG - Intronic
1018365505 6:163116212-163116234 GCAAAAGGCGAAGGAGAAGCAGG + Intronic
1018692390 6:166358007-166358029 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1018751439 6:166810047-166810069 GCAGAAGACAAAGGAGAAGCAGG + Intronic
1018787300 6:167118027-167118049 GCAGAAGGACAGACTGAAGCTGG - Intergenic
1019089841 6:169519462-169519484 GCAGAAGGCAAAGCAGGAGCTGG + Intronic
1019527403 7:1486921-1486943 GCAGAAGGCCAAGAAGCGGCAGG - Exonic
1019944507 7:4315924-4315946 GCAGAAGGCTAAGGGGAAGCAGG + Intergenic
1019955354 7:4410144-4410166 GCAGAAGGCTAAGGCGAAGCCGG + Intergenic
1019965275 7:4493815-4493837 GCAGGAGGCGAAGGAGAAGCAGG + Intergenic
1019980514 7:4618291-4618313 GCTGAAGGCAAAGGAGAAGCAGG - Intergenic
1020042693 7:5016143-5016165 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1020145142 7:5636613-5636635 TCAGAAGCCCCAACAGATGCTGG + Intronic
1020289427 7:6711388-6711410 GCAGAAGGCGAAGTGGAAGCAGG - Intergenic
1020824648 7:13011370-13011392 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
1021014577 7:15517507-15517529 CAAGGAGGCCAAGCAGAAGCAGG + Intronic
1021113406 7:16721828-16721850 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1021778720 7:24080058-24080080 ACAGAAAGCAAAACAGGAGCAGG - Intergenic
1021925532 7:25530269-25530291 GTAGAAGGCAAAGCAGGAGCAGG + Intergenic
1021939078 7:25661713-25661735 GCAGATGAGGAAACAGAAGCTGG - Intergenic
1022099719 7:27161822-27161844 GCACAAGGCCTAACAGAGGCAGG - Intergenic
1022218687 7:28290694-28290716 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
1022437447 7:30403079-30403101 GCAGCAGGCAAAGCAGGAGCAGG - Intronic
1022468678 7:30668329-30668351 GATGAAGGCCAAGCAGAGGCAGG - Intronic
1022680019 7:32535975-32535997 GCGGAAGGCAAAGGAGAAGCAGG - Intronic
1022712690 7:32866441-32866463 GCAGAAGGCAAAGGAAAAGCAGG + Intergenic
1022873487 7:34503963-34503985 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
1022875299 7:34521604-34521626 GCAGAAGGCAAAGCTGAAGCAGG - Intergenic
1022889997 7:34687469-34687491 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1022910303 7:34894538-34894560 GCAGAAGGCAAAGGAAAAGCAGG - Intergenic
1023813175 7:43928078-43928100 GCAGAAAGCAAAGGAGAAGCAGG + Intronic
1023826510 7:44013652-44013674 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1024001612 7:45193619-45193641 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1024164963 7:46721747-46721769 GCAGAAGGCAAAAGGGGAGCTGG - Intronic
1024589196 7:50866673-50866695 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
1024661871 7:51503435-51503457 GCAGAAGGCAAAGCAGGAACAGG + Intergenic
1024708157 7:51984591-51984613 GCAGAAGGCAAAAGGGGAGCAGG + Intergenic
1024726033 7:52196200-52196222 GCAGAAGGCAAAGGAGATGCAGG - Intergenic
1024731417 7:52257664-52257686 GCAGAAGGCAAAGAAGAAGAAGG - Intergenic
1024894108 7:54237269-54237291 GCATAAGGCAAAGCAGGAGCAGG - Intergenic
1025748829 7:64272530-64272552 GCAGAAGGTGAAAGAGAAGCAGG - Intergenic
1026502386 7:70953721-70953743 GCGGAAGGCAAAGGAGAAGCAGG + Intergenic
1026546725 7:71329604-71329626 GCAGAAGGCGAAAGGGAAGCAGG + Intronic
1026622940 7:71966567-71966589 GCAGAAGGCAAAGAGGAAGCAGG - Intronic
