ID: 960088595

View in Genome Browser
Species Human (GRCh38)
Location 3:113616295-113616317
Sequence GTGGCTAAAGGCCCATTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960088585_960088595 7 Left 960088585 3:113616265-113616287 CCTAAAATCAAGAAGGCCAGATG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 960088595 3:113616295-113616317 GTGGCTAAAGGCCCATTAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 138
960088590_960088595 -9 Left 960088590 3:113616281-113616303 CCAGATGGCCCAGGGTGGCTAAA 0: 1
1: 0
2: 2
3: 8
4: 135
Right 960088595 3:113616295-113616317 GTGGCTAAAGGCCCATTAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960088595 Original CRISPR GTGGCTAAAGGCCCATTAGT GGG Intronic
900379541 1:2377088-2377110 GTGGCAAAATGCCCATTCCTCGG - Intronic
905514232 1:38550170-38550192 GTGGCTACAGGCTCAGTGGTAGG - Intergenic
906809842 1:48814903-48814925 TTGGATAAATGCCCAGTAGTGGG + Intronic
907024011 1:51097407-51097429 TTGGATAAATGCCCAGTAGTGGG - Intergenic
908054546 1:60269402-60269424 GTGGCTGAAGGCCCCTTGGGTGG - Intergenic
909592339 1:77364872-77364894 TTGGATAAATGCCCAGTAGTGGG + Intronic
913333781 1:117689166-117689188 TTGGCTAAATACCCAGTAGTAGG - Intergenic
914441213 1:147708913-147708935 TTGGATAAAGACCCATCAGTTGG - Intergenic
917469491 1:175314357-175314379 GTGGCTAATGGTGCATTAGCTGG + Intergenic
918020253 1:180680697-180680719 TTGGATAAATGCCCAGTAGTGGG - Intronic
918773171 1:188590681-188590703 TTGGGTAAATGCCCAGTAGTAGG + Intergenic
921162745 1:212484804-212484826 GTGGATCAAGACCCATAAGTGGG - Intergenic
921261717 1:213390232-213390254 ATGGCAAAATGCCCAATAGTTGG + Intergenic
923223248 1:231915409-231915431 CTGGCCAAAGACCCATGAGTGGG - Intronic
1068069253 10:52175496-52175518 TTGGTTAAATGCCCAGTAGTGGG + Intronic
1070433563 10:76365250-76365272 GTGGCTAGATACCCAGTAGTGGG + Intronic
1072737857 10:97891337-97891359 TTGGCCAAAGGCCCAGAAGTGGG - Intronic
1074181234 10:111066239-111066261 TTGGATAAATGCCCAGTAGTGGG - Intergenic
1075962071 10:126576558-126576580 TTGGATAAATGCCCAGTAGTGGG - Intronic
1079469694 11:20766437-20766459 GTGGCTAAAAGCCAGTTGGTGGG - Intronic
1080318384 11:30976821-30976843 TTGGATAAATGCCCAGTAGTGGG - Intronic
1082211206 11:49504289-49504311 TTGGCTATACGCCCAGTAGTGGG - Intergenic
1083966598 11:66047474-66047496 GTGGGGAAAGGCCCAAGAGTGGG - Intronic
1084972129 11:72777737-72777759 GTGGCTCAAGGCCCAGTAGTTGG - Intronic
1086638437 11:89120765-89120787 TTGGCTATACGCCCAGTAGTGGG + Intergenic
1087068433 11:94049485-94049507 TTGGATAAATGCCCAGTAGTGGG - Intronic
1090193118 11:124790994-124791016 GTAGGTTATGGCCCATTAGTGGG + Intronic
1095499557 12:42821673-42821695 GTGGATAAATACCCAGTAGTGGG + Intergenic
1102553239 12:113707950-113707972 TTGGCTAAATGTCCAGTAGTGGG - Intergenic
