ID: 960084633

View in Genome Browser
Species Human (GRCh38)
Location 3:113577280-113577302
Sequence GGAGGCACAAAGGTTAAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960084626_960084633 18 Left 960084626 3:113577239-113577261 CCACTATGCACCAAGAACATTGT 0: 1
1: 0
2: 0
3: 14
4: 128
Right 960084633 3:113577280-113577302 GGAGGCACAAAGGTTAAGAACGG 0: 1
1: 0
2: 0
3: 10
4: 269
960084625_960084633 19 Left 960084625 3:113577238-113577260 CCCACTATGCACCAAGAACATTG 0: 1
1: 0
2: 2
3: 25
4: 312
Right 960084633 3:113577280-113577302 GGAGGCACAAAGGTTAAGAACGG 0: 1
1: 0
2: 0
3: 10
4: 269
960084627_960084633 8 Left 960084627 3:113577249-113577271 CCAAGAACATTGTTAGACTGCAC 0: 1
1: 1
2: 0
3: 10
4: 113
Right 960084633 3:113577280-113577302 GGAGGCACAAAGGTTAAGAACGG 0: 1
1: 0
2: 0
3: 10
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960084633 Original CRISPR GGAGGCACAAAGGTTAAGAA CGG Intronic
901017092 1:6238091-6238113 GGAGGGAGAAAGGCTGAGAAGGG + Intergenic
901877500 1:12175281-12175303 GGGGCCACCAAGGTTCAGAAAGG - Intronic
902612214 1:17603843-17603865 GGAGGAACCAAGGCTTAGAAAGG - Intronic
902692007 1:18115785-18115807 GGAAGGAAAAAGGTTGAGAAGGG + Intronic
903587695 1:24428775-24428797 GGAGGCCAAAAGGTTATGTATGG - Intronic
904354399 1:29929510-29929532 GCATGCTCAAAGGTGAAGAAGGG - Intergenic
905246443 1:36617805-36617827 TGGGGGGCAAAGGTTAAGAAGGG + Intergenic
905585710 1:39116035-39116057 GGAGGAAGACAGGTGAAGAAGGG + Intronic
907410403 1:54279573-54279595 GGAGGCACACAGATGAAGCATGG + Intronic
907976966 1:59440812-59440834 GGATTTACCAAGGTTAAGAAAGG + Intronic
908846721 1:68332281-68332303 GGAGGGAGAAAGGGCAAGAAGGG + Intergenic
908880383 1:68725003-68725025 GGATACACACAGGTTTAGAATGG + Intergenic
909409013 1:75327855-75327877 GGAGGCATAAAGGCAAAGACTGG - Intronic
909574239 1:77155819-77155841 GAAGGCAGAAAGGTGGAGAAGGG + Intronic
909629498 1:77756706-77756728 GGAGGAAAAAAGGTTAATAGTGG - Intronic
910409894 1:86930875-86930897 TGAGGCAGAGAGGTGAAGAAAGG + Intronic
912125831 1:106536681-106536703 GGTGGCAAAAATGTTAAAAATGG - Intergenic
912835877 1:112995985-112996007 CAAAGCAGAAAGGTTAAGAAGGG - Intergenic
914334333 1:146701065-146701087 GGGGGCAAAAAGGTCATGAAGGG + Intergenic
915071859 1:153276198-153276220 GCAGACACAAAGTTTAAAAAGGG - Intergenic
916495976 1:165347182-165347204 GGGGGCACAAAGGGGAAAAAAGG + Intronic
919947437 1:202329981-202330003 GGAGTGTCAAAGGTCAAGAATGG + Intergenic
921061635 1:211590201-211590223 GGAGGTAAAAGGGATAAGAAGGG - Intergenic
921953012 1:220953226-220953248 GGAGGAGCAAAGGTCAAGGAAGG - Intergenic