1026746360 7:73016336-73016358 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1026750011 7:73044479-73044501 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1026753659 7:73072589-73072611 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1026757310 7:73100625-73100647 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1027032463 7:74900894-74900916 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1027090094 7:75292861-75292883 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1027093739 7:75320789-75320811 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1027097382 7:75348756-75348778 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1027119679 7:75507840-75507862 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1027272146 7:76527771-76527793 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1027321965 7:77018916-77018938 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1027325599 7:77046836-77046858 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1027342144 7:77221006-77221028 GCGGAAGGCAAAGCAGGAGCAGG + Intronic
1027507898 7:79040771-79040793 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1027884124 7:83881288-83881310 GCAGAAGGGAAAGGAGAAGCAGG + Intergenic
1028026760 7:85852596-85852618 ATGGAAGGCGAAACAGAAGCTGG + Intergenic
1028063259 7:86348356-86348378 GCAGAAGGCAAAGTGGAAGCAGG + Intergenic
1028149333 7:87353657-87353679 GCAGAAGGTGAAGCAGGAGCAGG + Intronic
1028493535 7:91440234-91440256 GCAGAAGGCAAAGGAGAAGTAGG - Intergenic
1028493815 7:91442163-91442185 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1028634515 7:92972207-92972229 GCAGAAGGCAAAGGAGTAGCAGG + Intergenic
1028791261 7:94855712-94855734 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1028965689 7:96798726-96798748 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1029269187 7:99366627-99366649 GCAGAAGGCGAAGGGGAAGCAGG + Intronic
1029318026 7:99732251-99732273 GCAGAAGGTGAAAAAGAAGCAGG - Intronic
1029398490 7:100325750-100325772 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1029575612 7:101401515-101401537 GCAGGAGGACAAAGAGAAGGAGG + Intronic
1029717818 7:102342187-102342209 GCAGAAGGCGAAGGGGAAGCAGG - Intergenic
1029754797 7:102567056-102567078 GCAGAAGGCGAAGGGGAAGCAGG + Exonic
1029772747 7:102666136-102666158 GCAGAAGGCGAAGGGGAAGCAGG + Exonic
1029810383 7:103041385-103041407 CCAGAAGTACAAACAGGAGCTGG + Intronic
1029867345 7:103648328-103648350 GCAGAAGGCCAAAGGGAAGCAGG - Intronic
1030716268 7:112811330-112811352 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1030930901 7:115522174-115522196 GCAGAATGCCAGAGAGAAGGAGG - Intergenic
1031035541 7:116784493-116784515 GCAGAAGGCAAAATAGGAGCAGG + Intronic
1031035686 7:116785356-116785378 GCAGAAGGCAAAGCAGGAGCAGG + Intronic
1031180237 7:118404819-118404841 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1031267108 7:119595048-119595070 GCAGAAGGCAAATCAGGAGGAGG + Intergenic
1031284283 7:119844182-119844204 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1031397144 7:121286925-121286947 GCAGAAGGCAAAGAGGAAGCAGG + Intronic
1031429654 7:121651367-121651389 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1031617031 7:123894032-123894054 GCAGAAGGGAAAGGAGAAGCAGG - Intergenic
1031617875 7:123902756-123902778 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1031713213 7:125075307-125075329 GCAGAAGGAGAAGCTGAAGCAGG - Intergenic
1031713340 7:125076230-125076252 GCAGAAGGCAAAAGAAAAGCAGG - Intergenic
1031774497 7:125890459-125890481 GCAGAAGCCCAAGGAGAAGTAGG - Intergenic
1031803392 7:126276753-126276775 GCAGAAGGCAAAGGAGAAACAGG + Intergenic
1031905800 7:127458560-127458582 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1032535325 7:132658177-132658199 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1032543833 7:132725861-132725883 GCAGAAGGTGAAGCAGGAGCAGG + Intronic
