ID: 960092330

View in Genome Browser
Species Human (GRCh38)
Location 3:113653647-113653669
Sequence TCTATGCTTTAGCAGGTCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960092326_960092330 -3 Left 960092326 3:113653627-113653649 CCCTACCTATATCAAGTTCTTCT 0: 1
1: 0
2: 0
3: 14
4: 171
Right 960092330 3:113653647-113653669 TCTATGCTTTAGCAGGTCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 141
960092328_960092330 -8 Left 960092328 3:113653632-113653654 CCTATATCAAGTTCTTCTATGCT 0: 1
1: 0
2: 0
3: 14
4: 165
Right 960092330 3:113653647-113653669 TCTATGCTTTAGCAGGTCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 141
960092327_960092330 -4 Left 960092327 3:113653628-113653650 CCTACCTATATCAAGTTCTTCTA 0: 1
1: 0
2: 1
3: 9
4: 178
Right 960092330 3:113653647-113653669 TCTATGCTTTAGCAGGTCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 141
960092325_960092330 28 Left 960092325 3:113653596-113653618 CCATCTATTAAAAAAAAAAAAAA 0: 33
1: 849
2: 7595
3: 126697
4: 118372
Right 960092330 3:113653647-113653669 TCTATGCTTTAGCAGGTCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960092330 Original CRISPR TCTATGCTTTAGCAGGTCTC AGG Exonic
900805281 1:4763523-4763545 ACCATGCTTTACCAGCTCTCTGG - Intronic
902092406 1:13913975-13913997 TCTCTGATTGAGCAGGTCTTGGG - Intergenic
903595221 1:24488989-24489011 TCTATGCTGTAGCATGGGTCAGG - Intergenic
904913976 1:33956472-33956494 TCCATGCTGTAGCAGGTGTCAGG + Intronic
905169701 1:36102194-36102216 TCTGTGTTGTAGCAGGTGTCAGG - Intronic
907081932 1:51631639-51631661 TCTATGCCTTAGCAGGATTCAGG + Intronic
911659023 1:100478910-100478932 TCTCTGATTCAGCAGGTCTGAGG + Intronic
912137751 1:106682285-106682307 TCTGTGCATTAGCAGGACGCAGG + Intergenic
912278307 1:108284844-108284866 TGTTTCCTTTAGCAGATCTCAGG + Intergenic
912289919 1:108409513-108409535 TGTTTCCTTTAGCAGATCTCAGG - Intronic
914948330 1:152086637-152086659 TCTTTGTTTTAGCTGGTGTCTGG + Exonic
918123558 1:181560923-181560945 TCCATGCTGTAGCATGTGTCAGG - Intronic
1063686427 10:8241160-8241182 ACTATTCATTAGCAGCTCTCAGG + Intergenic
1065388741 10:25160119-25160141 TCTGTGCTCTGGCAGGCCTCTGG - Intergenic
1065519976 10:26562405-26562427 TCGATGTTTCAGCATGTCTCTGG - Exonic
1066422724 10:35277420-35277442 TCTCGGCCTCAGCAGGTCTCTGG - Intronic
1067179829 10:43976495-43976517 TCTATGTTGTAGCATGTGTCAGG + Intergenic
1067822570 10:49542566-49542588 TCTGCGCCTTAGCAGGACTCAGG + Intergenic
1071073906 10:81728873-81728895 TCTGTGCCTTAGCAGGGTTCAGG + Intergenic
1073848486 10:107587222-107587244 TCTGTGCTTTAGCAGGACTCAGG - Intergenic
1075956412 10:126526873-126526895 TCTATGCTATAACACGTATCAGG + Intronic
1078772295 11:14361923-14361945 TCCATGCTGTAGCATGTATCAGG - Intronic
1079948106 11:26768417-26768439 TCTGTGATTTAGCAGGACACAGG - Intergenic
1079983681 11:27178194-27178216 TCTAAGCCTTCCCAGGTCTCTGG + Intergenic
1080127535 11:28754554-28754576 ACTAATCTTTAGCATGTCTCAGG + Intergenic
1080618343 11:33965541-33965563 TCTATGTTGTAGCATGTATCAGG - Intergenic
1088970488 11:114770642-114770664 TCTCAGCTTTACCAGATCTCTGG + Intergenic
