ID: 960078681

View in Genome Browser
Species Human (GRCh38)
Location 3:113516729-113516751
Sequence GCACTTAGTAAGTGTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960078681 Original CRISPR GCACTTAGTAAGTGTAAAGT AGG (reversed) Intergenic
901486264 1:9564638-9564660 GCACTTAGTAAGGCCAAGGTGGG + Intronic
910837507 1:91530524-91530546 ACACTAAGTAAGAGTAAACTGGG - Intergenic
911627493 1:100141576-100141598 GCACTTTGGAAGGGTAAGGTGGG - Intronic
912753808 1:112307883-112307905 GCACTTAGTAAGTATTATCTGGG + Intergenic
914694625 1:150065928-150065950 TGAGTTAGTAAGTGTCAAGTAGG + Intergenic
918220678 1:182433597-182433619 GCACTTTGGGAGTGTGAAGTGGG - Intergenic
918370782 1:183859478-183859500 GCATTTTGTAACTGTCAAGTGGG + Intronic
918705506 1:187656783-187656805 GCACTTAGAAACTATAAACTGGG - Intergenic
920200826 1:204258852-204258874 GCAGTTAGTGAGTCTCAAGTGGG + Intronic
921232214 1:213084379-213084401 GCACTTAGGGAGGCTAAAGTGGG - Intronic
922317110 1:224452394-224452416 GCACTTTGTAAGGCTGAAGTGGG - Intronic
922348932 1:224720221-224720243 CCACTTAATAAGTGTTAAGTAGG + Intronic
1063676547 10:8145639-8145661 TCACTTAGTAACTGTGAACTTGG + Intergenic
1063964464 10:11335937-11335959 GCACTTACTGACTGTAAAGTTGG + Exonic
1065964064 10:30756477-30756499 GCACTTTGGGAGTGCAAAGTGGG - Intergenic
1075018030 10:118925335-118925357 GCACTGATTTAGTGTTAAGTGGG - Intergenic
1080022111 11:27573115-27573137 AAACTTAGCAAGTGTAAAGCTGG + Intergenic
1080104009 11:28492673-28492695 GCACTCATAAAGTGAAAAGTTGG - Intergenic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1082631532 11:55548045-55548067 ACACTTAATAATTGTAAACTTGG + Intergenic
1082914088 11:58411976-58411998 ACACTTATCAAGTGTAATGTTGG + Intergenic
1084984121 11:72852449-72852471 GCACTTTGGAAGGCTAAAGTGGG + Intronic
1085221333 11:74876103-74876125 GCACTTAGGTAGACTAAAGTGGG - Intronic
1086777144 11:90851565-90851587 GTATTTAGGAAGTGTAAATTAGG + Intergenic
1086800132 11:91163008-91163030 GCACATTGTAGGTTTAAAGTTGG + Intergenic
1086967916 11:93049163-93049185 GCACTCAGTATGTATAAAGTAGG - Intergenic
1089439142 11:118500259-118500281 GGACTTATAAACTGTAAAGTTGG - Intronic
1089665864 11:120018512-120018534 GCACTTTGTAGGTGTTAAATTGG + Intergenic
1092346550 12:7719958-7719980 GCACTCAATAAATGTAAACTGGG - Intergenic
1095158113 12:38883047-38883069 GCACTTAGTAAATAAATAGTAGG - Intronic
1096666245 12:53167681-53167703 CCACTTAGTGGGTGTGAAGTGGG - Intronic
1096912865 12:55001594-55001616 GCAGTTAGTAAGTGTGATGTGGG + Intergenic
1097376428 12:58848580-58848602 GCAATTAGGTAGTCTAAAGTGGG - Intergenic
1099412682 12:82350645-82350667 TGACTTTGTAAGTGTGAAGTAGG - Intronic
1099571564 12:84326602-84326624 TCACTTAGCCAGTGTAGAGTAGG + Intergenic
1100270386 12:93019008-93019030 GCACTTGGTAAGTGTCACCTAGG - Intergenic
1101238756 12:102816571-102816593 GCACTTTATAAGTGTTAATTTGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1108488148 13:50949374-50949396 GGACTTACTAAGTCTTAAGTTGG + Intronic
1110433990 13:75458918-75458940 GCACTAGGTAAATGTAAACTGGG + Intronic
1113553556 13:111212968-111212990 GCACTCAGAAATAGTAAAGTTGG + Intronic
1114487727 14:23073334-23073356 GCATTTAGTAAGTGTCCACTTGG - Intronic