1032560218 7:132883069-132883091 GCAGAAGGTGAAAGGGAAGCAGG - Intronic
1032561128 7:132893813-132893835 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1032623604 7:133564237-133564259 GCAGAAGGCGAAAGGAAAGCAGG + Intronic
1032745797 7:134784726-134784748 GCAGAAGCCCAAATAGGACCAGG + Intronic
1032920781 7:136544137-136544159 GCAGAAGCAGAAGCAGAAGCAGG - Intergenic
1032994710 7:137432108-137432130 GCAGAAGGCGAAGGGGAAGCAGG - Intronic
1033384903 7:140863770-140863792 GCAGAAGGCAAAGCAGGAGCAGG - Intronic
1033763423 7:144461658-144461680 GCAGAAGGCAAGGCAGAAGCAGG - Intronic
1033780154 7:144659265-144659287 GCAGAAGGCAAAGGAGAAACAGG + Intronic
1034487475 7:151374933-151374955 GCAGCAGTCCAGACAGATGCTGG + Intronic
1034839049 7:154378803-154378825 GCAGAAGGCAAAGGAGAACCAGG + Intronic
1034880878 7:154761611-154761633 GCAGAAGGCCAATGGGGAGCAGG + Intronic
1035085901 7:156257716-156257738 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
1035824096 8:2626546-2626568 GCAGACAGCCAGACATAAGCAGG + Intergenic
1035864540 8:3068647-3068669 GCAGAAGGCCAAGGGGGAGCAGG + Intronic
1036178723 8:6565112-6565134 GCTGGAGGTCACACAGAAGCAGG - Intronic
1036218414 8:6900242-6900264 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1036272788 8:7322691-7322713 GTGGAAGGCAAGACAGAAGCAGG - Intergenic
1036348562 8:7987657-7987679 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1036390237 8:8318702-8318724 TTTGAAGGCCAAGCAGAAGCCGG - Exonic
1036637019 8:10558151-10558173 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1036865201 8:12390441-12390463 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1036919941 8:12842646-12842668 GCAAAAGGCCTAACACTAGCAGG - Intergenic
1036994783 8:13643098-13643120 GTAGAGGGCAAAGCAGAAGCAGG - Intergenic
1037185605 8:16058811-16058833 GCAGAAGGCAAAGCAGGAGTAGG + Intergenic
1037192248 8:16140812-16140834 GCAGAGGCCCAAACAGCACCAGG + Intronic
1037244935 8:16822741-16822763 GCAGAAGGCAAAGCAAGAGCAGG + Intergenic
1037337858 8:17809163-17809185 GCAGAAGGCAAGGGAGAAGCAGG + Intergenic
1037344069 8:17879619-17879641 GCAGACGGCAAAGCAGAAGCAGG - Intronic
1037372703 8:18197039-18197061 GCGGAAGGCAAAAGGGAAGCAGG + Intronic
1037566865 8:20125456-20125478 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1037571374 8:20160797-20160819 CCAGATGGCCAAGCAGATGCTGG - Intronic
1038132602 8:24749863-24749885 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1038460680 8:27714042-27714064 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1038704018 8:29877275-29877297 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1038951596 8:32420992-32421014 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1038998277 8:32950571-32950593 GCAGCAGGCCAAGGAGGAGCAGG + Intergenic
1039156467 8:34564240-34564262 GCGGAAGGCAAAGCAGGAGCAGG - Intergenic
1039309330 8:36298522-36298544 ACAGAAGGCAAATCATAAGCAGG + Intergenic
1039322900 8:36452534-36452556 GCAGAAGGCAAAGAAGAAGCAGG + Intergenic
1039808160 8:41020873-41020895 CCAGAAGTACAAACAGGAGCTGG - Intergenic
1039932188 8:42003274-42003296 TCAGAAAGCCCAACAGCAGCAGG + Intronic
1040098026 8:43467202-43467224 GCAGAAGGCAAAGCTAAAGCAGG + Intergenic
1041315955 8:56562772-56562794 GCAGAAGGCCAAGAGGGAGCAGG - Intergenic
1041430551 8:57776859-57776881 GCAGAAGGCAAAAGAAAAGCAGG - Intergenic
1041522193 8:58769112-58769134 GCAAAAGGCAAAGCAGGAGCAGG + Intergenic
1041674841 8:60527445-60527467 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1042071853 8:64943627-64943649 GCAGAACCCAAAACAGAGGCTGG - Intergenic