924577768 1:245295983-245296005 GGAGGTACAAAGATGAATAATGG - Intronic
1063379936 10:5577974-5577996 GGAGGGACAAAGGATAACCAAGG - Intergenic
1065658855 10:27983452-27983474 GGAGGGACAAAGGGAAAGAGAGG - Intronic
1067348844 10:45457556-45457578 GGAGATACAAAGGTAAGGAAGGG + Exonic
1067480200 10:46590375-46590397 TAAGGCATAAAGATTAAGAAAGG - Intronic
1067614538 10:47751424-47751446 TAAGGCATAAAGATTAAGAAAGG + Intergenic
1068669992 10:59712639-59712661 GGTGGCAAATAGCTTAAGAAAGG - Intronic
1069214553 10:65803482-65803504 AGAGGAAAAATGGTTAAGAAAGG + Intergenic
1071629943 10:87211397-87211419 TAAGGCATAAAGATTAAGAAAGG + Intergenic
1073291167 10:102413988-102414010 GGCAGCTCAAAGGTGAAGAAGGG + Exonic
1075552539 10:123402617-123402639 GGAGCCACAAAGGAGGAGAAGGG - Intergenic
1080650485 11:34218879-34218901 AGAGGAACAAAGGTAAACAATGG - Intronic
1080682874 11:34492275-34492297 GAAGGCAGAAAAGCTAAGAATGG - Intronic
1082142169 11:48622035-48622057 AGAGGCAGAGAGCTTAAGAATGG - Intergenic
1082700072 11:56418011-56418033 GGAGTAACAAAGGTCAACAAAGG + Exonic
1082864741 11:57888232-57888254 GGAGGTACAAAGGGCCAGAATGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1083852454 11:65376280-65376302 GGAGGCACCTTGGTTAGGAAGGG + Exonic
1088583319 11:111335656-111335678 GGAGGGGCAAATGTTCAGAAAGG + Intergenic
1090364119 11:126192080-126192102 GGAGAAACACAGGTTAAGAGTGG + Intergenic
1090375212 11:126283320-126283342 GGTGCCAGAAAGGTGAAGAAGGG - Intronic
1090931267 11:131300022-131300044 GGAGGCAGAAAGAAGAAGAAGGG + Intergenic
1091600996 12:1917696-1917718 GGAGGCAGAAAGGTGTAGAAAGG + Intronic
1092035332 12:5329552-5329574 GGAGGGTCAAAGTCTAAGAAAGG + Intergenic
1094155981 12:27337396-27337418 GGAGGCACTTTGGTCAAGAAGGG - Intronic
1096212662 12:49778377-49778399 CGAGGCACAAAGGTGAGGCAGGG - Intergenic
1096687760 12:53300059-53300081 GGAGGCAGGAAGGGTAGGAAGGG - Intronic
1097773797 12:63622477-63622499 GGTGGCACAAACCTTGAGAATGG - Intronic
1098617033 12:72539140-72539162 GGAGGGACAAAGGATAACGAGGG - Intronic
1098890023 12:76000607-76000629 GAATGCACAAATGATAAGAAAGG - Intergenic
1099870245 12:88338992-88339014 GGAGGCCCAAAGTTTAAAAGAGG - Intergenic
1101146426 12:101844952-101844974 GGAGGCACAGAAGTTAAAACAGG - Intergenic
1101813538 12:108128771-108128793 GGGGACACAAAGGTTCAGAGAGG + Intergenic
1103763007 12:123264930-123264952 GGCAGCACACAGGGTAAGAAGGG + Intronic
1105629613 13:22149110-22149132 GGAGGCACAATGGTAAGGGAGGG + Intergenic
1105666405 13:22562229-22562251 GGAGACTAAAATGTTAAGAAAGG - Intergenic
1108406190 13:50104865-50104887 GGAAGCAAAAAGGGAAAGAATGG - Exonic
