ID: 960094072

View in Genome Browser
Species Human (GRCh38)
Location 3:113671236-113671258
Sequence TGGGCAAATGAGGCCTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960094070_960094072 -8 Left 960094070 3:113671221-113671243 CCTCTTTATGGCAAATGGGCAAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 960094072 3:113671236-113671258 TGGGCAAATGAGGCCTTTCTAGG 0: 1
1: 0
2: 0
3: 26
4: 188
960094066_960094072 21 Left 960094066 3:113671192-113671214 CCACTAACAAACAAGTTATTAGA 0: 1
1: 0
2: 0
3: 11
4: 171
Right 960094072 3:113671236-113671258 TGGGCAAATGAGGCCTTTCTAGG 0: 1
1: 0
2: 0
3: 26
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960094072 Original CRISPR TGGGCAAATGAGGCCTTTCT AGG Intronic
900703278 1:4061048-4061070 TGGGCATATGTGGCCTTCCATGG + Intergenic
902807943 1:18872487-18872509 GGGGAAAAGGAGGCCATTCTGGG - Exonic
903053242 1:20617180-20617202 TGGGAAAATGATAACTTTCTGGG - Intronic
903068114 1:20712131-20712153 CGGGTAACTGAGGCCTTTCTAGG + Intronic
903288311 1:22290925-22290947 TGGGCAACTGAGGGCTTTGTTGG + Intergenic
904497889 1:30897590-30897612 AGGGCCAATCAGGCCTTGCTGGG - Intronic
905891944 1:41523309-41523331 TGGGCCAATGTGCCCTCTCTGGG + Intronic
906230110 1:44155287-44155309 TCGGCAAATGAAGACTTTCCTGG - Intergenic
906294816 1:44643114-44643136 AGGGCAAATGAGGACTGTCAGGG + Intronic
907251768 1:53144198-53144220 TTGGAAAATGAGGCATTTGTTGG - Intergenic
909557993 1:76976159-76976181 TGGGCAAATGAGGGACTTCCAGG + Intronic
909922629 1:81400954-81400976 TGAGAAAATGTTGCCTTTCTTGG - Intronic
910537598 1:88316775-88316797 TGGGCAAATAACACTTTTCTTGG - Intergenic
913128032 1:115811429-115811451 TGCGGAAATCAGGCCTTTCTTGG + Intergenic
915444923 1:155969157-155969179 TGGGCAGATGAGGGCTTCCTTGG + Exonic
919190661 1:194214021-194214043 AGGGCAAAAAAGGTCTTTCTGGG + Intergenic
922331893 1:224584700-224584722 TGGAAAAATGAAGCATTTCTTGG + Intronic
924109794 1:240687436-240687458 TGGCCGAATGAGGCTTTTTTTGG - Intergenic
924203688 1:241688297-241688319 TGGGCACAAGGGGACTTTCTTGG + Intronic
1063758099 10:9039207-9039229 TGTGGCAATGAGGCCTTTCTGGG - Intergenic
1064459932 10:15524515-15524537 TCGGCAAGAGAGGTCTTTCTGGG + Intronic
1067453159 10:46394815-46394837 TGGCCACATGAGGCCTGTTTTGG - Intergenic
1067584076 10:47464951-47464973 TGGCCACATGAGGCCTGTTTTGG + Intronic
1068057584 10:52030069-52030091 TGGGCAAATGAAGCCTCTGATGG - Intronic
1069834731 10:71301335-71301357 TGGGCAAAGGAGGACTTGCCTGG + Exonic
1069985001 10:72276975-72276997 TGAGCAAACAAGGCCTGTCTGGG - Intergenic
1069999296 10:72364419-72364441 TGGGCCAATGAGCCCTTGCACGG + Intergenic
1071131983 10:82405154-82405176 TGGTCGAACGAGGCCTCTCTTGG + Intronic