1042152474 8:65802991-65803013 GCAGAAGGCAAAGCAGGAACAGG - Intronic
1042173573 8:66016454-66016476 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
1042350140 8:67768803-67768825 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1042387776 8:68197420-68197442 GCAGGAGGCAAAAGAGAAGCAGG - Intronic
1042528863 8:69794876-69794898 GCAAAAGGCAAAGGAGAAGCTGG + Intronic
1042581402 8:70282993-70283015 CCAGAAGGCCACCCACAAGCAGG + Intronic
1042605344 8:70540658-70540680 GCAGAAGGCTAAGGGGAAGCAGG - Intergenic
1042605607 8:70542500-70542522 GCAGAAGGCCAAGGAAAAGCAGG - Intergenic
1042822059 8:72940418-72940440 GCAGAAGGCCTAACAGACATAGG - Intergenic
1042984253 8:74565901-74565923 GGAGAAGGCAAAACAGGAGCTGG + Intergenic
1042989371 8:74621502-74621524 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1043104088 8:76085904-76085926 GCAGAAGGTGAAAGAGAATCAGG + Intergenic
1043137907 8:76550661-76550683 GCAGAAAGCAAAGCAGCAGCAGG + Intergenic
1043237132 8:77881974-77881996 GCAGAAGGGGAAGGAGAAGCAGG + Intergenic
1043370216 8:79582933-79582955 GCAGAAGGCAAAAGAGAAGGAGG - Intergenic
1043533494 8:81175543-81175565 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1043570760 8:81599988-81600010 GCGGAAGGCAAAGGAGAAGCCGG - Intergenic
1044216921 8:89623156-89623178 ACAGAAGGCAAAGCAGGAGCAGG + Intergenic
1044372599 8:91430117-91430139 GCAGAAGGCATAAGGGAAGCAGG - Intergenic
1044445408 8:92269748-92269770 GCAGAAGGCAAAGGAGAAGCCGG + Intergenic
1044550816 8:93510536-93510558 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1044638180 8:94349580-94349602 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1045519777 8:102893810-102893832 GTAGAAGGCAAAAGAGAAGCAGG + Intronic
1045764163 8:105647119-105647141 GCTGCAGGCCAACAAGAAGCAGG - Intronic
1045778530 8:105835687-105835709 GCAGAAGGTGAAAGGGAAGCTGG + Intergenic
1045785095 8:105911812-105911834 ACAGAAGGCAAAAGAGAAACAGG + Intergenic
1045881633 8:107047298-107047320 GCAGAAGGCGAAGGAGAAGCAGG - Intergenic
1046249807 8:111614736-111614758 GCAGAAGGTGAAGAAGAAGCAGG - Intergenic
1046314070 8:112477648-112477670 GCAGAAGGCAAAGCGGGAGCAGG - Intronic
1046383946 8:113485435-113485457 GCAGAAGGTGAAGAAGAAGCAGG - Intergenic
1046877915 8:119276888-119276910 GCAGAAGGAGAAAAGGAAGCAGG + Intergenic
1047173468 8:122517489-122517511 GCAGAAGGCGAAGGAGGAGCTGG - Intergenic
1047183330 8:122609940-122609962 GTAGAAGGCAAAGAAGAAGCAGG - Intergenic
1047322002 8:123795498-123795520 GCAGAAGGTGAAAGGGAAGCAGG - Intronic
1047325852 8:123835126-123835148 ACAGAAGGCAAAGAAGAAGCAGG - Intergenic
1047590874 8:126325492-126325514 GCAGAAGGCAAAGGAAAAGCAGG - Intergenic
1047647760 8:126886746-126886768 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1047691583 8:127360336-127360358 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1047786123 8:128155496-128155518 GCAGAAGGACAAACATAAACAGG + Intergenic
1047990713 8:130283636-130283658 AAAGAAGGCCAAACAAAGGCAGG + Intronic
1048412703 8:134192033-134192055 GCAGAAGGCAAAGAAGATGCAGG + Intergenic
1048413837 8:134204210-134204232 GTAGAAGGCTAAACAGAGGTAGG + Intergenic
1048464137 8:134650023-134650045 GTAGAAGGCAAAGGAGAAGCAGG - Intronic
1048737808 8:137520878-137520900 GCTGAAGGCCCAACAGACCCTGG - Intergenic
1048916407 8:139188340-139188362 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1049006602 8:139859647-139859669 CCAGACGGCCAGAGAGAAGCTGG + Intronic
1049476522 8:142799530-142799552 ACAGATGGACAGACAGAAGCAGG + Intergenic
1049517423 8:143068458-143068480 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1049653043 8:143784376-143784398 ACAGAAGGCCAAGGGGAAGCAGG - Intergenic