1116008048 14:39317666-39317688 CTACTCAGTAACTGTAAAGTTGG + Intronic
1116030902 14:39570072-39570094 GCATTTGATAAGTGCAAAGTGGG + Intergenic
1116060263 14:39915140-39915162 GCACCTAGAAAGTGAAAATTAGG - Intergenic
1117085088 14:52192129-52192151 CCACTTAGTAGGTGAAAGGTTGG + Intergenic
1120296379 14:82647139-82647161 ACACTTAGCAAGTGCTAAGTAGG + Intergenic
1121348800 14:93156597-93156619 GCACTTTGGAAGTCTGAAGTAGG - Intergenic
1122330370 14:100908106-100908128 GCACCTAGAATGTGTGAAGTAGG - Intergenic
1125114590 15:36075042-36075064 GAACTTATTTAGTGGAAAGTTGG - Intergenic
1127244539 15:57157807-57157829 GCACTTTGGGAGTCTAAAGTGGG - Intronic
1127420264 15:58798369-58798391 GCACTTTGAGAGTGTAAGGTGGG - Intronic
1128275983 15:66354227-66354249 GCGTTTAGGAAGTGTAAAATGGG - Intronic
1130169423 15:81496508-81496530 TTACTTTGTAAGTGCAAAGTAGG + Intergenic
1131091150 15:89625702-89625724 GAAGTTAGTAAGAGTAAAGAGGG + Exonic
1131983585 15:98018811-98018833 GCACTTGATAGGTGTAAAATGGG + Intergenic
1132955004 16:2587018-2587040 GCACATCGTAAGTGCACAGTTGG + Intronic
1138170108 16:54840918-54840940 GCACTCAGTAAATATAAACTGGG - Intergenic
1139104423 16:63809901-63809923 GCACATAGAGAGTGAAAAGTGGG - Intergenic
1139629001 16:68216026-68216048 GCACTTAATATGTGTAAATCTGG - Intronic
1149014583 17:51893025-51893047 TCACTTATTAAGCATAAAGTAGG - Intronic
1150243887 17:63659116-63659138 GCACTTTGCAAGGCTAAAGTGGG - Intronic
1151628489 17:75293408-75293430 GCACTTTGGAAGGGCAAAGTGGG - Intergenic
1153571497 18:6477769-6477791 GCACTTACTATGTGTAAAATAGG - Intergenic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1156103761 18:33631744-33631766 TTACTTAATAAGTGTGAAGTTGG + Intronic
1157117425 18:44875217-44875239 ACACTTAGAAAGAGTAAAATTGG + Intronic
1158267853 18:55679740-55679762 GCACTTTGTGAGTCTAAGGTGGG + Intergenic
1165381504 19:35484765-35484787 GCACTTAGTAGATCTGAAGTGGG + Intergenic
1168634269 19:57983145-57983167 GTACTGAGTGAGTATAAAGTTGG - Intronic
924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG + Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926184369 2:10677247-10677269 GCACTTTGTAAGGCAAAAGTTGG + Intronic
927360417 2:22225666-22225688 GCACTTAGGAAGACCAAAGTGGG - Intergenic
928190432 2:29160716-29160738 GCAATCAGTAAGAGTAAAATTGG - Intronic
931717342 2:65039553-65039575 GCAGTTAGTAAGTGGACTGTTGG + Intergenic
932726104 2:74181105-74181127 GCACTTTGTGAGGCTAAAGTGGG + Intergenic
938338393 2:130519045-130519067 GCACTTTATAAGTGGAAACTAGG - Intergenic
938351446 2:130601705-130601727 GCACTTTATAAGTGGAAACTAGG + Intergenic
938684399 2:133723050-133723072 GGACTTAGTAAATGAATAGTTGG - Intergenic
939589750 2:144049922-144049944 GCACATAGTAAGTTTATAATTGG + Intronic
939678341 2:145099584-145099606 GCACTCAGTAAGTGTTCACTGGG + Intergenic
942330153 2:174815128-174815150 GCACTTTGAAAGGCTAAAGTGGG + Intronic
942371942 2:175294735-175294757 GCACTAAGTCAGTGAAAAGAAGG - Intergenic
944468232 2:200025183-200025205 GCACATAGGAAGTCTAAAGGGGG - Intergenic
944896557 2:204171298-204171320 GCACTTAGAAAGGGTAAGGGGGG - Intergenic
945644676 2:212475868-212475890 GGACTGAGTAAGGGTAAAGAAGG - Intronic
1172052318 20:32127505-32127527 GGACTTGGTAAGTGGAAAGAAGG + Intronic