1071339031 10:84625644-84625666 TGGGCAAAGAAGCCCTTTGTAGG - Intergenic
1071479759 10:86056356-86056378 TGGACAAATGAGCACTTCCTTGG - Intronic
1071925499 10:90403750-90403772 TGCTCAAATGAGGCCTTTCCTGG - Intergenic
1072124781 10:92436010-92436032 TGGGCACCTGAGGCCTTCCAGGG - Intergenic
1072800811 10:98391099-98391121 TGGACATCTGAGGCCTTTCATGG - Intronic
1073725507 10:106225870-106225892 TGGTCATGTGAGGCCTCTCTGGG + Intergenic
1076673700 10:132136833-132136855 TGGGGAAATGAGGCCTATGTGGG - Intronic
1076906084 10:133361825-133361847 TGGGAAAATGAAAGCTTTCTTGG + Intergenic
1077009063 11:372080-372102 GTGGCACATGAGGCCTGTCTCGG - Intronic
1077132206 11:978747-978769 TGAGCAAATGACACCTTTCTTGG - Intronic
1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG + Exonic
1078400178 11:11019413-11019435 TGGGCATTAGAGGTCTTTCTAGG + Intergenic
1080034398 11:27697610-27697632 TAGGCAAATGATGACTTTCTTGG + Intronic
1081407185 11:42711247-42711269 TGGGGCAAAGAAGCCTTTCTTGG - Intergenic
1082659380 11:55891681-55891703 TGCGAAAAAGAGGGCTTTCTGGG - Exonic
1084913370 11:72409142-72409164 TGGGCATAGTGGGCCTTTCTGGG + Intronic
1084961237 11:72717881-72717903 TGAGCAAATGAGGCCATGCCAGG + Intronic
1086697537 11:89862942-89862964 TGCGAAAAAGAGGGCTTTCTGGG - Intergenic
1086708621 11:89981546-89981568 TGCGAAAAAGAGGGCTTTCTGGG + Intergenic
1087851851 11:103040310-103040332 AGGGCAAGTGAAGACTTTCTCGG + Intergenic
1089085355 11:115812519-115812541 GGGTGAAGTGAGGCCTTTCTTGG - Intergenic
1089129200 11:116199098-116199120 GGGGCATCTGAGGCCTTCCTGGG + Intergenic
1090533624 11:127616855-127616877 TGGGCAAAAGGGACCTTACTGGG - Intergenic
1095496644 12:42791379-42791401 TGGGATACTGAGGCCTTTCAGGG + Intergenic
1095596536 12:43965491-43965513 TGGGCAGATGAGAACTTTCTGGG - Intronic
1097212277 12:57381261-57381283 TGGGCAAATGAGGCCGGGCACGG + Intronic
1100917605 12:99443643-99443665 AGGGAAAATGATGCCATTCTGGG + Intronic
1101108126 12:101459891-101459913 TGGCCAAAGGAGCCCTGTCTTGG + Intergenic
1101931532 12:109018191-109018213 TGTGCAAATCAGACTTTTCTAGG - Intronic
1102617770 12:114169528-114169550 GGGGAAACTGAGGCCTGTCTAGG - Intergenic
1104891030 12:132140270-132140292 GGGGCAGCTCAGGCCTTTCTGGG + Intronic
1105758656 13:23493222-23493244 TGAGCACATGATGCCTCTCTCGG + Intergenic
1111379360 13:87426606-87426628 TGGGCACAGGAGGTCTTTCAGGG - Intergenic
1113713454 13:112486853-112486875 TCTGCAGATGAGGCCTTTCCAGG - Intronic
1115173443 14:30534569-30534591 TGGGAAAATGGGGTCTTCCTAGG - Intergenic
1115640832 14:35334624-35334646 TTGGGAAATGAAGCCCTTCTGGG + Intergenic
1117845016 14:59901874-59901896 AGGTGAAATGAGGCATTTCTAGG - Intergenic