1049747765 8:144270222-144270244 GCAGGAGGCCAGACAGGAGCAGG + Intronic
1049951060 9:644495-644517 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1049981946 9:912083-912105 TCAGAAGGCGAAGAAGAAGCAGG + Intronic
1050236533 9:3587077-3587099 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1050615772 9:7400411-7400433 GCAGAAGGCAAAGAAGAAGGAGG + Intergenic
1050661498 9:7888306-7888328 GTAGAAGGCAAAGGAGAAGCAGG + Intronic
1050678072 9:8079000-8079022 GAAGAAGGCAAAGCAGGAGCAGG + Intergenic
1050807769 9:9703209-9703231 GCAGAAGGTGAAAGGGAAGCAGG - Intronic
1050819447 9:9859164-9859186 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1051098926 9:13498456-13498478 GCGGAAGGCAAAGGAGAAGCAGG - Intergenic
1051838821 9:21371537-21371559 GCAGAAGGCTAAGGGGAAGCAGG + Intergenic
1052053817 9:23881740-23881762 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
1052077526 9:24161465-24161487 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1052179497 9:25506634-25506656 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1052502396 9:29308282-29308304 GCAGAAGGCAAAGGATAAGCAGG + Intergenic
1052622109 9:30925769-30925791 GCAGAAGGTGAAGCAGGAGCAGG + Intergenic
1053083612 9:35198363-35198385 GCAGAAGGCCAAGGAGAAGCAGG - Intronic
1053473621 9:38364886-38364908 GCGGAAGGAGAAGCAGAAGCAGG - Intergenic
1053647879 9:40133813-40133835 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1053757853 9:41330033-41330055 GGAGGTGGCCAAAAAGAAGCAGG - Intergenic
1054328853 9:63731765-63731787 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1054536701 9:66242357-66242379 GGAGGTGGCCAAAAAGAAGCAGG - Intergenic
1054857256 9:69914380-69914402 GCAGAAGGCGAAAGGGGAGCCGG - Intergenic
1055185830 9:73452835-73452857 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1055209588 9:73774298-73774320 GCAGAATGACAAAGACAAGCAGG - Intergenic
1055264435 9:74478704-74478726 GTAGAAGGCAAAGGAGAAGCAGG + Intergenic
1055337335 9:75246290-75246312 GCAGAAGGCAAAGAGGAAGCAGG - Intergenic
1055369677 9:75583937-75583959 GCGGAAGGCAAAGAAGAAGCAGG + Intergenic
1055550168 9:77425877-77425899 GGGGAGGGGCAAACAGAAGCAGG - Intronic
1055615483 9:78067716-78067738 GCAGAAGGCAAAAAGGAAGCAGG + Intergenic
1055945427 9:81688327-81688349 CCGGAAAGCCAAGCAGAAGCGGG + Exonic
1056012083 9:82342923-82342945 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1056485799 9:87056363-87056385 GCAGAAAGCGAAGCAGAAGCAGG + Intergenic
1056604244 9:88072820-88072842 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1056635860 9:88330751-88330773 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1056895080 9:90538423-90538445 GCAGAAGGCAAAGAAGAAGCAGG - Intergenic
1056954281 9:91070007-91070029 GCAGAAGGCAAAGAAGAAGCAGG + Intergenic
1057019644 9:91686555-91686577 GCATGAAGGCAAACAGAAGCAGG - Intronic
1057325560 9:94060642-94060664 GCAGAAGGCAAAGCAAGAGCAGG + Intronic
1057424159 9:94935230-94935252 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1057541042 9:95970576-95970598 AGAGAAGGCCAAGTAGAAGCAGG + Intronic
1057809496 9:98246850-98246872 GGGGAAGGCCAAACAGAAAGGGG + Intronic
1057823625 9:98353938-98353960 GCAGAAGGCAAAAGAGAAGCAGG - Intronic
1057838488 9:98466072-98466094 GCAGAAGGCAAAGCGGAAGCAGG - Intronic
1057863128 9:98657877-98657899 GCAGAAGACAAAGGAGAAGCAGG - Intronic
1057935639 9:99236436-99236458 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1058189112 9:101891508-101891530 GCAGAAGGCAAAGGAGGAGCAGG + Intergenic