1172177104 20:32979216-32979238 AGAGTTAGAAAGTGTAAAGTCGG - Intergenic
1172737304 20:37136820-37136842 GTACATAGTAGGTGTAAAGACGG - Intronic
1173526736 20:43738522-43738544 GCACTTTGGAAGGGTAAGGTGGG + Intergenic
1173843941 20:46176427-46176449 GCCCTGAGTAATTGAAAAGTCGG - Intronic
1174327895 20:49794001-49794023 GCACATAGTAAGTGTCATGTGGG - Intergenic
1178334142 21:31729016-31729038 GAACTTGGCAAGTGTATAGTGGG - Intronic
1179577933 21:42319359-42319381 GCAGTGAGTTAGTGCAAAGTAGG - Intergenic
1182060578 22:27394289-27394311 GCACATAGTAAATGTTCAGTAGG + Intergenic
950824311 3:15800660-15800682 GCACATACTAAGTGTTAATTGGG + Intronic
951014702 3:17717846-17717868 GTGCATAGTAAGTGTAAAGGTGG - Intronic
951224216 3:20102068-20102090 GCACTTTGGGAGTCTAAAGTGGG + Intronic
952477798 3:33729145-33729167 GCACTTTGGAAGGGTGAAGTGGG + Intergenic
954724721 3:52597948-52597970 GCACTTTGGAAGGCTAAAGTGGG - Intronic
959446390 3:106445383-106445405 GCACTTTGGAAGTGTGAAGGGGG - Intergenic
959849204 3:111068326-111068348 GCATTTAATAAGAGTAAGGTTGG + Intergenic
960078681 3:113516729-113516751 GCACTTAGTAAGTGTAAAGTAGG - Intergenic
960694962 3:120387229-120387251 GCACATAGAAAGTGTTATGTAGG - Intergenic
961083438 3:124045662-124045684 GCACTTAGTAGGTGTACAGCTGG - Intergenic
963674643 3:148294448-148294470 ATACTGAGTAAATGTAAAGTGGG + Intergenic
964888327 3:161510117-161510139 GCACATAGTAAGTGCAAGATAGG + Intergenic
966190412 3:177267429-177267451 GCACTTGGTAAGTCTACAGATGG + Intergenic
967668484 3:192203848-192203870 GCACTTTGGAAGTATAAAGCAGG - Intronic
970200742 4:13602052-13602074 GCACTAAGGAAGGGGAAAGTGGG - Exonic
973039643 4:45454291-45454313 GCACTTAGAATGTTTAAAATGGG - Intergenic
973720887 4:53722343-53722365 GCACTTAGTCAGTGGAAATTAGG - Intronic
975240894 4:72057738-72057760 GCACTTAATAAGTATATTGTGGG - Intronic
976104450 4:81601871-81601893 GCACTTTGGAAGGCTAAAGTGGG + Intronic
976521321 4:86030726-86030748 GGAATTAATAAGTGTAAATTAGG - Intronic
976745256 4:88396733-88396755 GTACTTAGTAAAAGTAAATTGGG + Intronic
977052049 4:92140890-92140912 GTACTTACTAAATGAAAAGTTGG - Intergenic
982382229 4:154761407-154761429 GCACTTAGTAAGTGCCTAGAGGG - Intergenic
983610480 4:169638978-169639000 CCAATTAGCAAGTATAAAGTTGG + Intronic
986007965 5:3683997-3684019 GCACTTAGAAAATGTGAAGGCGG - Intergenic
987418024 5:17684871-17684893 TCAATTTGTCAGTGTAAAGTTGG + Intergenic
992140546 5:73792740-73792762 GCACATTATAAGTGTACAGTAGG - Intronic
992632213 5:78692576-78692598 GCACTTTGGGAGGGTAAAGTGGG + Intronic
993032698 5:82723566-82723588 GCACTTTGGAAGGGCAAAGTGGG + Intergenic
993120663 5:83770051-83770073 GCATTTAGTAAATCTAATGTAGG - Intergenic
995245629 5:109932111-109932133 GCACTTTGTAAGCTCAAAGTGGG - Intergenic
995337531 5:111017594-111017616 GTACTTAGTAAGTGGAAGTTAGG - Intergenic
997022700 5:130020169-130020191 GCACTTTGGGAGGGTAAAGTGGG + Intronic
997175530 5:131772534-131772556 GTACTTAGTAAGTTTGAGGTAGG - Intronic
998082764 5:139290695-139290717 GCACTTTGGAAGGCTAAAGTGGG - Intronic
1003244585 6:4373178-4373200 GCACACAGTGAGGGTAAAGTAGG + Intergenic
1008589916 6:52983750-52983772 GCACTTTGTGAATGTAAAATAGG - Intronic
1009319955 6:62275432-62275454 GACATTAGTAAGTGTAAAATTGG - Intronic