1118058349 14:62106871-62106893 TGGAGATCTGAGGCCTTTCTTGG + Exonic
1118741684 14:68744109-68744131 TGGGTAAATGATACTTTTCTTGG - Intergenic
1119112664 14:71989572-71989594 AGGGGTAAAGAGGCCTTTCTAGG + Intronic
1121266217 14:92604179-92604201 TGGGGAAGTGAGGCCCTTCAGGG - Intronic
1122182978 14:99969371-99969393 AGGGCAGAAAAGGCCTTTCTCGG + Intergenic
1122663806 14:103315450-103315472 TTGTGAAATGAGGCCTTTCCTGG + Intergenic
1126068952 15:44849059-44849081 TGGCCAAATGAGGGCTGTCTTGG - Intergenic
1126089868 15:45041714-45041736 TGGCCAAACGAGGGCTGTCTTGG + Intronic
1128056245 15:64702366-64702388 TGGGAAAATGGGGCCTAACTGGG + Intronic
1129614510 15:77087578-77087600 TGGGCATTTAAGGCCTTTCTGGG + Intergenic
1130410408 15:83643098-83643120 TGGGCCAAGGGGGCCTCTCTTGG + Intergenic
1130556802 15:84928479-84928501 AGGGCAAGAGAGACCTTTCTGGG - Intronic
1132365903 15:101256532-101256554 TTGGCAATTAAGGCCTCTCTAGG + Intergenic
1135167959 16:20157098-20157120 GTGGCAAATGAGGCATTTGTTGG - Intergenic
1135500464 16:22991529-22991551 TGGGCATATCAAGTCTTTCTTGG - Intergenic
1135530013 16:23245265-23245287 TGGCCAACTGAGGCGTTTCTGGG - Intergenic
1137504160 16:49036545-49036567 TGGCCCAATGATGCCTATCTTGG + Intergenic
1137730231 16:50684144-50684166 TGGGGAAAGGAGACGTTTCTTGG + Intergenic
1139914948 16:70422159-70422181 TGGGCAAATCACACCTCTCTGGG + Intronic
1140688335 16:77455174-77455196 TGGACAAATGAGGTGTTTCTAGG + Intergenic
1141884847 16:86884457-86884479 TTGCCAAATGAGGCATTACTGGG + Intergenic
1142672629 17:1494135-1494157 TGGGCAAGTGAGGGCTTTGGAGG + Intergenic
1142781142 17:2182151-2182173 TGGAGAACTGAGTCCTTTCTTGG + Intronic
1142995491 17:3757534-3757556 TGGGGAAATGAGCCCTCTCTGGG + Intronic
1143429546 17:6870782-6870804 TGGGCAAAAGAGGCCGTGCACGG - Intergenic
1143779582 17:9222202-9222224 TGGGCAGATGTGGACTTTCGTGG - Intronic
1143888257 17:10083014-10083036 GGGGCAAAGGAGAGCTTTCTGGG + Intronic
1144718524 17:17451184-17451206 TGGGCAATTTAGACCTTCCTAGG + Intergenic
1146013171 17:29212001-29212023 AGGGCAGATGAGGCCTGGCTTGG + Intergenic
1147051119 17:37795871-37795893 TTGTCAAATGAGGCATTTCCAGG - Intergenic
1148288856 17:46422972-46422994 GGGGGAAATGAGGTCTCTCTGGG - Intergenic
1148311025 17:46640549-46640571 GGGGGAAATGAGGTCTCTCTGGG - Intronic
1150299097 17:64033715-64033737 GGGGCAAAAGAGGACCTTCTGGG + Intergenic
1152512834 17:80802024-80802046 TGAGCTAAGGAGGCCTTGCTGGG - Intronic
1154092997 18:11382098-11382120 TGGGGAAACAAGGCCTTCCTGGG + Intergenic
1155027962 18:21959384-21959406 TTGGCAAATAGGGCCTGTCTAGG - Intergenic
1160721102 19:597208-597230 TGGGCTGAGGAGTCCTTTCTGGG + Intronic