1058523094 9:105831488-105831510 GCACAAGGCAAAATGGAAGCAGG + Intergenic
1059001769 9:110356102-110356124 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1059011663 9:110467986-110468008 GCAGAAGGCAAATAAGGAGCAGG - Intronic
1059095107 9:111404605-111404627 GCAGAAGGCGAAGAGGAAGCAGG - Intronic
1059355567 9:113696895-113696917 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1059411807 9:114137246-114137268 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
1060255607 9:122027102-122027124 GCAGAAGGCAAAAGGAAAGCAGG + Intronic
1060542449 9:124440016-124440038 GCAGGAGGCCAAACAGACCTGGG + Intergenic
1060705105 9:125791613-125791635 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1060768329 9:126311656-126311678 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1060770734 9:126329932-126329954 GCAGAAGGCCAAGGAGAGCCGGG - Intronic
1060885105 9:127145974-127145996 GCAGTAAGCCACACAAAAGCAGG + Intronic
1061447170 9:130646561-130646583 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1062148143 9:135002139-135002161 GCGGAAGGCCAAGGAGAAGCAGG + Intergenic
1062669726 9:137700987-137701009 GCGGAAGGCCTAGGAGAAGCAGG + Intronic
1202795654 9_KI270719v1_random:117105-117127 GGAGGTGGCCAAAAAGAAGCAGG + Intergenic
1203525399 Un_GL000213v1:83550-83572 GCGGAAGGACAGACAGGAGCGGG - Intergenic
1186039757 X:5462905-5462927 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1186120657 X:6357726-6357748 GCAGAAGGCAAAGTGGAAGCAGG + Intergenic
1186260154 X:7769105-7769127 GCAGAGGGCAAAGGAGAAGCAGG + Intergenic
1186379796 X:9046246-9046268 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1186461107 X:9749282-9749304 GCAGAAGGCCAAGGGGAAGCAGG - Intronic
1186679901 X:11861964-11861986 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1186688486 X:11950220-11950242 ACAGAAGGCAAAGGAGAAGCAGG - Intergenic
1186701031 X:12090325-12090347 GCAGAAGGCAAAAGGGGAGCAGG - Intergenic
1186718152 X:12275283-12275305 GCAGAAGGTGAAGCAGGAGCAGG - Intronic
1186802647 X:13109172-13109194 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
1186977555 X:14924455-14924477 GGAGAAGACAAAGCAGAAGCAGG + Intergenic
1187165545 X:16801041-16801063 ACGGAAGGCAAAACAGGAGCAGG - Intronic
1187401048 X:18960470-18960492 GTGGAAGGCAAAACGGAAGCAGG + Intronic
1187650109 X:21392444-21392466 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1187654394 X:21453791-21453813 GCAGAAGGTGAAAGGGAAGCAGG + Intronic
1188405729 X:29806952-29806974 GCAGAAGGCAAAGGGGAAGCAGG - Intronic
1188618743 X:32193122-32193144 GCAGAAGGCAGAACGGGAGCAGG - Intronic
1188719679 X:33506819-33506841 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1188857822 X:35219235-35219257 GCAGAAGGCAAAGGGGAAGCTGG - Intergenic
1188939787 X:36223096-36223118 GCAGAAGACAAAGCAGGAGCAGG - Intergenic
1189103415 X:38213768-38213790 GCAGAAGGCGAAGGAGAAGCAGG + Intronic
1189188046 X:39070824-39070846 GCAGAAGGCGAAGTGGAAGCAGG - Intergenic
1189220111 X:39364314-39364336 GCAGAAGGCAAAAGGGAAGCAGG - Intergenic
1189293146 X:39900124-39900146 GCAGAAGCCCAGACATAAGTGGG - Intergenic
1189305668 X:39984895-39984917 GCGGGAGGCCACAGAGAAGCAGG + Intergenic
1189353022 X:40291209-40291231 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1189661227 X:43302074-43302096 GCAGAAGGCAAAGCAGGGGCAGG - Intergenic
1189896385 X:45660641-45660663 GCAGAAGGCAAAGCAGAAGCAGG - Intergenic
1189911280 X:45812806-45812828 GCAGAAGGCGAAGGAGAAGCAGG + Intergenic
1189969087 X:46399825-46399847 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1190090154 X:47430332-47430354 GCAGAAGGCAAAGCGGGAGCAGG - Intergenic