1089581413 11:119483898-119483920 TTTCTGCTTTACCAGGACTCAGG + Intergenic
1093210677 12:16304570-16304592 ACTCTGCTTTTGGAGGTCTCAGG - Intergenic
1093966115 12:25328052-25328074 TCTATGCTAGAGCAGGAGTCTGG - Intergenic
1095498690 12:42812748-42812770 TCTCTGCTTTATCAGCTCACAGG + Intergenic
1097603084 12:61719279-61719301 TCTATGCCTTAGCAGAATTCAGG - Intronic
1100234625 12:92648359-92648381 TCTTTTCTTCAGCAGGTCTGAGG + Intergenic
1106314553 13:28581852-28581874 TTTCTGATTTAGCAGGTCTGAGG - Intergenic
1106842162 13:33695555-33695577 TCTTTGGTCTAGCAGGTATCAGG + Intergenic
1111482436 13:88848661-88848683 TCTTTTCTTTACCTGGTCTCAGG - Intergenic
1112417980 13:99219872-99219894 TCTATGTTGTAGCATGTATCAGG + Intronic
1115210265 14:30960453-30960475 TCTATGCTTTAGTTTGTTTCTGG - Intronic
1117278486 14:54213675-54213697 TCTATGAATGAGCAGGTCTTAGG - Intergenic
1118485766 14:66213224-66213246 TCTGAGCCTTAGCAGGACTCAGG + Intergenic
1121838308 14:97111922-97111944 TCTCTGATTCAGTAGGTCTCAGG - Intergenic
1122821404 14:104347273-104347295 TCTATTCTTTTGAAGCTCTCTGG - Intergenic
1125170252 15:36758960-36758982 TCTTTGCTTTTGCATTTCTCTGG + Intronic
1125706652 15:41743162-41743184 TCTAGGCCTTACCTGGTCTCTGG - Exonic
1126694997 15:51318373-51318395 TCTGTGCTTTGGCAGGGATCAGG - Intronic
1127813457 15:62584906-62584928 TCTCTGCTTTACCTGGTCTTAGG + Intronic
1130665319 15:85864477-85864499 TCTCTGATTCAGCAGGTCCCAGG - Intergenic
1131008684 15:88999496-88999518 TCTGTGCCTTAGCAGGACTCAGG + Intergenic
1131374364 15:91911410-91911432 TCTTTGATTTTGCAGGTCTGGGG - Intronic
1137042347 16:35624711-35624733 TCTGTGCCTTGGCAGGACTCAGG + Intergenic
1138933221 16:61687438-61687460 TCTGTTCTTTAGCAGCACTCTGG + Intronic
1141514017 16:84531079-84531101 ACTCTGATTTAGCAGGTCCCAGG - Intronic
1141879738 16:86849932-86849954 TCTCTGATTCAGCAGGTCTAGGG - Intergenic
1143354955 17:6320526-6320548 TCTCTGCTTTAGAAGGTCAAAGG - Intergenic
1145065046 17:19756302-19756324 TCTATGCTCCAGCAGGTCTAGGG - Intergenic
1146097839 17:29949555-29949577 TGGATTTTTTAGCAGGTCTCTGG - Intronic
1150998739 17:70349632-70349654 TCTCTGATTTAGTAGGTCTGTGG + Intergenic
1152009558 17:77703438-77703460 TCTGTGTTTTAGCATGTGTCAGG + Intergenic
1152825747 17:82463678-82463700 TTTATGTTTTAGCAGATGTCGGG + Intronic
1154212101 18:12388539-12388561 TCCATGCTATAGCATGTATCAGG - Intergenic
1155700215 18:28734132-28734154 TCTGCACTTTAGCAGGACTCAGG - Intergenic
1155802286 18:30123008-30123030 ATAATGCTTTACCAGGTCTCTGG - Intergenic
1156469065 18:37366244-37366266 TCTGTGCTATAGCAGCTTTCTGG - Intronic
1157305242 18:46512123-46512145 TCTATGTTTTAGCAGAATTCAGG - Intronic
1160147316 18:76375853-76375875 TCCATCCTTTACCTGGTCTCTGG - Intronic
1166494693 19:43291009-43291031 TAAATGCTTTAGCACGTATCTGG - Intergenic
925408509 2:3625272-3625294 TCCATGCTCAAGCAGGCCTCAGG + Intronic
930668171 2:54120429-54120451 TTGATGCTTTACCAGCTCTCAGG + Intronic
934014330 2:87862933-87862955 TTTTTGCTATAGCAGGTCACTGG + Intergenic
938412453 2:131076103-131076125 ACACTGCTTTAGCTGGTCTCGGG + Intronic
940970474 2:159891528-159891550 TCCATGATTTAGCAGCCCTCAGG + Intronic