1161196370 19:2988756-2988778 GGGGCAAAGAAGGCTTTTCTGGG + Intronic
1161363867 19:3867761-3867783 TGGGGAACTGAGGCCTGACTGGG - Intronic
1163375060 19:16925057-16925079 TGGGCAAAAGAGGCCATTCAGGG - Intronic
1165995791 19:39843036-39843058 TGGCCAAAGTAGGCCCTTCTGGG - Intronic
1168504029 19:56917788-56917810 TGGGCAAATTTGGCCATTCAGGG + Intergenic
926321776 2:11753395-11753417 TGGGAAATTGGGGACTTTCTTGG - Intronic
931496867 2:62817273-62817295 TGGGCAGAGAAGGCCTCTCTGGG + Intronic
931565814 2:63614695-63614717 AGGGAAAAAGAGGTCTTTCTAGG - Intronic
932064904 2:68544756-68544778 AGGGCACATGGGACCTTTCTAGG + Intronic
933979217 2:87536939-87536961 AGGGCAATTCAGACCTTTCTGGG + Intergenic
936314608 2:111413853-111413875 AGGGCAATTCAGACCTTTCTGGG - Intergenic
936942185 2:117895823-117895845 TGGCCAAATGTGGTCTGTCTTGG + Intergenic
937085030 2:119165937-119165959 GGGCCAAGTGAGGGCTTTCTGGG - Intergenic
937574277 2:123400124-123400146 TCGGGAAAAGAGGCCTTTATTGG + Intergenic
938184068 2:129212348-129212370 TGTGCAAATGGGGCTTTTCTGGG + Intergenic
938189783 2:129266435-129266457 TGGGCCAATGAGGTCTCTCTTGG - Intergenic
939032957 2:137098558-137098580 TGTTCAAATGATGCTTTTCTAGG - Intronic
941531482 2:166676249-166676271 TGGAAAACTGAGTCCTTTCTGGG - Intergenic
945818900 2:214638835-214638857 GGGGAATATGAGCCCTTTCTTGG - Intergenic
946783957 2:223222567-223222589 TGGGCAGATGAATCCTCTCTTGG - Intergenic
946785527 2:223239458-223239480 TGGCCAAATGAGGCTTTATTTGG - Intergenic
1172787060 20:37475393-37475415 TGGGCTAGTGAAGCGTTTCTAGG - Intergenic
1173171546 20:40728721-40728743 TGGGGAAATGAGGCCTCTCGTGG + Intergenic
1173324574 20:42020925-42020947 TGAGCCATTGAGGCCTTTTTAGG - Intergenic
1173526455 20:43736690-43736712 TGGGCATCTGAGGCCTTTAGGGG + Intergenic
1174202876 20:48819434-48819456 TGGGCAAGGAAGGCTTTTCTAGG - Intronic
1175649716 20:60708990-60709012 TTAGCAAAAGAGGCCTGTCTTGG - Intergenic
1176725905 21:10432302-10432324 TGGGCAAAGGAGGCCTGCCATGG - Intergenic
1182568622 22:31218970-31218992 TCTGCAAATGAGTCCTTTTTAGG - Intronic
952986874 3:38793654-38793676 AGGGCCAAGGAGGACTTTCTGGG + Intronic
953846832 3:46434078-46434100 TGGGCAAAGGACACCTCTCTAGG + Intergenic
954943062 3:54392865-54392887 TAGGAAAAGGAAGCCTTTCTAGG + Intronic
955433312 3:58872203-58872225 TGGGCAAATGTGGACTTACTTGG - Intronic
955746114 3:62141960-62141982 TGGGCACCTGAGGCATTTCTAGG - Intronic
956999324 3:74867054-74867076 TGGGCACAGTAGGCTTTTCTTGG + Intergenic
957531455 3:81445500-81445522 TTAGCAAATCAGGCCTTGCTTGG + Intergenic
957720027 3:83982991-83983013 AGGGAAACTGAAGCCTTTCTAGG + Intergenic
