ID: 960090873

View in Genome Browser
Species Human (GRCh38)
Location 3:113636926-113636948
Sequence AACAGCCCTGTGAAGTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960090871_960090873 -6 Left 960090871 3:113636909-113636931 CCTCATTTGTCCTTAACAACAGC No data
Right 960090873 3:113636926-113636948 AACAGCCCTGTGAAGTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960090873 Original CRISPR AACAGCCCTGTGAAGTATGC AGG Intergenic
No off target data available for this crispr