1102716588 12:114978697-114978719 TTGGATAAATGCCCACTAGTGGG - Intergenic
1103920959 12:124398993-124399015 GTTGCTTAAGACCCATGAGTGGG + Intronic
1104343590 12:127975503-127975525 GTGGGTAGATGCCCAGTAGTGGG + Intergenic
1105002481 12:132699869-132699891 TTGGGTAGAGGCCCAGTAGTGGG + Intronic
1106028768 13:25979527-25979549 TTGGCTCAAGGCCCCTTAGGTGG + Intronic
1106346217 13:28881479-28881501 TTGGGTAAATGCCCAGTAGTGGG + Intronic
1106939665 13:34763999-34764021 CTGACAAAAGGCACATTAGTAGG - Intergenic
1107016708 13:35713362-35713384 GGGGGTAAACACCCATTAGTGGG - Intergenic
1110801973 13:79708753-79708775 CTTGGTAAAGTCCCATTAGTTGG - Intergenic
1114136293 14:19855669-19855691 TTGGATAAATGCCCAGTAGTGGG + Intergenic
1114679150 14:24469554-24469576 TTGGATAAATGCCCAGTAGTGGG - Intergenic
1114707187 14:24738877-24738899 TTGGATAAATGCCCAGTAGTAGG + Intergenic
1116468680 14:45262547-45262569 TTGGATAAATGCCCAATAGTGGG + Intergenic
1116475497 14:45334298-45334320 TTGGATAAATGCCCAGTAGTGGG + Intergenic
1117912518 14:60648910-60648932 GTGGCTGAAGGCGCATTACGTGG - Exonic
1126719457 15:51561670-51561692 TTGGATAAATACCCATTAGTGGG - Intronic
1137420080 16:48325758-48325780 TTGGATAAATGCCCATTTGTGGG + Intronic
1138175507 16:54894427-54894449 GTGGCATCTGGCCCATTAGTGGG + Intergenic
1138637608 16:58353790-58353812 TTGGGTAAATGCCCAGTAGTGGG + Intronic
1138842027 16:60521677-60521699 GTGGATAAATACCCAGTAGTGGG - Intergenic
1138982969 16:62293162-62293184 GTGGTTAAAGGACCAGAAGTTGG + Intergenic
1146096306 17:29933102-29933124 GGGGCTCAAAGCCAATTAGTAGG + Intronic
1149279485 17:55086768-55086790 TTGGATAAATGCCCAGTAGTAGG + Intronic
1154460561 18:14580682-14580704 TTGGATAAATGCCCAGTAGTGGG + Intergenic
1156860001 18:41824874-41824896 GTGGGTAAATACCCAGTAGTGGG + Intergenic
1162825544 19:13249320-13249342 GAGGAAAAAGGTCCATTAGTAGG + Intronic
1164719951 19:30424762-30424784 CTGGGGAAAGACCCATTAGTGGG + Intronic
1166285437 19:41823665-41823687 TTGGATAAATGCCCAGTAGTGGG - Intergenic
1166288901 19:41849159-41849181 GTGGTGAAGGGCCCATGAGTGGG - Exonic
925441605 2:3891878-3891900 GTGGGTAGATGCCCAGTAGTGGG + Intergenic
925616397 2:5748149-5748171 GAAGATAAAGGCCCATGAGTGGG - Intergenic
927401278 2:22714556-22714578 TTGGCTAAATACCCACTAGTGGG - Intergenic
928188370 2:29136823-29136845 GTTGACAAAGCCCCATTAGTGGG + Intronic
928215152 2:29355141-29355163 GTAGCTAAATGCTCATGAGTCGG - Intronic
928907767 2:36385576-36385598 GTGGTTAAAGGACCATCAGCAGG + Intronic
932717919 2:74116345-74116367 GGGGATAAATGCCCAGTAGTGGG - Intergenic
935703134 2:105830580-105830602 GTGGGTAAATGCCCAGCAGTGGG + Intronic
935764640 2:106353854-106353876 GTGGATAAATACCCAGTAGTGGG + Intergenic
937941103 2:127286739-127286761 GTGGCTCAAGACCCAGGAGTGGG - Exonic
