ID: 960079797

View in Genome Browser
Species Human (GRCh38)
Location 3:113529352-113529374
Sequence GAGGCACAAGAAGCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960079791_960079797 22 Left 960079791 3:113529307-113529329 CCAGTGCTGACCCAATGTGTCAA No data
Right 960079797 3:113529352-113529374 GAGGCACAAGAAGCCTTGGTGGG No data
960079793_960079797 11 Left 960079793 3:113529318-113529340 CCAATGTGTCAATGCAGACTCAA No data
Right 960079797 3:113529352-113529374 GAGGCACAAGAAGCCTTGGTGGG No data
960079792_960079797 12 Left 960079792 3:113529317-113529339 CCCAATGTGTCAATGCAGACTCA No data
Right 960079797 3:113529352-113529374 GAGGCACAAGAAGCCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960079797 Original CRISPR GAGGCACAAGAAGCCTTGGT GGG Intergenic
No off target data available for this crispr