959883126 3:111469364-111469386 TGGCTATATGAGGTCTTTCTTGG + Intronic
960094072 3:113671236-113671258 TGGGCAAATGAGGCCTTTCTAGG + Intronic
960321020 3:116236319-116236341 TAGGCAAATGATTCATTTCTAGG + Intronic
962092074 3:132254918-132254940 TGGCCCAATGTGGCCTTCCTGGG + Intronic
963064105 3:141249281-141249303 TTGCCCAATGAGGCCTTTTTAGG - Intronic
965731643 3:171778521-171778543 TGGTCAGAAGAGGCCTCTCTGGG + Intronic
967345627 3:188452393-188452415 GCAGCAAGTGAGGCCTTTCTGGG - Intronic
967676075 3:192300524-192300546 TGGTCAAGTCAGGTCTTTCTTGG + Intronic
969932305 4:10642468-10642490 TGGGGAGAGGAGGTCTTTCTAGG + Intronic
972059843 4:34855445-34855467 TGGGCAAGTGAGACCTGTTTTGG + Intergenic
974312850 4:60234465-60234487 TGGGAAAATGGGGCTTTTCCTGG + Intergenic
976583255 4:86765304-86765326 TTGGCTAATGAATCCTTTCTAGG + Intronic
980171318 4:129293611-129293633 TGCTCAAGTGAGGCCTTCCTCGG - Intergenic
980940128 4:139265658-139265680 TGGCCAAAAGAGGCCTTACTAGG - Intergenic
981111214 4:140935911-140935933 GGGGCACAGGAGGACTTTCTGGG - Intronic
981208618 4:142073853-142073875 AGTGAAAATGAGACCTTTCTTGG + Intronic
981515895 4:145609287-145609309 TTGGGGAATGAGGCCTTTCAGGG - Intergenic
981763376 4:148218640-148218662 TGGGCAGAAGAGACCTTTTTAGG - Intronic
984309740 4:178041794-178041816 TGGGGATATTAGGCCTTTGTTGG + Intergenic
985651449 5:1109599-1109621 TGGGCAGACGCGGCCTTGCTGGG + Intronic
988706049 5:33726924-33726946 TGGGCAGATGAGGCATCTCCTGG + Intronic
989118431 5:37979138-37979160 TGGGCAAAGTAGGCCTCACTGGG + Intergenic
989659127 5:43779959-43779981 TGTGCGTAGGAGGCCTTTCTTGG - Intergenic
991231984 5:64344727-64344749 TGGCTAAAAGAGGCCTTTCCTGG - Intronic
992132233 5:73704772-73704794 AGGCAAAATGTGGCCTTTCTGGG - Intronic
994120809 5:96110689-96110711 GGGGAAAATGAGGCCTGCCTAGG + Intergenic
994162702 5:96574345-96574367 TGGGCAAATGAGGCCGGGCGCGG - Intronic
996143795 5:119948276-119948298 TGGCCAGATGAGTGCTTTCTGGG - Intergenic
998181862 5:139951631-139951653 TGGGCCAAGGAGGCATCTCTGGG - Intronic
998444986 5:142191671-142191693 TGGGCCACAGAGGCCTTTCCTGG - Intergenic
998961733 5:147494971-147494993 TTGGCAAATTATGCCTTTCGAGG - Intronic
1000370190 5:160527768-160527790 TGGGGAAATGGGACCTTCCTGGG - Intergenic
1004186017 6:13421849-13421871 CGGGCACACGAGGCCTTTCCCGG + Intronic
1006380555 6:33694860-33694882 TTTCTAAATGAGGCCTTTCTAGG + Intronic
1008602957 6:53113297-53113319 TGGGCAAATCATGCTTCTCTGGG - Intergenic
1009220300 6:60975602-60975624 TGGGCCAAGGAGGCCATCCTGGG - Intergenic
1011130761 6:84049868-84049890 TGGGTAATTGAGTACTTTCTAGG + Intronic
1011773406 6:90700833-90700855 TAGGAAAATGAGGCTTTTCATGG - Intergenic