945683283 2:212938704-212938726 TTGGCTTAGGGCCCATTTGTAGG - Intergenic
946447074 2:219749090-219749112 GTGGCAAAAGGCCCATTCAAGGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1174375744 20:50125337-50125359 GTGGCCCCAGGCCCATTGGTGGG - Intronic
1175292555 20:57886576-57886598 CTGGGTAAATGCCCAGTAGTGGG + Intergenic
1176813549 21:13572173-13572195 TTGGATAAATGCCCAGTAGTGGG - Intergenic
1179443750 21:41416602-41416624 CTGGCTAAATACCCACTAGTGGG - Intergenic
1185121157 22:48971896-48971918 TTGGGTAAATGCCCAGTAGTGGG - Intergenic
950717029 3:14855359-14855381 TTGGATAAATGCCCAGTAGTAGG + Intronic
953081824 3:39627902-39627924 TTGGATAAATGCCCAGTAGTGGG - Intergenic
956069105 3:65428998-65429020 GTGGCTAAAGCACCATCAGATGG + Intronic
959028141 3:101266189-101266211 TTGGATAAATGCCCAGTAGTGGG - Intronic
960088595 3:113616295-113616317 GTGGCTAAAGGCCCATTAGTGGG + Intronic
961070669 3:123921834-123921856 GTGGCTCAGGGGCCATCAGTTGG + Intronic
961902712 3:130228917-130228939 TTGGGTAAATGCCCATTAGTGGG + Intergenic
964854721 3:161134335-161134357 TTGGCTAAATACCCAGTAGTGGG + Intronic
966265380 3:178035268-178035290 TTGGTTAAATGCCCAGTAGTAGG + Intergenic
966459249 3:180157143-180157165 TTGGATAAATGCCCAGTAGTGGG + Intergenic
969452781 4:7284337-7284359 GTGGCTCAAGGCCAAGCAGTGGG - Intronic
970042831 4:11815838-11815860 GTGGCTAAAGACAGATTAATCGG - Intergenic
972040973 4:34598345-34598367 GTGGATAGAGGCCCATTTTTAGG + Intergenic
973541693 4:51941561-51941583 CTGGCCAAAGGCTCATGAGTGGG - Intergenic
977340494 4:95751391-95751413 GTGGCTAATGGCTTATTGGTGGG - Intergenic
977813968 4:101391918-101391940 GTGGGTAAATGCCCAACAGTGGG - Intergenic
978106939 4:104914490-104914512 TTGGATAAATGCCCAGTAGTGGG - Intergenic
980664774 4:135917188-135917210 TTGGATAAATGCCCAGTAGTTGG - Intergenic
981956565 4:150481341-150481363 GTGGATAGATGCCCAGTAGTGGG + Intronic
982318180 4:154052359-154052381 TTGGATAAATGCCCAATAGTGGG + Intergenic
983051090 4:163048523-163048545 TTGGCTAAAGCCCCAAAAGTAGG + Intergenic
983418879 4:167493131-167493153 TTGGATAAATGCCCAGTAGTAGG - Intergenic
986467067 5:8036332-8036354 ATGCCTAAAGTCCCATTATTGGG - Intergenic
987151960 5:15051049-15051071 TTGGATAAATGCCCAGTAGTGGG + Intergenic
987161345 5:15146872-15146894 TTGGATAAATGCCCAGTAGTGGG - Intergenic
989297309 5:39844764-39844786 TTGGATAAATGCCCAGTAGTGGG + Intergenic
991158934 5:63472302-63472324 GTGGATTATGACCCATTAGTGGG - Intergenic
991937974 5:71821106-71821128 TTGGCTAAATGCCCAATAGTGGG + Intergenic
994388642 5:99163178-99163200 TTGGGTAGAGGCCCAGTAGTAGG - Intergenic
996444568 5:123530613-123530635 GTGGATCAGGGCCCATTAATGGG - Intronic
996485545 5:124029577-124029599 GTGGGTGAAGGCCAATGAGTTGG - Intergenic
997580383 5:135013154-135013176 GTGGGTGCAGCCCCATTAGTAGG + Intergenic