1108979794 13:56496278-56496300 GGAGACACAAAATTTAATAAAGG - Intergenic
1111539902 13:89656303-89656325 GGTGGCAGAAAGGAGAAGAATGG - Intergenic
1111854499 13:93620820-93620842 GGTGGCAGAAAGGTTGGGAATGG - Intronic
1114500760 14:23166546-23166568 TGAGGCACCAAGGGTAAGGAGGG + Intronic
1114861974 14:26534802-26534824 GGAGACAAGAAGGTTAAAAAAGG + Intronic
1116116345 14:40656463-40656485 GCAGGCATGAAGGTTATGAATGG - Intergenic
1116331909 14:43607715-43607737 GGAGCCACAAAAGTTTTGAAGGG + Intergenic
1116352633 14:43885097-43885119 GGAAGCACAAAGGTGGAGAAGGG + Intergenic
1118772472 14:68951428-68951450 GGAGGCACAATGGACAAGACAGG + Intronic
1119859758 14:77927686-77927708 TGAGGCCCAAAGGACAAGAAAGG + Intronic
1121813023 14:96908048-96908070 GCAGACACTAAGGTTCAGAAAGG - Intronic
1121835284 14:97086843-97086865 GCAGGCACAAAGGGAAACAAGGG - Intergenic
1121891605 14:97598005-97598027 GGAGACAGAAAGGATAAAAATGG + Intergenic
1124231152 15:27947431-27947453 GGTGGCACAATGGCAAAGAAGGG - Intronic
1127733491 15:61820829-61820851 GGAGCCACAAAAGTTAGAAAAGG + Intergenic
1127966762 15:63928477-63928499 GAAGGCAAAAAGGTTGGGAAGGG + Intronic
1128280998 15:66394371-66394393 GGAGGAAGAAAGGTTGAGACAGG + Intronic
1128692273 15:69733874-69733896 GAAGACCTAAAGGTTAAGAAGGG - Intergenic
1130156066 15:81351118-81351140 TGAGGCTCAAAGGTAGAGAACGG + Intronic
1133533438 16:6676459-6676481 GGAGGCAGAAAGGTCCTGAATGG + Intronic
1135721196 16:24820088-24820110 GGAGGAATAATGTTTAAGAAAGG - Intronic
1136540740 16:30926502-30926524 GGAGGCTCAAAGGATGAGGAAGG - Intronic
1137348612 16:47689477-47689499 AGTGCCACAAAGGTTCAGAAAGG - Intronic
1138806269 16:60093397-60093419 GGAGGCAAAAAAGGTAACAAAGG - Intergenic
1139187506 16:64823970-64823992 GGAGGGACCAAGGCTTAGAAAGG + Intergenic
1139370917 16:66468971-66468993 GGAGGGACAAAGGCACAGAAGGG - Intronic
1139999284 16:71010167-71010189 GGGGGCAAAAAGGTCATGAAGGG - Intronic
1146890847 17:36505626-36505648 GGAGGATCACAGGTTTAGAAGGG - Intronic
1147753778 17:42754598-42754620 TGAAGCTCAAAGGTTAAGTAAGG - Intergenic
1149998681 17:61418099-61418121 GGAAAGACAGAGGTTAAGAAGGG + Intergenic
1153646148 18:7197779-7197801 GGAGGGAAAAGAGTTAAGAATGG + Intergenic
1155494981 18:26433917-26433939 GCAGGCAAAAAGGGAAAGAAAGG - Intergenic
1156662580 18:39363816-39363838 GGAGGCAGAAAGGCTAATACTGG - Intergenic
1156954635 18:42947478-42947500 GCAGTAACAAAGGTTAATAAAGG - Intronic
1157141994 18:45118289-45118311 GGAGACACAAAGTGTAATAAAGG + Intergenic
1158393501 18:57062297-57062319 GGAGGCCCAAAGGATCAGAGTGG - Intergenic