942015825 2:171814045-171814067 GCTATGCTTTAGAATTTCTCAGG + Intronic
943263558 2:185697100-185697122 CATATGCTTTAGCAGATCTATGG + Intergenic
945924422 2:215789000-215789022 TTTATTCTTTAGCAGGCTTCTGG - Intergenic
947735900 2:232455325-232455347 TCCATGTTGTAGCAGGTGTCAGG + Intergenic
947991433 2:234490795-234490817 TCCTTGATTTAGCAGCTCTCTGG - Intergenic
1169351030 20:4868040-4868062 TTTCTGCTTCAGCAGGTCTGGGG - Intronic
1169642604 20:7771287-7771309 CCTATTCTTTACCAGCTCTCTGG - Intergenic
1170312122 20:15003760-15003782 TCTATACCTTAGCAGGCCTCAGG - Intronic
1171135087 20:22688476-22688498 TCTCTGATTTAGCAGGTCTGGGG - Intergenic
1173161551 20:40656405-40656427 TTTATGCTGTTGCAGCTCTCTGG - Intergenic
1174774991 20:53335188-53335210 TTTCTGGTTTAGTAGGTCTCTGG - Intronic
1174955194 20:55090165-55090187 TCTGTGTTTTAGCAAGTCACAGG + Intergenic
1174963635 20:55185821-55185843 GCAATGCTTTAGCAGGCCACTGG - Intergenic
1175728325 20:61334444-61334466 TTTATCCATTAGCCGGTCTCAGG - Intronic
1178496015 21:33086817-33086839 TCTATGTTGTAGCATGTGTCAGG - Intergenic
1179254950 21:39707475-39707497 TCTGTACCTTAGCAGGTCTCAGG + Intergenic
1180596294 22:16975649-16975671 TCTGTCCCTTAGCAGGGCTCGGG - Intronic
1181726336 22:24813663-24813685 TTGATGCTTTTTCAGGTCTCTGG + Intronic
1182087576 22:27571877-27571899 TCTCTGATTTAGCAGGTTCCTGG - Intergenic
1182635881 22:31726620-31726642 TCTCTGCTTTTCCAGTTCTCAGG + Intronic
955549858 3:60072015-60072037 TTTATGATTTACCAAGTCTCAGG + Intronic
960092330 3:113653647-113653669 TCTATGCTTTAGCAGGTCTCAGG + Exonic
960322641 3:116255311-116255333 TGTATGATTTTGCAGCTCTCTGG - Intronic
961137047 3:124520952-124520974 TCCATGCTTTTCCAGGTCACTGG + Intronic
961864870 3:129946271-129946293 TCTATGGTTTCCCAGCTCTCAGG - Intergenic
962035204 3:131644105-131644127 TTTCTGCTTTAGTAGGTCTTAGG + Intronic
962268458 3:133960387-133960409 TCTGTGCTGTAGCATGTGTCAGG - Intronic
962748101 3:138412467-138412489 TTTATGATTTAGCAGGTCTGGGG + Intergenic
965187349 3:165482358-165482380 TCTTTTCTTTTGCAGCTCTCTGG - Intergenic
966006202 3:175015483-175015505 TTTATGCTTTATCAGGTCTCAGG - Intronic
967245027 3:187477868-187477890 TCTGTGCCTTAGCAGGACTCAGG + Intergenic
967716701 3:192770985-192771007 TCTCTGCTTTGGCAGCTCTGAGG - Intergenic
970750605 4:19354617-19354639 TCTATGATTTATAAGGTCACTGG + Intergenic
972282570 4:37617201-37617223 ACTCTGATTTAGTAGGTCTCAGG - Intronic
977047650 4:92088053-92088075 TCTGCACCTTAGCAGGTCTCAGG - Intergenic
981679320 4:147376929-147376951 GCAATGCTTTACCAGTTCTCTGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983781266 4:171673480-171673502 TCTATGCCTTAGCAGGACTAAGG + Intergenic
984041871 4:174744730-174744752 TCTTTGCTTTATCATGTTTCTGG - Intronic
985149159 4:186928693-186928715 TCTGTGTTTTTCCAGGTCTCTGG + Intergenic
985359914 4:189162568-189162590 TCTGTGCCTTAGCAGGCCTCAGG + Intergenic
985906088 5:2838211-2838233 TTTATAATTTAGCTGGTCTCAGG - Intergenic
986658732 5:10040417-10040439 TCCATGCTGTAGCACGTGTCAGG + Intergenic
988333157 5:29869403-29869425 TTAATGCTTTACCAGTTCTCTGG + Intergenic
994408627 5:99378337-99378359 TCTATGCAAAAGTAGGTCTCAGG - Intergenic