1190247515 X:48700282-48700304 GCAGAAGGCCAAGCAGAGGCGGG + Exonic
1190368335 X:49718500-49718522 GCAGAAGGCAAAAGAGAAGCAGG + Intergenic
1190446069 X:50525746-50525768 GCAGAAGGTGAAAGGGAAGCAGG + Intergenic
1190531676 X:51385262-51385284 GCAGAAGGCAAAGGAGAAGTGGG + Intergenic
1190531953 X:51387176-51387198 GCAGAAGGCAAAGGAGCAGCAGG + Intergenic
1190578409 X:51865946-51865968 GCAGAAGGTGAAAGTGAAGCAGG - Intronic
1190804100 X:53818699-53818721 GCAGAAGGCAAAGGGGAAGCAGG + Intergenic
1191015256 X:55802766-55802788 GAAGGAGGCAAAGCAGAAGCAGG - Intergenic
1191022305 X:55875703-55875725 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1191121838 X:56914419-56914441 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1191154329 X:57255339-57255361 CCAGAAGTCCAAAGAGGAGCTGG + Intergenic
1191678092 X:63812600-63812622 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1192207836 X:69107834-69107856 CCAGAAAGAGAAACAGAAGCAGG - Intergenic
1192301343 X:69906391-69906413 GCACAAGGACAAAAAGAAGCAGG + Intronic
1192388910 X:70704158-70704180 GCAGAAGGCAAAGCAAAAGCAGG - Intronic
1192436175 X:71145121-71145143 GTAGAAGGGAGAACAGAAGCGGG - Intronic
1192501545 X:71657072-71657094 GCAGAAGGTGAAACAGGAGCAGG + Intergenic
1192508610 X:71707942-71707964 GCAGAAGGCAAAACAGGAGCAGG + Intergenic
1192512033 X:71726762-71726784 GCGGAAGGTGAAACAGAAGCAGG - Intergenic
1192514664 X:71754743-71754765 GCGGAAGGTGAAACAGAAGCAGG + Intergenic
1192518087 X:71773611-71773633 GCAGAAGGCAAAACAGGAGCAGG - Intergenic
1192527951 X:71863719-71863741 GCGGAAGGCGAAACAGGAGCAGG + Intergenic
1193175707 X:78389700-78389722 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1193192763 X:78592363-78592385 GCAGAAGGCAAAGGTGAAGCAGG + Intergenic
1193412590 X:81182598-81182620 GCAGAAGGCAAATCAGAAACAGG - Intronic
1193439694 X:81524421-81524443 GCAGAAGGTGAAGGAGAAGCAGG + Intergenic
1193593868 X:83422240-83422262 GCAGAAGGCAAAAGAGAAGCAGG - Intergenic
1193594119 X:83424333-83424355 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1193638525 X:83983387-83983409 GCAGAAGGCAAAAGAGAAGCAGG + Intergenic
1193667420 X:84338922-84338944 GCAGAAGGTGAAAGGGAAGCAGG - Intronic
1193682549 X:84540468-84540490 GCAGAAGGGGAAGGAGAAGCAGG - Intergenic
1193810222 X:86042445-86042467 GCAGAAGGCAAAGGGGAAGCAGG + Intronic
1193813995 X:86084148-86084170 GCAGAAGGCAAAGCAGAAGCAGG - Intergenic
1193921945 X:87438875-87438897 GCAGAAGGCGAAGCAGAAGCAGG - Intergenic
1193944317 X:87713827-87713849 GCAGAAGGCAAAGGAGGAGCAGG - Intergenic
1194338310 X:92677217-92677239 GTAGAAGGCAAAGGAGAAGCAGG + Intergenic
1194394746 X:93368620-93368642 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
1194558812 X:95395661-95395683 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
1194676282 X:96797581-96797603 GCAGAAGGCAAAGGAGAAGCAGG + Intronic
1194943460 X:100040836-100040858 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1195209752 X:102642568-102642590 GCGGAAGGCAAAGGAGAAGCAGG + Intergenic
1195227500 X:102813474-102813496 GCAGAAGGCAAAGCAGTAGCAGG + Intergenic
1195289355 X:103417090-103417112 GCAGAAGGCGAAGGGGAAGCAGG + Intergenic
1195443102 X:104920569-104920591 GTGGAAGGCCAAGCAGAAGCAGG - Intronic
1195494010 X:105508621-105508643 ACAGAAGGCCCTTCAGAAGCTGG + Intronic
1195815796 X:108885899-108885921 GCAGAAGGCAAAATGGGAGCAGG - Intergenic
1195989887 X:110672021-110672043 GTAGAAGGCAAAAGAGAAGCAGG + Intergenic
1196078461 X:111604192-111604214 GCAGAAGGGCAAAGAGAGGCAGG + Intergenic