1158750045 18:60248172-60248194 GGAGACACAAAGGCCATGAATGG - Intergenic
1159666838 18:71171657-71171679 GGAGGGACAGAGGTAAAGATGGG - Intergenic
1160032027 18:75270228-75270250 TGAGGCACAGAGGTTAAGTGAGG - Intronic
1160120295 18:76124373-76124395 GGATGCACAAAAGATAAAAATGG - Intergenic
1160197431 18:76767572-76767594 GGAAGCTCAAAGGGTAGGAAAGG - Intergenic
1162498262 19:11035478-11035500 GGAGGCACAAGGGTGAATCATGG + Intronic
1163242134 19:16070726-16070748 GGAGGCCCAAAGGGGAAGTAGGG - Intronic
1163337019 19:16679833-16679855 GGAGGAACCAAGGTTCAGAGAGG - Intronic
1166463276 19:43009100-43009122 GGAGACACAAAGCCTAAGACAGG - Intronic
1167406005 19:49309203-49309225 GGAGATACAAAAGTAAAGAATGG + Intronic
1167621993 19:50565926-50565948 GGAGGCACAGAGGGAGAGAAGGG - Intronic
925662107 2:6213464-6213486 GGAGTCACAAAAGTGATGAAGGG - Intergenic
925865855 2:8225155-8225177 ATAGCCACAGAGGTTAAGAAGGG - Intergenic
927194652 2:20539106-20539128 GGAGAAAAAAAGGTTAAGACAGG + Intergenic
927928488 2:27028913-27028935 GGAGGCAGAAAGGGTCAGAGTGG + Intergenic
929048818 2:37816749-37816771 GGTGGCACTGAGGTTAGGAAGGG - Intergenic
930607238 2:53505149-53505171 AAAGGCACAAAGATTAAAAAAGG - Intergenic
930713369 2:54570225-54570247 GGAGAGAGAAAGGCTAAGAAGGG - Intronic
932735992 2:74255120-74255142 GGAAGTAAAAAAGTTAAGAATGG - Intronic
933979942 2:87541143-87541165 GGAGGCAAGAAGGTTAAAGAAGG - Intergenic
934735720 2:96688929-96688951 GGAGGCACAGAGGTGGAGAGGGG - Intergenic
936313879 2:111409648-111409670 GGAGGCAAGAAGGTTAAAGAAGG + Intergenic
937072260 2:119073295-119073317 GGAGGCAAAAAGGAAAGGAAGGG + Intergenic
937713495 2:125005685-125005707 GGAGAAACAAAGGATAAAAATGG + Intergenic
939022305 2:136973129-136973151 GGAAGCACAAAGATTATGACTGG + Intronic
939765110 2:146238643-146238665 GGAGGTACAGAGGGTAAGAAGGG - Intergenic
940140750 2:150488241-150488263 GGAGGCAGAAAGGTTTCGAGGGG + Intronic
940339144 2:152561405-152561427 GGAAGGACAAAGGGTAACAAAGG - Intronic
941367443 2:164624457-164624479 GGAGGGACAAAGAGTAAAAAAGG - Intergenic
941445825 2:165598343-165598365 ACATGCACAAAGGTAAAGAATGG + Intronic
941569224 2:167148512-167148534 GGAGGGAAAGAGGTAAAGAAAGG + Intronic
941724516 2:168846761-168846783 GGAGGAACACTGGTTGAGAAAGG - Intronic
943002061 2:182340592-182340614 GGAGGAAAAGTGGTTAAGAAAGG + Intronic
943148025 2:184070609-184070631 GGAGGCACAAGAGTGAACAATGG - Intergenic
943151182 2:184115625-184115647 AGAGGCAACAAGGGTAAGAAAGG + Intergenic
943981198 2:194553348-194553370 TGAGGCAGAAACGTTAAGTAAGG - Intergenic
944337745 2:198557174-198557196 TGAGGCAACAAGGTTAAGGATGG + Intronic