1012091254 6:94900956-94900978 TGGGAAAATCAGGTCTTTATGGG - Intergenic
1014809296 6:125867785-125867807 TAGGCAATTTAGGCCTTTCCTGG + Intronic
1016365757 6:143316298-143316320 TGGGCAAAGGGGATCTTTCTTGG - Intronic
1019488671 7:1301030-1301052 TGAGTCAATGAGGCCTTTCCTGG - Intergenic
1019649837 7:2150822-2150844 TGGGCAGAGGAGGCCTCTCTGGG - Intronic
1021367339 7:19796009-19796031 TTGGAAAATGAGGTTTTTCTTGG - Intergenic
1025765999 7:64450959-64450981 AAGGCAAATAAGGCCTTTCTAGG + Intergenic
1033658093 7:143386719-143386741 GGGGCAACTAAGGCTTTTCTGGG + Intronic
1035439799 7:158887166-158887188 TCTGCAAATGAGCCCTGTCTCGG - Intronic
1036593681 8:10192813-10192835 TGGGCTGAGGAGGCCCTTCTGGG + Intronic
1037804645 8:22052359-22052381 TGGGCCAATGACTTCTTTCTAGG - Intronic
1039171934 8:34757586-34757608 TGAGCAAATGATGCCCTTATAGG - Intergenic
1040047033 8:42974976-42974998 AGGGCCTAGGAGGCCTTTCTTGG - Intronic
1040834437 8:51717725-51717747 TGGGCCAATGAGGCCTATCCTGG - Intronic
1042020188 8:64364693-64364715 TTGGCAAATGAACCCTTTCCCGG + Intergenic
1044269775 8:90228268-90228290 TGGGCAACTCAGGCCATTATTGG + Intergenic
1045827072 8:106410887-106410909 TGAACAAATGAGTCATTTCTGGG - Intronic
1047864350 8:129005345-129005367 TGGGCAGATGACGACTTTGTTGG + Intergenic
1048074517 8:131054748-131054770 TGGGCAACTGAGCACTTTATGGG + Intergenic
1050051678 9:1608645-1608667 TGGACCAAGAAGGCCTTTCTGGG + Intergenic
1050171144 9:2818270-2818292 TCGGCAAATCAGGCCATTCAGGG + Intronic
1051409242 9:16771762-16771784 TTAGCAAAAGATGCCTTTCTAGG - Intronic
1052371612 9:27671606-27671628 TGGGTAAATGAGCTGTTTCTTGG + Intergenic
1058529464 9:105891267-105891289 TGGGTAAATGTGACCTTTTTTGG - Intergenic
1059402308 9:114078004-114078026 TGGGCAAGTGCGGCCTGTCTCGG - Intronic
1059528145 9:115012170-115012192 TGGGAAACAGAGGCCTTTATTGG + Intergenic
1061049961 9:128189433-128189455 TGGGCACATGACCCCTCTCTGGG + Intronic
1061317231 9:129803755-129803777 GGGCCAAATGTGGGCTTTCTGGG - Intronic
1185731484 X:2465231-2465253 TGGGAAAATGAGGCTCTTCAGGG + Intronic
1185732963 X:2475816-2475838 TGGGAAAATGAGGCTCTTCAGGG + Intronic
1187910551 X:24107164-24107186 TGGGCAAAGGAGGCCATGCGTGG - Intergenic
1188551756 X:31372478-31372500 TGTGCAAATTAGGCCTCTTTCGG + Intronic
1189320662 X:40085154-40085176 CGCGCAAATGAGGCCTGCCTCGG + Intronic
1192435276 X:71139504-71139526 TGATCAAAAGAGCCCTTTCTGGG - Intronic
1192830102 X:74742306-74742328 TGTTCAAATGAGCCCTCTCTTGG - Exonic
1195694019 X:107653452-107653474 TAGGAAAATGATGCTTTTCTGGG + Intergenic
1198159190 X:133990022-133990044 AGGGGCAATGAGGCCTTTTTTGG + Intergenic
1201944508 Y:19497276-19497298 GGTGCAAATGAGGCCTACCTTGG + Intergenic