1196144070 X:112297392-112297414 GCAGAAGGCGAAGAGGAAGCAGG + Intergenic
1196148331 X:112344443-112344465 GCAGAAGGCAAAGAGGAAGCAGG + Intergenic
1196291468 X:113946703-113946725 GCAGAAGGCGAAAGGGGAGCAGG + Intergenic
1196524115 X:116711146-116711168 GCAGAAGGCAAAGGGGAAGCTGG + Intergenic
1196686419 X:118514188-118514210 GCAGAAGGCAAAGGAGAAGCAGG - Intronic
1196838325 X:119833888-119833910 GCAGAAGGTGAAGTAGAAGCAGG - Intergenic
1196864151 X:120055554-120055576 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1196878948 X:120180776-120180798 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1197042167 X:121949991-121950013 GCAGAAGGCAAAGTGGAAGCAGG + Intergenic
1197303261 X:124807026-124807048 GCAGAAGGCTAAGGAGGAGCTGG + Intronic
1197341801 X:125284334-125284356 GCAAAAGGCAAAGGAGAAGCAGG + Intergenic
1197534281 X:127667511-127667533 GCAGAAGGCAAAGGGGAAGCAGG - Intergenic
1197558719 X:127991427-127991449 GCAGAAGGCAAAGCAGGAGCAGG + Intergenic
1197649730 X:129051659-129051681 GCAGAAGGCAAAGCAGAAGCAGG + Intergenic
1197748396 X:129948512-129948534 GTAGAATGACAAACAGAACCTGG - Intergenic
1197812244 X:130455556-130455578 GCGGAAGGCAAAGCAGGAGCAGG - Intergenic
1197823784 X:130567525-130567547 GCAGAAGGCGAAAGGGAAGCAGG - Intergenic
1197836357 X:130698063-130698085 ACAGAAGGACAAACAGGAGCTGG - Intronic
1198261942 X:134972889-134972911 GCAGAAGGTGAAAGGGAAGCAGG - Intergenic
1198276686 X:135100750-135100772 GCAGAAGGCAAAAGAGAAGCAGG - Intergenic
1198276990 X:135104309-135104331 GCAGAAGGTGAAGCAGGAGCAGG - Intergenic
1198610675 X:138396245-138396267 GCAGAAGGCAAAGCAGGAGCAGG - Intergenic
1198818698 X:140621934-140621956 GCAGAAGGAAGAACAGATGCTGG + Intergenic
1198836416 X:140809625-140809647 GCAGAAGGCAAAAGGGAAGCAGG + Intergenic
1198999967 X:142624140-142624162 GCGGAAGGCAAAGCAGGAGCAGG + Intergenic
1199078015 X:143546128-143546150 GCAGAAGGCAAAAGAGAAGCAGG + Intergenic
1199170799 X:144732677-144732699 GCAGAAGGCAAAGGAGAAGCAGG + Intergenic
1199171038 X:144734583-144734605 GCAGAAGGCAAAAAAGAAGCAGG + Intergenic
1199304393 X:146250325-146250347 GCGGAAGGCAAAGGAGAAGCAGG - Intergenic
1199334762 X:146605749-146605771 GCAGAAGGCAAAATTGGAGCAGG + Intergenic
1199373905 X:147084417-147084439 GCAGAAGGCAAAAAGGAAGGAGG - Intergenic
1199431675 X:147768063-147768085 GCGGAAGGCAAAGGAGAAGCAGG - Intergenic
1199512562 X:148638657-148638679 GCAGAAGGCAAAGCAAGAGCAGG + Intronic
1199603452 X:149557493-149557515 GCAGAAGGCAAAAGAGGAGCTGG - Intergenic
1199646935 X:149921982-149922004 GCAGAAGGCAAAAGAGGAGCTGG + Intergenic
1199720565 X:150540323-150540345 GCAGAAGGCAAAAAGGGAGCAGG - Intergenic
1199795337 X:151190512-151190534 GCAGAAGGTGAAGGAGAAGCAGG - Intergenic
1199963055 X:152794965-152794987 GCAGAAGGTGAAGCGGAAGCAGG - Intergenic
1200003566 X:153073863-153073885 GCAGAAGGCCATGGAGAAGGAGG + Exonic
1200004157 X:153076146-153076168 GCAGAAGGCCATGGAGAAGGAGG - Intergenic
1200016839 X:153171060-153171082 GCAGAAGGCAAAGGAGAAGCAGG - Intergenic
1200268715 X:154661317-154661339 GCGGAAGGCAAAGGAGAAGCAGG - Intergenic
1200276896 X:154741770-154741792 GCAGAAGGCAAAGGAGAAACAGG + Intronic
1200515244 Y:4136086-4136108 GCAGAAGGTAAAGCAGGAGCAGG - Intergenic
1200646712 Y:5794000-5794022 GTAGAAGGCAAAGGAGAAGCAGG + Intergenic
1200866265 Y:8047002-8047024 GAAGAAGGCCAGACAGGAGAGGG - Intergenic
1201261422 Y:12162615-12162637 GCAGAAGGTGAAAGAGAAGTAGG + Intergenic
1201477397 Y:14397407-14397429 GCAGAAGGCAAAGTAGAAGCAGG - Intergenic
1201746644 Y:17381906-17381928 GCAGAAGGCAAAGCAGGAGCCGG + Intergenic