945020966 2:205571232-205571254 TTAGGCAAAAAGGTCAAGAAAGG - Intronic
945605076 2:211919019-211919041 GGAGGGAGAAAGGATAATAACGG - Intronic
945867397 2:215191556-215191578 GGAGCCAGAAAGGTCAAGATAGG + Intergenic
946132174 2:217615114-217615136 GAAGGCACACAGGGTAAGAGGGG - Intronic
948372567 2:237498929-237498951 GGAGGGACAAAGGCTGAGAAGGG - Intronic
1169879643 20:10332462-10332484 GGAAACACAAAGCTTCAGAATGG + Intergenic
1170403806 20:16014930-16014952 GGAGGCAGAAGAGTCAAGAAAGG + Intronic
1172066205 20:32222419-32222441 GGAGGAACAAAAGTTGCGAAAGG + Intronic
1172393097 20:34579756-34579778 GGAGGCACAAAGAAGAAGGATGG - Intronic
1173931809 20:46827161-46827183 GGAAGCATTAATGTTAAGAAGGG - Intergenic
1175214511 20:57384632-57384654 GGAGGCAGAAAGATTTACAAGGG - Intergenic
1177517297 21:22171657-22171679 GTAGGCCTAAAGGTTAAGACAGG + Intergenic
1179862957 21:44200720-44200742 ACAGGCACAAAGTTTAAAAAGGG + Intergenic
1179958223 21:44752686-44752708 GGAGGGACAAAGGGAAAGAGGGG + Intergenic
1182735543 22:32530118-32530140 GGAGCCCCCAAGGTTAGGAATGG + Intronic
1184104385 22:42359132-42359154 GGAGGAACTAAGGCTCAGAAAGG - Intergenic
949105715 3:197837-197859 AGAGGCACAAAGAGGAAGAAGGG - Intronic
950231124 3:11276746-11276768 TGAGGGACAAAGGGGAAGAAAGG - Intronic
950535620 3:13576554-13576576 GAAGGCACAAAGATTCAGGAAGG + Intronic
950627690 3:14260199-14260221 GGAGGCTCAAAGGCTAGGGAAGG - Intergenic
950944837 3:16934362-16934384 TGAGGAACATAGGTTAGGAAAGG + Intronic
951231714 3:20186811-20186833 GGACGGGCAAAGGTTAAGAGAGG - Intergenic
951587777 3:24232876-24232898 GGATGCAGATAGGTTAAGATTGG + Intronic
951663774 3:25099234-25099256 GAAGGCAGAAAAGGTAAGAAGGG - Intergenic
952137645 3:30441279-30441301 GGAGACACAAAGGTGAATTATGG + Intergenic
952472347 3:33668896-33668918 GGAGGGAGAAATGGTAAGAATGG + Intronic
952656205 3:35788945-35788967 GGAGGTAAAAAGGTTAGGAATGG - Intronic
954588839 3:51762639-51762661 GGTGGCACAATGGTTGATAAAGG + Intergenic
955382014 3:58446856-58446878 GGAATCACAAAGGTTCTGAATGG + Intergenic
956727889 3:72171472-72171494 AGAGACAGAAAGGTCAAGAAAGG - Intergenic
956801354 3:72762312-72762334 GGTGACAAATAGGTTAAGAAAGG + Intronic
957069121 3:75551868-75551890 GCAGGAACAGAGTTTAAGAAAGG + Intergenic
958622049 3:96574706-96574728 GAAGGAAAAAATGTTAAGAATGG - Intergenic
959265823 3:104137289-104137311 GCAGTCTCAAAGGTTATGAAAGG - Intergenic
960084633 3:113577280-113577302 GGAGGCACAAAGGTTAAGAACGG + Intronic
960272463 3:115689831-115689853 GGAGGCAGAAAGAATAAGCAAGG + Intronic