1009983528 6:70754696-70754718 GGAAGTAGTAAGTGTAAAGGTGG + Intronic
1010098393 6:72074415-72074437 GCACTTAGGAAGTCTGAGGTGGG + Intronic
1010640484 6:78320389-78320411 ATACACAGTAAGTGTAAAGTAGG - Intergenic
1011682785 6:89799381-89799403 ACACTTAGAAATAGTAAAGTTGG + Intronic
1013268961 6:108527995-108528017 GCATTTTGAAAGTGGAAAGTGGG - Intergenic
1014802050 6:125789538-125789560 GCATTTAGTAAGGGAAAATTAGG - Intronic
1015148877 6:130018042-130018064 GCACTTAGGAAGCGGAAAGAAGG + Intronic
1018391982 6:163347564-163347586 GCGCTTAGTAAGTGTATATAAGG - Intergenic
1019754541 7:2759329-2759351 GCACATAGGAAGTGCAAGGTAGG - Intronic
1022998341 7:35782213-35782235 GCACTTAATATCTGCAAAGTAGG + Intergenic
1025210233 7:57016180-57016202 GCACTTTGGAAGGGCAAAGTGGG - Intergenic
1025661720 7:63560667-63560689 GCACTTTGGAAGGGCAAAGTGGG + Intergenic
1026028068 7:66763107-66763129 GCACTTAGGAAGGCTGAAGTAGG - Intronic
1026524373 7:71141460-71141482 TCACTTTTTAAGTGTAAAATGGG + Intronic
1026974855 7:74491059-74491081 GCACTTTGGAAGGCTAAAGTGGG + Intronic
1027957444 7:84899131-84899153 GCACTTTGGGAGTTTAAAGTGGG + Intergenic
1028342704 7:89742005-89742027 GCACTTAGTAATTCTCTAGTAGG - Intergenic
1028392433 7:90332269-90332291 GCACTAAGTGATTGGAAAGTAGG - Intergenic
1028965203 7:96794390-96794412 CCACTTACTAGGTGTAAACTTGG + Intergenic
1029972163 7:104800444-104800466 GCACGTAGGAAGAGGAAAGTGGG - Intronic
1031042334 7:116851344-116851366 GCACTTTGTGAGTCTGAAGTGGG + Intronic
1031508472 7:122618089-122618111 TCACTTAAGAAGTGGAAAGTGGG - Intronic
1034842092 7:154408014-154408036 GCACTCAGTAAGTGCCAGGTTGG - Intronic
1035104809 7:156433353-156433375 TCACTTAGAAAATGTAAAGATGG + Intergenic
1036791453 8:11723843-11723865 GCCATTATTAAGTGTACAGTTGG + Intronic
1042386507 8:68181495-68181517 GCACTTTGGAAGTTTAAAATAGG + Intronic
1047163262 8:122406078-122406100 ACACTTAGTAAGTATTACGTTGG - Intergenic
1051919267 9:22245386-22245408 GAACTTGGTAAGTGTAAAATTGG - Intergenic
1052791761 9:32881723-32881745 GCACTTTGGAAGGCTAAAGTGGG - Intergenic
1052844050 9:33319128-33319150 GTAACTAGTAAGCGTAAAGTTGG + Intronic
1057987092 9:99728175-99728197 GCACATAGTAAGTGTTAGGTAGG - Intergenic
1058376177 9:104324583-104324605 TCTCTTATTAAATGTAAAGTGGG + Intergenic
1058686241 9:107482838-107482860 GCACTTAGCAAATATAAAGATGG + Intergenic
1059006068 9:110404124-110404146 GCACTTTCTTAGTTTAAAGTGGG + Intronic
1059838802 9:118189155-118189177 GCACTTCGTAATGGTAAAATGGG + Intergenic
1060439275 9:123623728-123623750 GCAGTTAATAAATGAAAAGTAGG - Intronic
1061609130 9:131734510-131734532 GCACTCAGTAAGTGTTAAAACGG + Intronic
1061618143 9:131793627-131793649 GCACTTTGTGAGTCCAAAGTGGG - Intergenic
1186877351 X:13829404-13829426 GCATTTTGTAAGTGTCATGTAGG - Intronic
1186906603 X:14117704-14117726 GCACTTACTGAGTGAAAAGGGGG + Intergenic
1188464009 X:30457675-30457697 TCACTTAGTAAGTGTGGAGCCGG - Intergenic
1190079266 X:47342755-47342777 GCACTTTGTAAGGCCAAAGTGGG - Intergenic
1190369112 X:49724675-49724697 GCACTCAGTAAGTCTACATTTGG - Intergenic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1191899613 X:66027290-66027312 GCACTGAGGATGGGTAAAGTGGG - Intronic