999251731 5:150186467-150186489 GGGGCTAAACACCCATTGGTAGG - Intergenic
999663080 5:153885828-153885850 GTGGGTCATGGCCCATTAGTGGG - Intergenic
1000965999 5:167657486-167657508 TTGGATAAATGCCCAGTAGTGGG + Intronic
1005405032 6:25477567-25477589 GTGGGTGAAGACCCATTAGCTGG + Intronic
1005593606 6:27354514-27354536 TTGGATAAATGCCCACTAGTGGG - Intergenic
1006154545 6:32007191-32007213 GTGGCAACAGGCCCATAACTGGG - Intergenic
1006160856 6:32039927-32039949 GTGGCAACAGGCCCATAACTGGG - Intronic
1007457576 6:41992096-41992118 TTGGATAAATGCCCAGTAGTGGG + Intronic
1008326222 6:50185216-50185238 GGGGATAAAGGCTCATGAGTAGG - Intergenic
1008672464 6:53785443-53785465 TTGGATAAAGGCCCAGTAGTGGG - Intergenic
1009788631 6:68370921-68370943 TTGGCCAAAGGTCAATTAGTGGG - Intergenic
1014073385 6:117208846-117208868 TTGGGTAAATGCCTATTAGTGGG + Intergenic
1014500520 6:122183371-122183393 GTGACTCAAGCCCCCTTAGTGGG + Intergenic
1018660653 6:166083666-166083688 TTGGGTAAATGCCCAGTAGTGGG - Intergenic
1019847346 7:3518784-3518806 CTGGATAAATGCCCAGTAGTGGG - Intronic
1028039417 7:86030357-86030379 TTGGATAAATGCCCAGTAGTGGG - Intergenic
1028041568 7:86060254-86060276 TTGGATAAATGCCCATTAGTGGG + Intergenic
1028444343 7:90903218-90903240 TTGGATAAACACCCATTAGTAGG - Intronic
1031071142 7:117163280-117163302 TTGGATAAATGCCCAGTAGTGGG + Intronic
1031105843 7:117541671-117541693 TTGGATTAAGGCACATTAGTGGG + Intronic
1033995999 7:147348632-147348654 TTGGATAAACGCCCATTAGTAGG - Intronic
1034584083 7:152073645-152073667 TTGGATAAATGCCCAGTAGTGGG + Intronic
1035982443 8:4388158-4388180 CTGGGTAGATGCCCATTAGTGGG - Intronic
1037620031 8:20555582-20555604 GGGTCAAAAGCCCCATTAGTTGG + Intergenic
1041758694 8:61340685-61340707 TTGGCTATATGCCCAGTAGTAGG + Intronic
1047068067 8:121309578-121309600 TTGGATATATGCCCATTAGTGGG + Intergenic
1048644559 8:136405116-136405138 TTGGATAAAGGCTCAGTAGTGGG - Intergenic
1051373846 9:16383855-16383877 TTGGATAAATGCCCACTAGTGGG + Intergenic
1051692397 9:19729357-19729379 TTGGATAAATGCCCAATAGTGGG - Intronic
1053416548 9:37950389-37950411 GTGCCTATAGGCCCACTACTTGG - Intronic
1055314645 9:75022085-75022107 GTGTCTAAATGCCCAGTAGTTGG - Intronic
1056043537 9:82692455-82692477 GTGGATAAATGCCCCATAGTGGG + Intergenic
1058204738 9:102089737-102089759 TTGGATAAATGCCCAGTAGTGGG + Intergenic
1188610708 X:32093360-32093382 TTGGATAAATGCCCAGTAGTGGG + Intronic
1193162950 X:78248618-78248640 TTGGGTAAATGCCCAGTAGTGGG + Intergenic
1194232861 X:91346163-91346185 TTGGATAAATGCTCATTAGTGGG + Intergenic
1197078366 X:122379848-122379870 GTGGGTAAATACCCAGTAGTGGG + Intergenic
1197308902 X:124879621-124879643 GTGGATAAATGCCCAAGAGTGGG + Intronic
1199709819 X:150461138-150461160 GTGGCTCCAGGCCCATTTGGCGG - Intronic