960540546 3:118857040-118857062 GGAAACACAAATGATAAGAAAGG + Intergenic
960956091 3:123032200-123032222 GTAGGTACAAAGGTTAGAAATGG - Intergenic
962889012 3:139654915-139654937 GGAGGTAGAAAGGCTAAGGACGG + Intronic
963643522 3:147885189-147885211 GGAGGAACAAAGTTTCAGGAAGG - Intergenic
964735041 3:159908339-159908361 GGATGCAGAGGGGTTAAGAAGGG + Intergenic
966479466 3:180389803-180389825 GGAGGCAGGAAGGTAAAAAAGGG + Intergenic
967100096 3:186209409-186209431 TGAGGCACAGAGATTTAGAAGGG - Intronic
967798223 3:193622644-193622666 GGAGCTACAAAGGTTATGGAAGG - Intronic
969752614 4:9123295-9123317 GCAGGAACAGAGTTTAAGAAAGG + Intergenic
970027250 4:11636650-11636672 GGAGGTAGAAAGGTTCAGAAAGG - Intergenic
970435454 4:16029934-16029956 GAAGGCAGAAAGGGAAAGAAAGG - Intronic
973727258 4:53789061-53789083 GGAGGTGGAAAGATTAAGAAAGG - Intronic
974845823 4:67350446-67350468 GGAGGGACACAGCTGAAGAAGGG - Intergenic
977654976 4:99510370-99510392 GGAGGCATAAGGCATAAGAATGG + Intergenic
978548425 4:109898724-109898746 GAAGGAAAAAATGTTAAGAAGGG - Intergenic
980639923 4:135564613-135564635 AAATGCACAGAGGTTAAGAAGGG + Intergenic
981802792 4:148677653-148677675 GGAGGCAATATGGTTAAGACAGG + Intergenic
982595082 4:157372460-157372482 GGAGGCACAAAGGCATAGAGAGG + Intergenic
983120893 4:163883128-163883150 GCAGGAACAAATGTTAACAAAGG - Intronic
988693621 5:33597132-33597154 GAAGTCACAAAGGTTGAGAAAGG + Intronic
990083854 5:51951247-51951269 GAAGGCATAAAAGTTAAAAAAGG - Intergenic
990576508 5:57128568-57128590 GGAGGAACCAAGGTTCAGACTGG - Intergenic
990643308 5:57813893-57813915 TGAGGCAGAAAGTTTAAAAAAGG - Intergenic
990802467 5:59620277-59620299 GGAAACACAAGGGTTAAAAATGG + Intronic
992533252 5:77672242-77672264 GGAGGAACAAAGGGAAAAAAAGG - Intergenic
993035971 5:82757619-82757641 GGGGGCACAAATGGGAAGAAAGG + Intergenic
994047048 5:95321845-95321867 CAAGGCATAAAGGTAAAGAAAGG + Intergenic
994054601 5:95401101-95401123 GGAGGCATCAAGGTTGACAAAGG - Intronic
994369564 5:98952595-98952617 GAAGGCAGAAAGGTAAAAAAGGG - Intergenic
994456641 5:100017103-100017125 GAAGGGACAAAGGGAAAGAAAGG - Intergenic
994910276 5:105896240-105896262 GAATGCACAAAAGTAAAGAATGG + Intergenic
995001966 5:107144023-107144045 GGAGACACAAAGGTTATAATTGG - Intergenic
998691689 5:144594985-144595007 GGAGGCACCAAGGGTGAGCAAGG - Intergenic
999186284 5:149712395-149712417 GGAGGCAAAAAAGTGAGGAATGG + Intergenic
1001094441 5:168765445-168765467 GGAGCCAGAAATGTTAATAACGG + Intronic
1001271031 5:170311887-170311909 GCAGGCACAGAGGGAAAGAAGGG - Intergenic
1001288051 5:170437965-170437987 GGAGGGACCAAGGCTAGGAATGG - Intronic