997380519 5:133433214-133433236 ATTAAGCTTTTGCAGGTCTCTGG - Intronic
997821761 5:137072389-137072411 TCTCTGTTTTAGCAGGTCGAGGG - Intronic
999742756 5:154569001-154569023 ACTATGCTATAGCACCTCTCAGG - Intergenic
1002053200 5:176583665-176583687 TCTAAGCTTCTGCAGGTCCCCGG + Intronic
1002909017 6:1474025-1474047 TCCATGCTGTAGCAGGTGTCAGG + Intergenic
1003880668 6:10477041-10477063 GCAATGCTGTGGCAGGTCTCAGG - Intergenic
1004929426 6:20447477-20447499 TCTAAACTTGAGCAGGTCTTGGG + Intronic
1006874637 6:37284761-37284783 ATTCTGATTTAGCAGGTCTCAGG + Intronic
1010568351 6:77446453-77446475 TCTGTGCTTTAGCATTTCTTGGG + Intergenic
1016745464 6:147574587-147574609 TCTATTCTTTACCCAGTCTCAGG - Intronic
1017347875 6:153405688-153405710 CCTGTGCCTTAGCAGGACTCAGG + Intergenic
1018138881 6:160806994-160807016 CCTGTGCCTTAGCAGGACTCAGG - Intergenic
1024176701 7:46847614-46847636 TCTATGATTTTGCAGGCCACTGG - Intergenic
1024307790 7:47942798-47942820 TTTCTGCTTTAGGAGGTCTGGGG - Intronic
1026227315 7:68453665-68453687 TCTGAGCCTTAGCAGGACTCAGG + Intergenic
1026468798 7:70677045-70677067 TCGCTGATTTAGGAGGTCTCTGG - Intronic
1027571468 7:79873279-79873301 TTTCTGATTTAGCAGGTCTCAGG + Intergenic
1028938478 7:96492382-96492404 TCCATGTTTTAGCATGTATCAGG + Intronic
1029977813 7:104850702-104850724 TTTCTGATTTAGCAGGTCTGGGG - Intronic
1030412147 7:109194070-109194092 TCTATGCTGTAGCATGTATCAGG + Intergenic
1039906019 8:41787050-41787072 TCTGTGCTTTGGGACGTCTCTGG - Intronic
1040523086 8:48194318-48194340 TCTGTGCTGTGGCAGGTTTCAGG + Intergenic
1042755727 8:72208415-72208437 TCTAGGCTTTGGCAGGGTTCAGG + Intergenic
1043540139 8:81253103-81253125 TCTTTGCTTCAGCAGTTCTGCGG - Intergenic
1046104375 8:109648528-109648550 TCTATGCTTTTTCAGTTATCTGG - Intronic
1048232467 8:132657439-132657461 TCTCTGCTCTACCAGCTCTCAGG - Intronic
1049505601 8:142994938-142994960 TCTGTGCCTTACCAGGACTCAGG + Intergenic
1053086344 9:35226213-35226235 TCTGTGCTTTAACAGCCCTCAGG + Intronic
1055998878 9:82193317-82193339 TCTGTGCCTTAGCAGCACTCAGG - Intergenic
1057544027 9:96002877-96002899 TCCTTTCTTTTGCAGGTCTCTGG + Intronic
1185955616 X:4485340-4485362 TCTGTGCCTTAGCAGGAATCAGG + Intergenic
1186628059 X:11316397-11316419 TTTATTCTTTAGCAGTTCACAGG + Intronic
1186771386 X:12821291-12821313 TCCATGCTGTAGCATGTGTCAGG - Intronic
1186779474 X:12898505-12898527 TGTCTGATTTAGCAGGTCTGAGG - Intergenic
1186970394 X:14835545-14835567 TTTCTGATTTAGCAGGTTTCGGG + Intergenic
1187581349 X:20610685-20610707 GCTCTGATTTAGCAGGTCTAGGG - Intergenic
1190784612 X:53632942-53632964 TCCATTCTTTAGCTGGTTTCTGG - Intronic
1190931537 X:54952773-54952795 TCTGTGCTTTGGGAGCTCTCTGG + Intronic
1192365319 X:70467607-70467629 TCTATGTTTTACCAGGTCAATGG - Intronic
1193848506 X:86505589-86505611 TCTATGTTGTAGCATGTGTCAGG + Intronic
1199130143 X:144175540-144175562 TTTTTGCTATAGCAGGTCACTGG - Intergenic
1199180130 X:144844634-144844656 TCTATGCTATAGCAGATCTTTGG + Intergenic
1199933791 X:152551661-152551683 TCTCTGATTCAGCAGGTCTGGGG + Intergenic
1202025576 Y:20519226-20519248 TCTATGCTTCTGCAGTTCTCAGG - Intergenic