1003163807 6:3658765-3658787 GCAGGCAGGAAGGTTAAGATGGG + Intergenic
1005667050 6:28068353-28068375 GGAGGCACAAGGGTGAGGGATGG - Intergenic
1006185429 6:32178977-32178999 TGAGACACAAAGGTTAAGGGAGG + Intronic
1006832844 6:36979070-36979092 GGAGGGAAAAAGGAAAAGAAAGG + Intronic
1006964438 6:37968257-37968279 GGAGGCAAGAGGGCTAAGAATGG + Intronic
1007165024 6:39823206-39823228 AAAGGCCCAAAGATTAAGAAAGG + Intronic
1007539648 6:42629351-42629373 GTAGGCATAAAAATTAAGAAAGG + Intronic
1008550765 6:52628431-52628453 AGAGGCCCAGAGGTCAAGAATGG + Intergenic
1009177462 6:60478187-60478209 GGGTGCATAAAGGTTTAGAATGG - Intergenic
1010158348 6:72821971-72821993 GGATGCACGAAGGATAAGATAGG - Intronic
1010251060 6:73707502-73707524 GGAGGCACAGTGGGTTAGAATGG + Intronic
1011083810 6:83516809-83516831 GGAGGCAGACGGGTTAAGAGTGG - Intronic
1012615653 6:101276341-101276363 AGAGTTACAAAGATTAAGAATGG - Intergenic
1014795430 6:125719082-125719104 GGAGGCAGAAAGGGTGGGAAAGG + Intergenic
1015365466 6:132392850-132392872 GGAGTCAAAAAGGTTAAAATGGG + Intronic
1015465953 6:133548921-133548943 GGAAGCACAGAGGGTAAGGAGGG + Intergenic
1017257662 6:152352242-152352264 CGAGGCAGAGAGGTTAAGAAAGG - Exonic
1018381246 6:163260069-163260091 GGAGGCACCAAGGATAAGCCAGG - Intronic
1018869489 6:167770254-167770276 GGAGACACATAGGGTGAGAAAGG - Intergenic
1022933370 7:35146229-35146251 GGTGGCACAAACCTTGAGAATGG - Intergenic
1023556793 7:41431526-41431548 GGAGCAACAAAGGGTAATAAAGG - Intergenic
1023913427 7:44570993-44571015 TGAGGCACAATGATTAAGTAGGG - Intronic
1024194675 7:47047450-47047472 GGAGGCACACAGGCTGAGACAGG - Intergenic
1026345371 7:69469154-69469176 GGAGGTAATAATGTTAAGAATGG + Intergenic
1027621030 7:80485221-80485243 GGAAGCACTTAGATTAAGAAGGG - Intronic
1029829296 7:103238996-103239018 GGTGGCACAAACCTTGAGAATGG - Intergenic
1031960837 7:127988431-127988453 GTAGACACAAAGGCAAAGAAGGG - Intronic
1033316803 7:140304236-140304258 GGAGTCACAAAGGTTGATCATGG - Intronic
1034352568 7:150426860-150426882 GGAGGCACAGAGGTTGTGAAAGG + Intergenic
1036375829 8:8198689-8198711 GCAGGAACAGAGTTTAAGAAAGG + Intergenic
1036422808 8:8613774-8613796 GGAGACACAAAGGGAAAGCAAGG + Intergenic
1036853700 8:12224454-12224476 GCAGGAACAGAGTTTAAGAAAGG - Intergenic
1036875076 8:12466964-12466986 GCAGGAACAGAGTTTAAGAAAGG - Intergenic
1038957728 8:32485415-32485437 GGAAGCAGAAAAGTGAAGAAAGG - Intronic
1039190959 8:34973643-34973665 AGAGGCACAAAGGTAAGGCAAGG - Intergenic
1040073998 8:43211243-43211265 GGAGGCACAAGGGGCCAGAAGGG - Intergenic
1041414000 8:57587342-57587364 GGAGGCACAAATATTGACAAAGG + Intergenic
1042041740 8:64598985-64599007 GCAGGAACCAATGTTAAGAAGGG + Intronic
1042642576 8:70952441-70952463 GGAGGCAGAGAGGACAAGAAAGG - Intergenic
1043116283 8:76257546-76257568 GGAAGCACATATGTTTAGAATGG - Intergenic
1044478061 8:92651752-92651774 GGAGGCAGAAATGTCAAGAGGGG - Intergenic
1045846822 8:106646638-106646660 GGAAGAACAAGGGTAAAGAAGGG + Intronic
1046242621 8:111516726-111516748 GGAGGCATAGAGGTTGAAAATGG - Intergenic
1047173827 8:122521619-122521641 AGAGTCAGAAAGTTTAAGAAAGG + Intergenic
1047381230 8:124365690-124365712 GGAGGCAAAAAGGTCAATGAGGG + Intronic
1048070184 8:131012707-131012729 GGAGGCATAAAGGATCATAATGG + Intronic
1048231184 8:132643432-132643454 GGAGGCAGGTAGGATAAGAAAGG + Intronic
1049538963 8:143197778-143197800 GAAGGCAGAAAGGCCAAGAAGGG + Intergenic
1049978472 9:882415-882437 GGATGTATAAAGGATAAGAAAGG - Intronic
1050461125 9:5878341-5878363 GGAGGCACCATGTATAAGAATGG + Intergenic
1052139653 9:24963914-24963936 AGAGGCAGAAAAGTTAACAAAGG + Intergenic
1053164609 9:35835514-35835536 GAAGGCACAAATGTTAATCAAGG + Intronic
1056022738 9:82457607-82457629 CTAGGCACAAGGTTTAAGAAGGG - Intergenic
1057490251 9:95515358-95515380 GGAGGAAGAAAGGATAAAAAGGG + Intronic
1057745811 9:97750060-97750082 GGAGGCACCATGGCCAAGAACGG + Intergenic
1058056129 9:100450840-100450862 GGAGGAACACAGGATAAAAATGG + Exonic
1058231080 9:102426366-102426388 GAAGGAACAAAGGTCAACAATGG + Intergenic
1060320515 9:122555002-122555024 GAAGTCACAAAGCTTAACAATGG + Intronic
1060424345 9:123492265-123492287 GGAGGCACAAAGGAAGAGAGGGG + Intronic
1186039808 X:5463387-5463409 GGAGGGACCATGGTGAAGAAGGG - Intergenic
1186470568 X:9818873-9818895 GGAAGCTCAAAGGTGCAGAATGG - Intronic
1186616062 X:11189299-11189321 GGAGGCGCAAAGCTTATAAAAGG + Intronic
1188152488 X:26695208-26695230 GGAGGCAGAAGGGTCAAGGATGG + Intergenic
1188765499 X:34086579-34086601 GTAGATACAAAGGTTAAGGAAGG + Intergenic
1189348664 X:40261254-40261276 GGGGCCACAGAGGTTCAGAAAGG + Intergenic
1189967116 X:46386394-46386416 GGAGGAGCAAAGGTCAGGAAAGG - Intergenic
1191117086 X:56863755-56863777 GCAGCCACAAACGTTGAGAAAGG - Intergenic
1191938471 X:66451823-66451845 GGAGATAAAAAGGTAAAGAAGGG + Intergenic
1195725669 X:107913098-107913120 GATGGACCAAAGGTTAAGAATGG - Intronic
1196330216 X:114463757-114463779 TGAGAAACAGAGGTTAAGAAGGG + Intergenic
1197467356 X:126821062-126821084 GGGGGCACAAAGGTCAACAATGG + Exonic
1197950441 X:131890227-131890249 GGAGTCAAACAAGTTAAGAAGGG - Intergenic
1199116055 X:143994119-143994141 GGAGACACAAAGTTTAACACTGG + Intergenic